Next Article in Journal
Genomic Characterization of Selected Escherichia coli Strains from Catfish (Clarias gariepinus) in Nigeria
Previous Article in Journal
Interaction between Trichoderma sp., Pseudomonas putida, and Two Organic Amendments on the Yield and Quality of Strawberries (Fragaria x annanasa cv. San Andreas) in the Huaral Region, Peru
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Multiplex-PCR Detection of an Atypical Leuconostoc mesenteroides subsp. jonggajibkimchii Phenotype Dominating the Terminal Spoilage Microbial Association of a Fresh Greek Whey Cheese Stored at 4 °C in Vacuum

by
Nikoletta Sameli
1,†,‡,
Eleni Sioziou
1,†,§,
Loulouda Bosnea
1,
Spiros Paramithiotis
2,* and
John Samelis
1,*
1
Department of Dairy Research, Institute of Technology of Agricultural Products, Hellenic Agricultural Organization—DIMITRA, Ethnikis Antistaseos 3, Katsikas, 45221 Ioannina, Greece
2
Department of Biological Applications and Technology, University of Ioannina, 45110 Ioannina, Greece
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Current address: Carlsberg Research Laboratory, J.C. Jacobsens Gade 4, 1799 Copenhagen V, Denmark.
§
Current address: Aphea.Bio, Technologiepark 21, 9052 Zwijnaarde, Belgium.
Appl. Microbiol. 2024, 4(3), 1124-1141; https://doi.org/10.3390/applmicrobiol4030076
Submission received: 7 June 2024 / Revised: 22 July 2024 / Accepted: 22 July 2024 / Published: 24 July 2024

Abstract

A species-specific multiplex-PCR method and phenotypic tests were combined to evaluate biochemical and genotypic differences between 24 representative Leuconostoc mesenteroides diverse isolates previously found to dominate in spoiled, vacuum-packed Anthotyros whey cheeses stored at 4 °C for 40 days and identified by 16S rRNA gene sequencing. Based on their phenotypic (API 50 CHL) profiles, the 24 isolates comprised 6 multi-strain and 7 single-strain biotypes. Only two single-strain biotypes (L4A and L4B) produced slime (dextran) from sucrose, and only four biotypes (L2A–L2C, L3; 7 isolates) fermented L-arabinose; the remaining 15 isolates (biotypes L1A–L1F) were dextran-negative, oligofermenting Ln. mesenteroides variants, able to ferment D-xylose and grow at 37 °C. Based on their multiplex-PCR (rpoB, araA, dsr, and sorA) gene profiles in comparison with those of the type strains of the four Ln. mesenteroides subsp. cremoris (rpoB), dextranicum (rpoB/dsr), mesenteroides (rpoB/araA/dsr/sorA), and jonggajibkimchii (rpoB/araA/dsr), no isolate was assigned to the first two subspecies and only four isolates (L2A and L2C) to the subsp. mesenteroides. Ten isolates shared the subsp. jonggajibkimchii profile, while the other ten ones have a fifth atypical profile (rpoB/dsr/sorA), seemingly being closer to the subsp. dextranicum. Particularly the atypical biotype L1B representatives of the most prevalent psychrotrophic Ln. mesenteroides subsp. jonggajibkimchii (rpoB/araA/dsr) genotype at Anthotyros whey cheese spoilage deserve further biochemical and molecular characterization studies.

1. Introduction

Traditional cheeses, yogurt, sour cream, and acidified milks are naturally preserved by indigenous starter or non-starter lactic acid bacteria (LAB) strains or consortia [1,2,3], which are beneficial except in rare cases where they cause bitterness, flavor defects, such as fruity or malty off flavors, or textural defects, such as unwanted gas pockets, slits or excessive blowing by CO2 formation, and ropiness (slippery mouth-feel) by exopolysaccharides formation in cheese [4,5,6,7]. Overall, the term ‘dairy spoilage LAB’ remains controversial in the milk industry [8] because, in principle, souring and clotting of raw milk at ambient or cold storage temperatures is a milder and often beneficial natural-LAB fermentative spoilage process [9] compared to various offensive types of spoilage manifested when psychrotrophic Gram-negative bacteria, mainly Pseudomonas spp., Gram-positive spore-forming bacteria, or yeast contaminants predominate in raw or processed milk and dairy products [10,11,12,13]. In this context, prevention of post-thermal LAB contamination and growth is a prerequisite in relatively few dairy technologies, with fresh, ready-to-eat (RTE) whey cheeses produced by heating the remaining whey after the manufacture of typical rennin-coagulated cheeses at high temperatures (>80–95 °C) and collection of the water-soluble milk protein coagulum, being the most prominent non-fermented dairy product category, preceded by the Italian-style Ricotta-type cheeses globally [14].
Fresh whey cheeses (pH > 6.0–6.8; moisture > 60–80%; salt < 1%) have a limited (<7 to max. 33 days) shelf-life when stored aerobically at 6–25 °C [15] because they are prone to post-thermal microbial contamination, with psychrotrophic Pseudomonas and Enterobacteriaceae spp., and occasionally Bacillus spp., being the major spoilers [14,16,17,18]. Vacuum and MAP are convenient (active) packaging methods to extend the shelf-life of cold-stored RTE Ricotta and other whey cheese types by shifting the microbial spoilage association in favor of autochthonous or intentionally added psychrotrophic LAB strain cultures [14,16,19,20]. Likewise, a progressive numerical dominance of fermentative LAB spoilers over Pseudomonas, Aeromonas, Hafnia, and Serratia spp. occurred during refrigerated, vacuum-packed storage of fresh Greek Anthotyros whey cheeses [21]. We reported, for the first time, that after 40 days at 4 °C (i.e., at the commercial sell-by-date of Anthotyros cheese), the terminal spoilage LAB community was dominated by autochthonous Leuconostoc spp. (80%), followed by Carnobacterium maltaromaticum (10.9%). Specifically, 95.8% of the Leuconostoc isolates were identified as typical and mostly atypical Ln. mesenteroides strains by 16S rRNA gene sequencing and basic phenotypic tests [21].
Leuconostoc mesenteroides is a taxonomically complex species currently consisting of four subspecies, namely mesenteroides, dextranicum, cremoris, and jonggajibkimchii, while Ln. mesenteroides subsp. suionicum [22] was raised to the species level by Jeon et al. [23]. The first three subspecies are commonly found in milk and dairy products [24], particularly as subdominant members of the diverse autochthonous LAB biota in traditional (raw milk) cheeses [1,3,25,26,27,28,29], including Greek cheeses [30,31,32,33,34,35]. They exert beneficial catabolic activities during cheese fermentation and ripening and thus are used as flavor formers in mixed dairy starter cultures [3,36]. Especially Ln. mesenteroides subsp. mesenteroides is ubiquitous and develops in plant material [37], meat [38], fish, and other food products [39,40], either as a natural or commercial starter or as a spoiler [41,42,43], and the type strain was isolated from fermenting olives [23]. In contrast, Ln. mesenteroides subsp. cremoris is an exclusive dairy LAB [36,39], with its type strain originating from a Hansen’s dried cheese starter powder [23]. Of note, the new subspecies jonggajibkimchii, originating from traditional Korean kimchi [23], has started being detected as a subdominant, but important, LAB in dairy foods, such as traditional ‘Torta’ cheeses from Spain [27] and brine cheeses from Montenegro [29], naturally fermented cow and yakmilk products from India [44], and raw sheep milk from native breeds in Greece [45]. The aforementioned subspecies of Ln. mesenteroides are highly intermixed phenotypically and thus cannot be differentiated by biochemical criteria, except for the oligofermenting Ln. mesenteroides subsp. cremoris industrial starter (type) strain/s [39]. However, neither the atypical Ln. mesenteroides isolates from spoiled Anthotyros cheese shared the typical Ln. mesenteroides subsp. cremoris phenotype nor their 16S rRNA gene profiling by the Sanger sequencing method provided an accurate subspecies identification for any of them [21]. Hence, this research represents an advanced follow-up study aiming to classify our atypical whey cheese spoilage Ln. mesenteroides isolates at the subspecies level based on the multiplex-PCR (rpoB, araA, dsr, and sorA) method of Ricciardi et al. [46], as it was recently applied for the first detection and genotypic characterization of two Ln. mesenteroides subsp. jonggajibkimchii isolates from refrigerated raw bulk Epirus sheep milk [46].

2. Materials and Methods

2.1. Whey Cheese Spoilage Isolates and Culture Conditions

Twenty-six Leuconostoc spp. isolates from two terminally spoiled Anthotyros batches (C and D) stored at 4 °C without (CN) or with (Ent+) a crude enterocin A-B-P-containing extract added to the fresh whey cheese samples before vacuum packaging [21] were studied (Table 1): 24 isolates were diverse representative strains of the complex species Ln. mesenteroides, differentiated into four main biotypes, L1 to L4, on the basis of five key phenotypic traits [21], while two isolates represented a variant biotype L5, identified as Ln. lactis (Table 1). Species identifications were based on 16S rRNA gene sequencing of 13 representative isolates [21], indicated in bold in Table 1. Four variable pairs of Ln. mesenteroides isolates (WM109A/B; WM110A/B; WM122A/B; and WM125A/B) obtained after re-purification of the original stock cultures were among the selected isolates to elucidate whether their colony size variability following growth on streaked agar plates was due to polymorphism of a pure strain culture or due to the presence of contaminated (mixed) strain cultures.
All isolates were resuscitated from their frozen (−30 °C) stock state in 20% (w/v) glycerol [21] by subculturing them in 5 mL portions of de Man Rogosa Sharpe (MRS) broth (Neogen Culture Media; formerly Lab M, Heywood, UK) at 30 °C. Following growth, all isolates were streaked on MRS agar (Neogen) plates for 72 h, and one single colony from each isolate was transferred for growth in 10 mL MRS broth, as above, to ensure culture purity. Then, all fresh cultures were activated by two sequent transfers of 100 μLin 10 mL of MRS broth, incubated at 30 °C for 24 h, before use in the experiments.

2.2. Biochemical Differentiation of the Leuconostoc spp. Isolates

All representative isolates (Table 1) were retested for their Gram-positive and catalase-negative reactions, as well as for colony appearance, cell morphology, growth at 4, 10, 37, and 45 °C in MRS broth, gas (CO2) production from glucose, ammonia (NH3) production from arginine, slime formation from sucrose, and the fermentation of 13 basic (key) sugars, purchased from Merck (Darmstadt, Germany) or Fluka (Sigma Aldrich Chemie GmbH, Steinheim, Germany) in pre-sterilized 96-well miniplates, as described by Sameli et al. [21]. Retesting was necessary to confirm the genus- and species-specific phenotypic traits of the selected psychrotrophic Ln. mesenteroides and Ln. lactis isolates. All phenotypic tests were performed twice. Lastly, to improve the biochemical discrimination of the Leuconostoc spp. isolates, the entire sugar fermentation profile of each different strain biotype was determined by the API 50 CHL identification kit (BioMerieux, Marcy l’ Etoile, Lyon, France), according to the manufacturer’s instructions.

2.3. Differentiation and Identification of the Leuconostoc spp. Isolates by Multiplex-PCR

Actively growing cultures of the selected isolates were inoculated into MRS broth and incubated at 30 °C for 24 h. The cell biomass contained in two 1.5 mL portions from each 24h culture was collected by centrifugation (12,000 rpm, 10 min, 4 °C) and washed twice with sterile saline. DNA extraction was performed by modifying the method of Querol et al. [47] according to the analytical procedure detailed by Tsafrakidou et al. [48]. The final clean pellet containing the DNA of each isolate was suspended in 100 μL TE buffer (pH 8.0, 50 mM Tris-HCl, 20 mM EDTA) and kept at −20 °C until the analysis.
The multiplex-PCR method of Ricciardi et al. [46] was used, as described by Sioziou et al. [45]. Three reference Ln. mesenteroides strains isolated from traditional Greek cheeses, Ln. mesenteroides subsp. dextranicum ACA-DC 0231, Ln. mesenteroides subsp. dextranicum ACA-DC 0493, and Ln. mesenteroides subsp. mesenteroides ACA-DC 0750, kindly provided by Professor E. Tsakalidou, Laboratory of Dairy Research, Agricultural University of Athens, Greece, were used as positive controls in the multiplex-PCR assays, according to Sioziou et al. [45]. Moreover, to demonstrate the species specificity of this method within the genus Leuconostoc, both Ln. lactis isolates, WM118 and WM129 (Table 1) were used as negative (i.e., outer species within the same LAB genus) controls.
Briefly, fresh MRS broth cultures (30 °C, 24 h) of the three reference Ln. mesenteroides strains were used for DNA extraction, as described above; moreover, the DNA extracts of the selected Leuconostoc isolates (Table 1) previously used for the 16S rRNA gene sequencing analysis [21] were subsequently used for the multiplex-PCR assay (presence/absence of the genes: beta subunit of RNA polymerase, rpoB; L-arabinose isomerase, araA; dextransucrase, dsr; PTS-sorbose transporter subunit IIC, sorA) [45,46]. The primers for detecting each of the four genes are listed in Table 2. Specifically, PCRamplifications were performed using 25 ng of total bacterial DNA, 1 μM of rpoB primers, 0.5 μM of araA primers, 0.3 μM of dsr primers, and 0.1 μM of sorA primers (Table 2) in 25 μL reaction mixtures using the Kapa Taq PCR kit (Kapa Biosystems), according to the manufacturer’s instructions. PCR was performed in the DNA Engine Peltier Thermal Cycler (BioRad) using the following steps: 5 min at 95 °C, 30 cycles of denaturation at 95 °C for 30 s, annealing at 60 °C for 60 s, extension at 72 °C for 90 s, and a final extension of 10 min at 72 °C. PCR products were separated in 1.2% agarose gel stained with ethidium bromide [45].

3. Results

3.1. Biotyping of the Whey Cheese Spoilage Leuconostoc spp. Isolates

All 26 isolates (Table 1) were confirmed to be obligatory heterofermentative, arginine-negative LAB cocci or coccobacilli, able to promote weak visible growth in MRS broth after 10 days at 4 °C, and good to excellent growth after 2 to 7 days at 10 °C or after 16 to 48 h at 37 °C, respectively, while none grew at 45 °C. Additionally, as shown in Figure 1, all Leuconostoc spp. isolates shared the following important biotechnological traits: (i) in addition to the glucose fermentation in MRS broth, they fermented lactose and galactose rapidly (i.e., at ca. 6 h of incubation at 30 °C in miniplates), reflecting their high affinity for growth in milk and (fresh whey) cheese; (ii) also, while all isolates fermented sucrose, only two of them, WM107 and WM108, produced slime from sucrose, i.e., the primary (key) phenotypic trait for their assignment to biotype L4 (Figure 1) originally defined to include all Ln. mesenteroides isolates from the spoiled Anthotyros cheese products that were slime (dextran)producers [21].
In addition to that, the two major slime (dextran)-negative Ln. mesenteroides biotypes, L1 (L-arabinose- and raffinose-negative) and L2 (L-arabinose- and raffinose-positive), were split into six (L1A to L1F) and three (L2A to L2C) strain biotypes (Figure 1). Of note, both isolates of two Ln. mesenteroides pairs, WM110A/B and WM125A/B, were assigned to the same biotype, L2B or L1E, respectively, whereas each of the remaining two pairs, WM109A/B and WM122A/B, included diverse isolates assigned to the separate biotypes L1B or L1D and L2A or L2C, respectively. Additional constant traits were the ability of all Ln. mesenteroides biotype L1, L2, and L3 isolates to ferment trehalose and D-xylose, but not cellobiose and sorbitol; maltose, mannitol, melibiose, and ribose were fermented variably (Figure 1).
Solely based on the key phenotypic taxonomic criteria for the differentiation of the oligofermenting Ln. mesenteroides subsp. cremoris from the subsp. dextranicum and mesenteroides [39,49], it was noteworthy that the most prevalent, slime (dextran)-negative, L-arabinose-negative isolates in biotypes L1A to L1F, as well as the two most atypical, slime (dextran)-positive but L-arabinose-negative isolates in biotypes L4A and L4B, fermented fewer basic sugars compared to the also atypical, L-arabinose-positive but slime (dextran)-negative, biotypes L2A to L2C and L3 (Figure 1). Clearly, for taxonomic and biotechnological reasons discussed in later paragraphs, the most interesting Ln. mesenteroides biotype was L1B due to its high prevalence in the Anthotyros batches C and D at spoilage [21] and because all L1B isolates failed to ferment D-maltose despite being able to ferment D-xylose strongly (Figure 1). Lastly, the isolates WM118 and WM129 comprised a constant biotype L5, typical of Ln. lactis, which differed from the Ln. mesenteroides biotypes L1A to L4B in failing to ferment trehalose (Figure 1).
To advance biotyping at strain level, 14 Ln. mesenteroides isolates were tested using the API 50 CHL method (Table 3). Their entire fermentation profiles, which are sorted vice versa in Table 3 (i.e., from the isolates with the richest to those with the poorest profiles), indicated that all six isolates of the homogeneous oligofermenting biotype L1B differed further from the isolates in biotypes L2C (WM105), L3 (WM121), L1E (WM119), L1F (WM106), L1D (WM117), and L4B (WM107), which formed a quite heterogeneous Ln. mesenteroides group of strains, in failing to ferment α-methyl-D-glucopyranoside (MDG), esculin, and turanose. The maltose-positive isolate WM137 (L1C), which also failed to ferment the above three sugars, was an intermediate strain, seemingly closer to the L1B isolates. Of note, the most oligofermenting strain, WM124 (L1A), failed to ferment D-xylose by the API method, and thus, it was moved together with strain WM108 (L4A). Lastly, we confirmed that the two trehalose-negative Ln. lactis isolates had an identical API 50 CHL profile, which differed from the profiles of all Ln. mesenteroides biotypes (Table 3). Therefore, to resolve the very high intra-species phenotypic heterogeneity of the whey cheese spoilage Ln. mesenteroides isolates (Figure 1, Table 3), it was necessary to determine the subspecies-specific gene profiles by multiplex-PCR.

3.2. Classification of the Whey Cheese Spoilage Ln. mesenteroides Isolates by Multiplex-PCR—Prevalence of Isolates with a Gene Profile Specific to Ln. mesenteroides subsp. jonggajibkimchii

The results of the multiplex-PCR analysis for the presence of rpoB, araA, dsr, and sorA in the genome of the 24 Ln. mesenteroides isolates, defined as profiles S1 to S5, are shown in Table 4 in comparison with the respective gene profiles of the type strains of the four subspecies, cremoris, dextranicum, jonggajibkimchii, and mesenteroides, adapted from the decision tree of the Ricciardi et al. [46] study, the three reference Ln. mesenteroides strains, ACA-DC 0750, ACA-DC 0493, and ACA-DC 0231 [45], and the two Ln. lactis control (outer species) isolates sorted last in Table 4. The PCR gene band profiles of 13/26 Leuconostoc spp. isolates, including Ln. lactis WM118, are illustrated in Figure 2; the gene band profiles of the ACA-DC strains were previously illustrated by Sioziou et al. [45].
The multiplex-PCR results confirmed that all Ln. mesenteroides whey cheese isolates (Table 1), as well as the three ACA-DC strains, possessed the rpoB gene (Table 4), which is species-specific [46]. Indeed, rpoB was not detected in the genome of Ln. lactis WM118 and WM129, which displayed blank (noband) profiles (Table 4, Figure 2), confirming the species specificity of the multiplex-PCR method. In addition to that, as we anticipated by relying on the biotyping data (Figure 1; Table 3), none of our isolates was assignable to Ln. mesenteroides subsp. cremoris, whose type strain possesses the rpoB gene but lacks the araA, dsr, and sorA genes (multiplex-PCR profile S1) from its genome (Table 4).
Unexpectedly, neither the S2 (rpoB/dsr) gene profile of the Ln. mesenteroides subsp. dextranicum type strain orthe reference ACA-DC 0493 strain was detected in any of the 24 Ln. mesenteroides isolates by the multiplex-PCR method, which distinguished them into two major (S3 and S5) and one minor (S4) geneprofile group, including 10, 10, and 4 whey cheese isolates, respectively (Table 4). Among them, only the minor group S4 possessed the complete gene (rpoB/araA/dsr/sorA) profile of typical Ln. mesenteroides subsp. mesenteroides strains [46], including the ACA-DC 0750 reference strain (Table 4). Unsurprisingly, the multi-fermenting isolates WM103, WM105, and WM122B in biotype L2C possessed the S4 gene profile of the subspecies mesenteroides. The isolate WM122A, assigned singly to the biotype L2A, belonged to the subspecies mesenteroides, too (Figure 2). Conversely, altogether ten phenotypically intermixed isolates, representing variable oligofermenting strain biotypes (L1A, L1D, L1E, L1F, L3, and L4B) being unable to ferment L-arabinose and/or D-raffinose (i.e., unlike the basic biotype L2) (Figure 1; Table 3), shared the S5 gene profile (rpoB/dsr/sorA) (Table 4; Figure 2). Thus, they were atypical ‘intermediate’ strains of the subspecies mesenteroides and dextranicum [45], including the reference strain Ln. mesenteroides subsp. dextranicum ACA-DC 0231 (Table 4).
However, the most prominent finding was that all Ln. mesenteroides isolates encompassing the most prevalent, oligofermenting biotype L1B and the unique, dextran-forming D-xylose-negative WM108 (L4A) isolate (Figure 1; Table 3) shared the S3 (rpoB/araA/dsr) gene profile that is possessed by the Ln. mesenteroides subsp. jonggajibkimchii type strain (Table 4; Figure 2). The S3 profile was possessed by an additional three atypical Ln. mesenteroides isolates: (i) the single-strain WM137 being very similar (L1C) with the L1B isolates; and (ii) WM110A and WM110B, an isolate pair that was assigned singly (L2B) with respect to its phenotype, indicating it was another unique Ln. mesenteroides strain, too. The fact that this particular L-arabinose-positive, multi-fermenting strain WM110A/B shared the S3 (rpoB/araA/dsr) jonggajibkimchii profile with the L-arabinose-negative, oligofermenting L1B isolates (Table 4; Figure 2) was in sharp contrast to the high phenotypic resemblance of its biotype L2B with the typical Ln. mesenteroides subsp. mesenteroides L2C isolates (Figure 1; WM105 in Table 3).
Table 3. Comparison of the entire (API 50 CHL-based) sugar fermentation profiles of the most prevalent strain biotypes of Leuconostoc mesenteroides and Leuconostoc lactis isolated from two batches of terminally spoiled Anthotyros whey cheese after storage at 4 °C for 40 days 1.
Table 3. Comparison of the entire (API 50 CHL-based) sugar fermentation profiles of the most prevalent strain biotypes of Leuconostoc mesenteroides and Leuconostoc lactis isolated from two batches of terminally spoiled Anthotyros whey cheese after storage at 4 °C for 40 days 1.
Species Identification/
Isolate Code
Strain
Biotype
LAra
4
Rib
5
DXyl
6
Gal
10
Glu
11
Fru
12
Mne
13
Man
18
MDG
21
NAG
22
Arb
24
Esc
25
Sal
26
Mal
28
Lac
29
Mel
30
Sac
31
Tre
32
Raf
35
Tur
40
Ln. mesenteroides
WM105L2C+++++++(+)d++(+)+++++++++
WM121L3+++++++(+)d++(+)++++-++-+
WM119L1E--+++++(+)d++(+)(+)+++-++-+
WM106L1F--+++++-++-(+)++++++-+
WM107L4B--+++++-++-(+)-++-++-+
WM117L1D--+++++-++-(+)-++-++-+
WM137L1C--+++++--+---++-++--
WM136L1B--+++++--+----+-++--
WM138L1B--+++++--+----+-++--
WM147L1B--+++++--+----+-++--
WM151L1B--+++++--+----+-++--
WM153L1B--+++++--+----+-++--
WM108L4A---++++--+----+-++--
WM124L1A---++++--+----+-++--
Ln. lactis
WM118L5---++++--+---++++-+-
WM129L5---++++--+---++++-+-
1 Sugars are tabulated from left to right according to their abbreviated code names and their numerical order (1 to 49) followed in the API-50 identification strips; only the positive or weakpositive [(+)/(+)d sugar] fermentation reactions for at least one of the tested strains are profiled to allow comparison of the diverse strain biotypes; MDG, α-Methyl-D-Gluconopyranoside; NAG, N-AcetylGlucosamine. Additionally, all strains gave negative reactions with the following sugars: glycerol (1), erythritol (2), D-arabinose (3), L-xylose (7), adonitol (8), β-Methyl-D-Xylopyranoside (9), sorbose (14), rhamnose (15), dulcitol (16), inositol (17), sorbitol (19), α-Methyl-D-Mannopyranoside (20), amygdalin (23), cellobiose (27), inulin (33), melezitose (34), amidon (36), glycogen (37), xylitol (38), gentibiose (39), lyxose (41), tagatose (42), D-fucose (43), L-fucose (44), D-arbitol (45), L-arbitol (46), gluconate (47), 2-keto-gluconate (48), and 5-keto-gluconate (49). +, positive reaction; (+), weak positive reaction; -, negative reaction.
Table 4. Multiplex-PCR profiles of the 24 representative Leuconostoc (Ln.) mesenteroides isolates from two spoiled Anthotyros whey cheese batches relative to the presence of the rpoB, araA, dsr, and sorA in their genome in comparison with the respective profiles of the type strains of the four Ln. mesenteroides subspecies and three reference strains from traditional Greek cheeses and correlation with the strain biotype assignment of each isolate 1.
Table 4. Multiplex-PCR profiles of the 24 representative Leuconostoc (Ln.) mesenteroides isolates from two spoiled Anthotyros whey cheese batches relative to the presence of the rpoB, araA, dsr, and sorA in their genome in comparison with the respective profiles of the type strains of the four Ln. mesenteroides subspecies and three reference strains from traditional Greek cheeses and correlation with the strain biotype assignment of each isolate 1.
Species IdentificationStrain
Code
Target Genes Detected
by Multiplex-PCR
Subspecies
Identification
ReferenceMultiplex
Profile
Basic
Biotype
Updated
Biotype
Reference strains (literature/our previous data)rpoBaraAdsrsorA
Ln. mesenteroidesATCC 19254T+---cremoris[46]S1NANA
Ln. mesenteroidesDSM 20484T+-+-dextranicum[46]S2NANA
Ln. mesenteroidesDRC1506T+++-jonggajibkimchii[46]S3NANA
Ln. mesenteroidesATCC 8293T++++mesenteroides[46]S4NANA
Ln. mesenteroidesACA-DC 0750++++mesenteroides[45]S4NANA
Ln. mesenteroidesACA-DC 0493+-+-dextranicum[45]S2NANA
Ln. mesenteroidesACA-DC 0231+-++dextranicum (atypical)[45]S5NANA
Anthotyros cheese strains This study
Ln. mesenteroidesWM124+-++dextranicum (atypical) S5L1L1A
Ln. mesenteroidesWM109A+++-jonggajibkimchii S3L1L1B
Ln. mesenteroidesWM136+++-jonggajibkimchii S3L1L1B
Ln. mesenteroidesWM138+++-jonggajibkimchii S3L1L1B
Ln. mesenteroidesWM147+++-jonggajibkimchii S3L1L1B
Ln. mesenteroidesWM151+++-jonggajibkimchii S3L1L1B
Ln. mesenteroidesWM153+++-jonggajibkimchii S3L1L1B
Ln. mesenteroidesWM137+++-jonggajibkimchii S3L1L1C
Ln. mesenteroidesWM109B+-++dextranicum (atypical) S5L1L1D
Ln. mesenteroidesWM117+-++dextranicum (atypical) S5L1L1D
Ln. mesenteroidesWM119+-++dextranicum (atypical) S5L1L1E
Ln. mesenteroidesWM123+-++dextranicum (atypical) S5L1L1E
Ln. mesenteroidesWM125A+-++dextranicum (atypical) S5L1L1E
Ln. mesenteroidesWM125B+-++dextranicum (atypical) S5L1L1E
Ln. mesenteroidesWM106+-++dextranicum (atypical) S5L1L1F
Ln. mesenteroidesWM122A++++mesenteroides S4L2L2A
Ln. mesenteroidesWM110A+++-jonggajibkimchii S3L2L2B
Ln. mesenteroidesWM110B+++-jonggajibkimchii S3L2L2B
Ln. mesenteroidesWM103++++mesenteroides S4L2L2C
Ln. mesenteroidesWM105++++mesenteroides S4L2L2C
Ln. mesenteroidesWM122B++++mesenteroides S4L2L2C
Ln. mesenteroidesWM121+-++dextranicum (atypical) S5L3L3
Ln. mesenteroidesWM108+++-jonggajibkimchii S3L4L4A
Ln. mesenteroidesWM107+-++dextranicum (atypical) S5L4L4B
Ln. lactisWM118----None (N/A) No bandsL5L5
Ln. lactisWM129----None (N/A) No bandsL5L5
1 The Ln. lactis isolates coded WM118 and WM129 were used as negative (outer species) controls in the multiplex-PCR analysis. NA, not analyzed in the course of this study. +, presence of the target gene in the strain’s genome; -, absence of the target gene in the strain’s genome.

4. Discussion

Apart from being phenotypically intermixed, the first three food (dairy)-associated subspecies of Ln. mesenteroides, namely cremoris, dextranicum, and mesenteroides (i.e., defined before the introduction of molecular typing methods) [50], share very high genotypic relatedness and interrelationships, which cause difficulties in differentiating between them [36,51]. Additionally, it is well documented that the subspecies dextranicum and mesenteroides encompass atypical slime (dextran)-negative strains that display variable sugar fermentation patterns [46]; based on their phenotype/s, such Ln. mesenteroides variants can easily be misclassified with the closelyrelated Ln. lactis and Ln. pseudomesenteroides or even as Weissella paramesenteroides [52,53,54]. Generally, the species and mainly the subspecies delineation of newly isolated, autochthonous (beneficial or spoilage) Ln. mesenteroides strains from traditional dairy, meat, or plant foods is a challenge [24,37,54], including the newest fourth subspecies, jonggajibkimchii, which is phenotypically and genomically intermixed, too [23,43]. Therefore, over time, various molecular identification and typing techniques, such as 16S rRNA gene sequencing, RAPD-PCR, rep-PCR, multiplex-PCR, species-specific PCR, 16S PCR-RFLP, PFGE, ARDRA, MLST, and partial sequencing of housekeeping genes [22,25,26,33,36,37,53,55,56,57,58,59] and, more recently, MALDI-TOF MS profiling [27,33,60], have been proposed to differentiate Ln. mesenteroides and its subspecies. While all the above techniques have shown success in distinguishing the type/reference or native strains tested at the species level (i.e., from Ln. pseudomesenteroides, Ln. lactis, and Ln. citreum), most of them, including 16S rDNA sequencing, have been insufficient to classify Ln. mesenteroides at the subspecies level, despite the valid strain profiling differentiations provided [36,53,57,60]. Recent studies have demonstrated that more powerful WGS analyses provide robust support [23,43,51]; however, these approaches cannot be applied routinely in food laboratories due to the specific expertise and tools required [46]. Conversely, the faster and readily applicable multiplex-PCR approach used in this study was successful in differentiating all representative Ln. mesenteroides isolates from the two Ln. lactis (outer species) isolates, in alignment with their preceding basic phenotypic characterization and 16S rRNA gene identification [21]. Additionally, a highly constant genotypic differentiation of the 24 biochemically diverse Ln. mesenteroides isolates in three distinct multiplex-PCR profiles, S3 (41.7% of the isolates), S4 (16.6%), and S5 (41.7%), was achieved: the atypical S3 and S4 isolates were more homogeneous biochemically and matched the subspecies jonggajibkimchii and mesenteroides type strains, respectively, whereas the S5 isolates represented an intermixed group of several atypical strain biotypes seemingly closer to the subspecies dextranicum (Table 4). The fact that none of the autochthonous whey cheese spoilage Ln. mesenteroides isolates possessed the cremoris S1 profile, deficient of the araA, dsr, and sorA genes (Table 4), was an important confirmatory finding, particularly with regard to the six slime-negative and oligofermenting strain biotypes L1A to L1F (Figure 1), all grown at 37 °C. It is well documented that the subspecies cremoris strains neither grow at 37 °C (having an optimal between 18 °C and 25 °C) nor produce dextran from sucrose [24,39]. Additionally, all of them ferment a limited number of carbohydrates compared to the subspecies mesenteroides and dextranicum encompassing dextran-producing strains, capable of growth at 37 °C, including the type strains ATCC 8293T (DSM 20343T) and ATCC 19255T (DSM 20484T), respectively [39,49]. Specifically, all cremoris strains ferment glucose and lactose, while the fermentation of galactose and maltose is strain-specific, being positive and negative, respectively, in most strains [39]. All other basic sugars, including the key taxonomic ones L-arabinose, cellobiose, trehalose, and D-xylose (Figure 1), are not fermented by the ATCC 19254T (DSM 20346T) strain or any other typical cremoris strain, although sucrose-fermenting mutants have been reported since 1966 [22,39,49]. Gu et al. [22] highlighted that the subsp. cremoris strains do not ferment aesculin, salicin, and melibiose either. Moreover, later comparative studies based on advanced pan-genomic and transcriptomic analyses confirmed that the type strains of the four Ln. mesenteroides subspecies shared very high 16S rRNA gene sequence similarities (>99.72%) and could not be differentiated by this method, which is inappropriate to infer the phylogenetic relationships of Ln. mesenteroides strains [23,36,43,51]. In accordance with the literature, we could not identify the subspecies of our autochthonous whey cheese spoilage Ln. mesenteroides isolates by the Sanger 16S rRNA gene sequencing method either [21], which prompted us to follow the multiplex-PCR approach of Ricciardi et al. [46].
Ricciardi et al. [46] reported that sequence analysis of the rpoB gene and comparison of the rpoB amino acid sequences clearly separated the subspecies cremoris group but were not conclusive for the other strains. Specifically, in the phylogenetic tree of partial rpoB gene sequences retrieved from 57 Ln. mesenteroides strains and 21 published Ln. mesenteroides genomes (i.e., strain P45 was excluded), the cremoris ATCC 19254T cluster, being deficient of the araA, dsr, and sorA genes, included five strains only. Consistent with the lack of the above genes, all five cremoris strains displayed three subspecies-specific ‘negative’ phenotypic traits (no acid production from arabinose; no slime (dextran) formation; no growth at 37 °C). At least one of them, however, the Irish cremoris DPC 3944 (MK574700) strain from artisanal cheese, was found to ferment cellobiose, maltose, ribose, sucrose, trehalose, and xylose [46]. Because the DPC 3944 strain phenotype, seemingly genotyped with the subsp. cremoris by molecular tools in addition to the 16S rRNA gene sequencing, was similar to our atypical, slime-negative subsp. dextranicum isolates in biotypes L1D–L1F (Figure 1), autochthonous Ln. mesenteroides subsp. cremoris strain genotypes with enriched sugar fermentation patterns may also occur in traditional Greek cheeses to be misidentified as Ln. mesenteroides subsp. dextranicum strain genotypes with an oligofermenting phenotype, such as that of the respective NCDO 529 (ATCC19255T = DSM20484T) type strain originally defined by Garvie [49,50].
Overall, it is not always possible to differentiate between the L-arabinose-negative Ln. mesenteroides subspecies cremoris and dextranicum on a phenotypic level [39], particularly when the latter dairy strains are atypical in failing to produce dextran (slime) from sucrose although they possess the dsr gene [46], as all representative whey cheese spoilage isolates of Ln. mesenteroides, except of the WM107 and WM108 strains, do (Figure 1; Table 4). Altogether, 20 strains with the atypical S5 (dsr/sorA) dextranicum profile vs. an additional 39 strains with the typical S4 (araA/dsr/sorA) profile of Ln. mesenteroides subsp. mesenteroides ATCC 8293T clustered variably and quite ambiguously on the basis of their partial rpoB gene sequences; in total, five ambiguous clusters in addition to the four clusters comprising the respective type strains of the Ln. mesenteroides subspecies were detected by Ricciardi et al. [46]. Surprisingly, ACA-DC 0493 was among four dsr/sorA strains in the mes_ATCC8293T cluster of Ricciardi et al. [46], whereas in our present (Table 4) and previous [45] studies, it was found to possess the S2 (dsr) gene profile of Ln. mesenteroides subsp. dextranicum DSM 20484T. While this multiplex-PCR discrepancy regarding the ACA-DC 0493 strain cannot be addressed without further inter-laboratory testing, it needs to be stressed that only the type strain (DSM 20484T = LMG 6908T) of the subspecies dextranicum was a single dsr gene possessor among the 78 Ln. mesenteroides strains studied by Ricciardi et al. [46]. In our opinion, that finding is of prominent importance with respect to the LAB ecology of the artisanal cheeses overall and corroborates the absence of typical (dsr) Ln. mesenteroides subsp. dextranicum strains contrary to the prevalence of atypical (dsr/sorA) intermediate dextranicum and/or mesenteroides strains among the 24 representative isolates herein (Table 4), among 10 similar isolates from Epirus raw sheep milk [45], and probably among the total 92 Ln. mesenteroides isolates from four spoiled Anthotyros whey cheese batches [21].
The absence of araA and thus the L-arabinose-negative fermentation reaction of the subsp. dextranicum strains remain key traits for their separation from the subsp. mesenteroides and jonggajibkimchii strains [46]. Therefore, the fact that the type strain of Ln. mesenteroides subsp. dextranicum KACC 12315T produced acid from L-arabinose by the API 50 CHL method, according to the fermentation data tabulated in the taxonomic study defining Ln. mesenteroides subsp. jonggajibkimchii subsp. nov. [23], is a critical contradiction with Bergey’s Manual tabulation [39]. Nevertheless, for many of the Ln. mesenteroides strains analyzed by Ricciardi et al. [46], the presence of dsr and araA did not reflect the production of dextran from sucrose and acid from arabinose, as it was respectively shown in the present study for 22 out of the total 24 dsr-positive Ln. mesenteroides isolates and, most profoundly, for 8 araA-positive isolates in the oligofermenting L1B, L1C, and L4A biotypes (Figure 1) possessing the S3 multiplex-PCR profile of Ln. mesenteroides subsp. jonggajibkimhcii DRC 1506T, deficient of the sorA gene only (Table 4). Notably, only 3 out of the 74 Ln. mesenteroides reference strains that had the expected araA/dsr profile of the subsp. jonggajibkimchii did the most ambiguous clustering, i.e., clearly outside of the jon_DRC 1506T cluster, which instead included an additional 10 strains, all of them sharing the typical araA/dsr/sorA profile of the subspecies mesenteroides [46].
Altogether, the above literature data suggest that Ln. mesenteroides strains with the araA/dsr profile of our atypical subsp. jonggajibkimchii-like strains have been rarely isolated so far, at least from dairy foods, and may also be genotyped closer to either typical subsp. mesenteroides or subsp. dextranicum strains. Ricciardi et al. [46] highlighted the above discrepancies and concluded that none of the phenotypic and genotypic traits (including the sorA gene) separated the former two subspecies. The authors opinioned that contradictive clustering or taxonomic inaccuracies among strains may occur because the proposal of Ln. mesenteroides subsp. jonggajibkimchii subsp. nov. by Juan et al. [23] was based on the description of a single strain, DRC 1506T. Therefore, it is necessary to analyze additional subsp. jonggajibkimchii as well as much more subsp. dextranicum strains, comparatively to the subsp. mesenteroides strains, before asserting the presence of this newest fourth subspecies [46]. Robust genome-based approaches supported by comparative metabolic diversity studies are constantly required for an accurate subspecies discrimination of Ln. mesenteroides strains [36,43,51], particularly of novel artisan cheese isolates seemingly assigned to the subsp. jonggajibkimchii by the combined use of MALDI-TOF MS and pheS gene sequencing analysis [27] or with more advanced taxonomic tools, such as digital DNA-DNA hybridization (dDDH) using the DSMZ type strain genome server (TYGS) analysis [29]. The complex phylogeny of the ubiquitous Ln. mesenteroides and its closelyrelated Ln. suionicum, Ln. litchii, Ln. pseudomesenteroides, and Ln. falkenbergense has not been fully resolved yet [51]. In this context, our present dairy study provides novel Ln. mesenteroides isolates possessing the rare jonggajibkimchii (araA/dsr) profile, which, apart from lacking sorA, display an atypical oligofermenting pattern (Figure 1; Table 3) compared to the DRC 1506T, which, among others, ferments L-arabinose, aesculin, salicin, mannitol, ribose, and raffinose, and produces dextran (slime) from sucrose [23]. Because all Ln. mesenteroides (araA/dsr) isolates in the strain biotypes L1B, L1C, and L4A were not retrieved as autochthonous non-starter LAB from traditionally fermented and ripened cheeses, but they evolved as competitive predominant psychrotrophic LAB spoilers in a fresh (non-fermented) whey cheese during refrigerated storage, they may be free-living, D-xylose-positive strains of plant origin having adapted to raw milk niches by shifting their active-gene sugar fermentation pathways accordingly [43,51]. In support of this hypothesis, two similar Ln. mesenteroides (araA/dsr) strains (KFM3 and KFM9) were isolated, for the first time, from bulk Greek raw sheep milk [45].

5. Conclusions

In conclusion, at least 8 of the 24 diverse representative Ln. mesenteroides whey cheese isolates with the atypical novel strain phenotypes L1B, L1C, and L4A, classified as Ln. mesenteroides subsp. jonggajibkimchii, according to their multiplex-PCR (araA/dsr) profile (Table 4), deserve further investigations, based on WGS and transcriptomic analyses, to resolve their taxonomy and metabolic features. Future studies are also required to validate the actual spoilage potential and safety of all Ln. mesenteroides strain biotypes/genotypes retrieved from Anthotyros whey cheese [21] in association with their bioprotective and probiotic potential, as it was done for other ‘two-faced’ Ln. mesenteroides strains from food (dairy) microecosystems [34,40,44]. The present psychrotrophic Ln. mesenteroides strains promoted an unmonitored, batch-dependent natural acidification (pH 5.5 to ≤ 5.0), which ceased the growth of Gram-negative bacteria in the spoiling vacuum-packaged Anthotyros whey cheeses from day 15 to day 40 at 4 °C [21], without causing blowing [6] or strong flavor defects, suggesting minor in situ CO2 formation and enzymatic activity [8,61]. In parallel, they controlled the growth of inoculated Listeria monocytogenes, whose viability declined in most batches during storage [62], suggesting the presence of bacteriocinogenic (Bac+) Ln. mesenteroides or other psychrotrophic Bac+ LAB strains. Particularly, the atypical jonggajibkimchii (araA/dsr) strain biotypes may have low spoilage potential and also inhibit coexisting spoilage or pathogenic bacteria at low storage temperatures to be intentionally added as probiotic biopreservatives, like Carnobacterium spp. or Lacticaseibacillus casei, in fresh (whey) cheeses [20,63,64]. Relevant studies on defined Bac+ Ln. mesenteroides or other Leuconostoc spp. strain applications remain scarce in the dairy industry [65,66]. Therefore, fresh whey cheese inoculation studies with present Ln. mesenteroides strains, preselected for their technological, functional, and safety traits [35], should be conducted. A recent review by Dimov [67] does not encompass Leuconostoc/Ln. mesenteroides among the most concerning LAB (excluding Enterococcus spp.) of controversial (probiotic vs. pathogenic) nature actively participating in cheese ripening. However, previous reports have associated Leuconostoc, mostly Ln. mesenteroides strains, with clinical infections as opportunistic pathogens and multi-antibiotic resistance [24,40,68]. Therefore, a thorough safety evaluation is a prerequisite for applying any of the present natural Ln. mesenteroides whey cheese strains as a biopreservative and/or probiotic adjunct culture in Greek dairy foods.

Author Contributions

Conceptualization, J.S.; Methodology, N.S., E.S., S.P. and J.S.; Formal analysis, N.S., E.S. and J.S.; Data curation, N.S., E.S. and J.S.; Resources, J.S.; Supervision, L.B. and S.P.; Funding acquisition, L.B. and J.S.; Writing—original draft, J.S.; Writing—review and editing, S.P. and J.S.; Project administration, L.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the European Union and Greek national funds through the EPAnEK 2014–2020 Operational Program Competitiveness, Entrepreneurship, and Innovation under RESEARCH-CREATE-INNOVATE (project: T1EDK-00968; project acronym BIO TRUST). E.S.’s support was funded by the project Traditional Kefalotyri of Epirus (MIS: 5033089; program code HP1AB-00121).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The technical assistance of Athanasia Kakouri with respect to the LAB culture maintenance and microbiological media preparation is gratefully acknowledged.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Montel, M.-C.; Buchin, S.; Mallet, A.; Delbés-Paus, C.; Vuitton, D.A.; Desmasures, N.; Berthier, F. Traditional cheeses: Rich and diverse microbiota with associated benefits. Int. J. Food Microbiol. 2014, 177, 136–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Aryana, K.J.; Olson, D.W. A 100-year review: Yogurt and other cultured dairy products. J. Dairy Sci. 2017, 100, 9987–10013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Coelho, M.C.; Malcata, F.X.; Silva, C.C.G. Lactic acid bacteria in raw-milk cheeses: From starter cultures to probiotic functions. Foods 2022, 11, 2276. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Schillinger, U.; Holzapfel, W.H.; Björkroth, K.J. Lactic acid bacteria. In Food Spoilage Microorganisms; Blackburn, C.W., Ed.; Woodhead Publishing Limited: Cambridge, UK, 2006; pp. 541–578. [Google Scholar]
  5. Hassan, A.N. Possibilities and challenges of exopolysaccharide-producing lactic cultures in dairy foods. J. Dairy Sci. 2008, 91, 1282–1298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Quiberoni, A.; Guglielmotti, D.; Reinheimer, J. New and classical spoilage bacteria causing widespread blowing in Argentinean soft and semihard cheeses. Int. J. Dairy Technol. 2008, 61, 358–363. [Google Scholar] [CrossRef] [Scilit]
  7. Gobbetti, M.; De Angelis, M.; Di Cagno, R.; Mancini, L.; Fox, P.F. Pros and cons for using non-starter lactic acid bacteria (NSLAB) as secondary/adjunct starters for cheese ripening. Trends Food Sci. Technol. 2015, 45, 167–178. [Google Scholar] [CrossRef] [Scilit]
  8. Machado, S.G.; Bagliniére, F.; Marchsand, S.; Van Coillie, E.; Vanetti, M.C.D.; De Block, J.; Heyndrickx, M. The biodiversity of the microbiota producing heat-resistant enzymes responsible for spoilage in processed bovine milk and dairy products. Front. Microbiol. 2017, 8, 302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Quigley, L.; O’Sullivan, O.; Stanton, C.; Beresford, T.P.; Ross, R.P.; Fitzgerald, G.F.; Cotter, P.D. The complex microbiota of raw milk. FEMS Microbiol. Rev. 2013, 37, 664–698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Boor, K.; Fromm, H. Managing microbial spoilage in the dairy industry. In Food Spoilage Microorganisms; Blackburn, C.W., Ed.; Woodhead Publishing Limited: Cambridge, UK, 2006; pp. 171–193. [Google Scholar]
  11. Doyle, C.J.; Gleeson, D.; Jordan, K.; Beresford, T.P.; Ross, R.P.; Fitzgerald, G.F.; Cotter, P.D. Anaerobic sporeformers and their significance with respect to milk and dairy products. Int. J. Food Microbiol. 2015, 197, 77–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Yuan, L.; Sadiq, F.A.; Burmølle, M.; Wang, N.I.; He, G.Q. Insights into psychrotrophic bacteria in raw milk: A review. J. Food Prot. 2019, 82, 1148–1159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Odeyemi, O.A.; Alegbeleye, O.O.; Strateva, M.; Stratev, D. Understanding spoilage microbial community and spoilage mechanisms in foods of animal origin. Comp. Rev. Food Sci. Food Saf. 2020, 19, 311–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Pintado, M.E.; Macedo, A.C.; Malcata, F.X. Review: Technology, chemistry and microbiology of whey cheeses. Food Sci. Technol. Int. 2001, 7, 105–116. [Google Scholar] [CrossRef]
  15. Hough, G.; Puglieso, M.L.; Sanchez, R.; Da Silva, O.M. Sensory and microbiological shelf-life of a commercial Ricotta cheese. J. Dairy Sci. 1999, 82, 454–459. [Google Scholar] [CrossRef] [Scilit]
  16. Pala, C.; Scarano, C.; Venusti, M.; Sardo, D.; Casti, D.; Cossu, F.; Lamon, S.; Spanu, V.; Ibba, M.; Marras, M. Shelf life evaluation of Ricotta Fresca sheep cheese in modified atmosphere packaging. Ital. J. Food Saf. 2016, 5, 5502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Sattin, E.; Andreani, N.A.; Carraro, L.; Fasolato, L.; Balzan, S.; Novelli, E.; Squartini, A.; Telatin, A.; Simionati, B.; Cardazzo, B. Microbial dynamics during shelf-life of industrial Ricotta cheese and identification of a Bacillus strain as a cause of a pink discolouration. Food Microbiol. 2016, 57, 8–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Spanu, C.; Scarano, C.; Spanu, V.; Pala, C.; Casti, D.; Lamon, S.; Cossu, F.; Ibba, M.; Nieddu, G.; De Santis, E.P.L. Occurrence and behavior of Bacillus cereus in naturally contaminated Ricotta Salata cheese during refrigerated storage. Food Microbiol. 2016, 58, 135–138. [Google Scholar] [CrossRef] [Scilit]
  19. Di Pierro, P.; Sorrentino, A.; Mariniello, L.; Giosafatto, C.V.L.; Porta, R. Chitosan/whey protein film as active coating to extend Ricotta cheese shelf-life. LWT-Food Sci. Technol. 2011, 44, 2324–2327. [Google Scholar] [CrossRef] [Scilit]
  20. Spanu, C.; Piras, F.; Mocci, A.M.; Nieddu, G.; De Santis, E.P.L.; Scarano, C. Use of Carnobacterium spp. protective culture in MAP packed Ricotta Fresca cheese to control Pseudomonas spp. Food Microbiol. 2018, 74, 50–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Sameli, N.; Sioziou, E.; Bosnea, L.; Kakouri, A.; Samelis, J. Assessment of the spoilage microbiota during refrigerated (4 °C) vacuum-packed storage of fresh Greek Anthotyros whey cheese without or with a crude enterocin A-B-P-containing extract. Foods 2021, 10, 2946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Gu, C.T.; Wang, F.; Li, C.Y.; Liu, F.; Huo, G.C. Leuconostoc mesenteroides subsp. suionicum subsp. nov. Int. J. Syst. Evol. Microbiol. 2012, 62, 1548–1551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Jeon, H.H.; Kim, K.H.; Chun, B.H.; Ryu, B.H.; Han, N.S.; Jeon, C.O. A proposal of Leuconostoc mesenteroides subsp. jonggajibkimchii subsp. nov. and reclassification of Leuconostoc mesenteroides subsp. suionicum (Gu et al., 2012) as Leuconostoc suionicum sp. nov. based on complete genome sequences. Int. J. Syst. Evol. Microbiol. 2017, 67, 2225–2230. [Google Scholar] [PubMed]
  24. Hemme, D.; Foucaud-Scheunemann, C. Leuconostoc, characteristics, use in dairy technology and prospects in functional foods. Int. Dairy J. 2004, 14, 467–494. [Google Scholar] [CrossRef] [Scilit]
  25. Pogačić, T.; Chuat, V.; Madec, M.-N.; Samaržija, D.; Lortal, S.; Valence, F. Phenotypic traits of genetically closely related Leuconostoc spp. Int. Dairy J. 2014, 39, 96–101. [Google Scholar] [CrossRef] [Scilit]
  26. Terzić-Vidojević, A.; Mihajlovic, S.; Uzelac, G.; Veljović, K.; Tolinački, M.; Nikolic, M.; Topisirovic, L.; Kojic, M. Characterization of lactic acid bacteria isolated from artisanal Travnik young cheeses, sweet creams and sweet kajmaks over four seasons. Food Microbiol. 2014, 39, 27–38. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Sánchez-Juanes, F.; Teixeira-Martín, V.; González-Buitrago, J.M.; Velázquez, E.; Flores-Félix, J.D. Identification of species and subspecies of lactic acid bacteria present in Spanish cheeses type “Torta” by MALDI-TOF MS and pheS gene analyses. Microorganisms 2020, 8, 301. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Terzić-Vidojević, A.; Veljović, K.; Tolinački, M.; Živković, M.; Lukić, J.; Lozo, J.; Fira, Đ.; Jovčić, B.; Strahinić, I.; Begović, J.; et al. Diversity of non-starter lactic acid bacteria in autochthonous dairy products from Western Balkan countries—technological and probiotic properties. Food Res. Int. 2020, 136, 109494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Ruppitsch, W.; Nisic, A.; Hyden, P.; Cabal, A.; Sucher, J.; Stöger, A.; Allerberger, F.; Martinović, A. Genetic diversity of Leuconostoc mesenteroides isolates from traditional Montenegrin brine cheese. Microorganisms 2021, 9, 1612. [Google Scholar] [CrossRef] [Scilit]
  30. Samelis, J.; Kakouri, A.; Pappa, E.C.; Matijašic, B.B.; Georgalaki, M.D.; Tsakalidou, E.; Rogelj, I. Microbial stability and safety of traditional Greek Graviera cheese: Characterization of the lactic acid bacterial flora and culture-independent detection of bacteriocin genes in the ripened cheeses and their microbial consortia. J. Food Prot. 2010, 73, 1294–1303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Litopoulou-Tzanetaki, E.; Tzanetakis, N. The microfloras of traditional Greek cheeses. Microbiol. Spectr. 2014, 2, CM-0009-2012. [Google Scholar] [CrossRef] [Scilit]
  32. Vandera, E.; Kakouri, A.; Koukkou, A.-I.; Samelis, J. Major ecological shifts within the dominant non starter lactic acid bacteria in mature Greek Graviera cheese as affected by the starter culture type. Int. J. Food Microbiol. 2019, 290, 15–26. [Google Scholar] [CrossRef] [Scilit]
  33. Gantzias, C.; Lappa, I.K.; Aerts, M.; Georgalaki, M.; Manolopoulou, E.; Papadimitriou, K.; De Brandt, E.; Tsakalidou, E.; Vandamme, P. MALDI-TOF MS profiling of non-starter lactic acid bacteria from artisanal cheeses of the Greek island of Naxos. Int. J. Food Microbiol. 2020, 323, 108586. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Zoumpopoulou, G.; Papadimitriou, K.; Alexandraki, V.; Mavrogonatou, E.; Alexopoulou, K.; Anastasiou, R.; Georgalaki, M.; Kletsas, D.; Tsakalidou, E.; Giaouris, E. The microbiota of Kalathaki and Melichloro Greek artisanal cheeses comprises functional lactic acid bacteria. LWT 2020, 130, 109570. [Google Scholar] [CrossRef] [Scilit]
  35. Apostolakos, I.; Paramithiotis, S.; Mataragas, M. Comparative genomic analysis reveals the functional traits and safety status of lactic acid bacteria retrieved from artisanal cheeses and raw sheep milk. Foods 2023, 12, 599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Frantzen, C.A.; Kot, W.; Pedersen, T.B.; Ardö, Y.M.; Broadbent, J.R.; Neve, H.; Hansen, L.H.; Dal Bello, F.; Østlie, H.M.; Kleppen, H.P. Genomic characterization of dairy associated Leuconostoc species and diversity of leuconostocs in undefined mixed mesophilic starter cultures. Front. Microbiol. 2017, 8, 132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Paramithiotis, S.; Kouretas, K.; Drosinos, E.H. Effect of ripening stage on the development of the microbial community during spontaneous fermentation of green tomatoes. J. Sci. Food Agric. 2014, 94, 1600–1606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Chen, S.; Liu, S.; Ma, J.; Xu, X.; Wang, H. Evaluation of the spoilage heterogeneity of meat-borne Leuconostoc mesenteroides by metabonomics and in-situ analysis. Food Res. Int. 2022, 156, 111365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Holzapfel, W.H.; Björkroth, J.A.; Dicks, L.M.T. Genus I Leuconostoc van Tieghem 1878, 198 AL. In Bergey’s Manual of Systematic Bacteriology, The Firmicutes, 2nd ed.; Whitman, W.B., Ed.; Springer: New York, NY, USA, 2009; Volume 3, pp. 624–635. [Google Scholar]
  40. De Paula, A.T.; Jeronymo-Ceneviva, A.B.; Todorov, S.D.; Penna, A.L.B. The two faces of Leuconostoc mesenteroides in food systems. Food Rev. Int. 2015, 31, 147–171. [Google Scholar] [CrossRef] [Scilit]
  41. Samelis, J. Managing microbial spoilage in the meat industry. In Food Spoilage Microorganisms; Blackburn, C.W., Ed.; Woodhead Publishing Limited: Cambridge, UK, 2006; pp. 213–286. [Google Scholar]
  42. Iulietto, M.F.; Sechi, P.; Borgogni, E.; Cenci-Goga, B.T. Meat spoilage: A critical review of a neglected alteration due to ropy slime producing bacteria. Ital. J. Anim. Sci. 2015, 14, 4011. [Google Scholar] [CrossRef] [Scilit]
  43. Chun, B.H.; Kim, K.H.; Jeon, H.H.; Lee, S.H.; Jeon, C.O. Pan-genomic and transcriptomic analyses of Leuconostoc mesenteroides provide insights into its genomic and metabolic features and roles in kimchi fermentation. Sci. Rep. 2017, 7, 11504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Rai, R.; Tamang, J.P. In vitro and genetic screening of probiotic properties of lactic acid bacteria isolated from naturally fermented cow-milk and yak-milk products of Sikkim, India. World J. Microbiol. Biotechnol. 2022, 38, 25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Sioziou, E.; Kakouri, A.; Bosnea, L.; Samelis, J. Antilisterial activity of raw sheep milk from two native Epirus breeds: Culture-dependent identification, bacteriocin gene detection and primary safety evaluation of the antagonistic LAB biota. Curr. Res. Microb. Sci. 2024, 6, 100209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Ricciardi, A.; Storti, L.V.; Zotta, T.; Felis, G.E.; Parente, E. Analysis of rpoB polymorphism and PCR-based approaches for the identification of Leuconostoc mesenteroides at the species and subspecies level. Int. J. Food Microbiol. 2020, 318, 108474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Querol, A.; Barrio, E.; Huerta, T.; Ramon, D. Molecular monitoring of wine fermentations conducted by active dry yeast strains. Appl. Environ. Microbiol. 1992, 58, 2948–2953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Tsafrakidou, P.; Sameli, N.; Bosnea, L.; Chorianopoulos, N.; Samelis, J. Assessment of the spoilage microbiota in minced free-range chicken meat during storage at 4 °C in retail modified atmosphere packages. Food Microbiol. 2021, 99, 103822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Garvie, E.I. Proposal of neotype strains for Leuconostoc mesenteroides (Tsenkovskii) van Tieghem, Leuconostoc dextranicum (Beijerinck) Hucker and Pederson, and Leuconostoc cremoris (Knudsen and Sørensen) Garvie. Int. J. Syst. Bacteriol. 1979, 29, 149–151. [Google Scholar] [CrossRef] [Scilit]
  50. Garvie, E.I. Leuconostoc mesenteroides subsp. cremoris (Knudsen and Sørensen) comb. nov. and Leuconostoc mesenteroides subsp. dextranicum (Beijerinck) comb. nov. Int. J. Syst. Bacteriol. 1983, 33, 118–119. [Google Scholar]
  51. Raimondi, S.; Candeliere, F.; Amaretti, A.; Costa, S.; Vertuani, S.; Spampinato, G.; Rossi, M. Phylogenomic analysis of the genus Leuconostoc. Front. Microbiol. 2022, 13, 897656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Kalogridou-Vassiliadou, D.; Tzanetakis, N.; Litopoulou-Tzanetaki, E. Microbiological and physico-chemical characteristics of “Anthotyro”, a Greek traditional whey cheese. Food Microbiol. 1994, 11, 15–19. [Google Scholar] [CrossRef] [Scilit]
  53. Cibik, R.; Lepage, E.; Tailliez, P. Molecular diversity of Leuconostoc mesenteroides and Leuconostoc citreum isolated from traditional French cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification. Syst. Appl. Microbiol. 2000, 23, 267–278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  54. Samelis, J.; Kakouri, A. Growth inhibitory and selective pressure effects of sodium diacetate on the spoilage microbiota of frankfurters stored at 4 °C and 12 °C in vacuum. Foods 2021, 10, 74. [Google Scholar] [CrossRef] [Scilit]
  55. Villani, F.; Moschetti, G.; Blaiotta, G.; Coppola, S. Characterization of strains of Leuconostoc mesenteroides by analysis of soluble whole-cell protein pattern, DNA fingerprinting and restriction of ribosomal DNA. J. Appl. Microbiol. 1997, 82, 578–588. [Google Scholar] [CrossRef] [PubMed]
  56. Moschetti, G.; Blaiotta, G.; Villani, F.; Coppola, S. Specific detection of Leuconostoc mesenteroides subsp. mesenteroides with DNA primers identified by randomly amplified polymorphic DNA analysis. Appl. Environ. Microbiol. 2000, 66, 422–424. [Google Scholar] [PubMed]
  57. Papatsaroucha, E.; Pavlidou, S.; Hatzikamari, M.; Lazaridou, A.; Torriani, S.; Gerasopoulos, D.; Litopoulou-Tzanetaki, E. Preservation of pears in water in the presence of Sinapis arvensis seeds: A Greek tradition. Int. J. Food Microbiol. 2012, 159, 254–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Sharma, A.; Kaur, J.; Lee, S.; Park, Y.S. Genetic diversity analysis of Leuconostoc mesenteroides from Korean vegetables and food products by multilocus sequence typing. Appl. Microbiol. Biotechnol. 2018, 102, 4853–4861. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Biruk, A.M.; Furik, N.N.; Tarashkevich, Y.S.; Savelyeva, T.A. Construction of specific primers for identification of Leuconostoc mesenteroides subspecies. Proc. Nat. Acad. Sci. USA 2020, 58, 244–256. [Google Scholar] [CrossRef] [Scilit]
  60. Zeller-Peronnet, V.; Brockmann, E.; Pavlovic, M.; Timke, M.; Busch, U.; Huber, I. Potential and limitations of MALDI-TOF MS for discrimination within the species Leuconostoc mesenteroides and Leuconostoc pseudomesenteroides. J. Consum. Prot. Food Saf. 2013, 8, 205–214. [Google Scholar] [CrossRef] [Scilit]
  61. Hantsis-Zacharov, E.; Halpern, M. Culturable psychrotrophic bacterial communities in raw milk and their proteolytic and lipolytic traits. Appl. Environ. Microbiol. 2007, 73, 7162–7168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Sameli, N.; Samelis, J. Growth and biocontrol of Listeria monocytogenes in Greek Anthotyros whey cheese without or with a crude enterocin A-B-P extract: Interactive effects of the native spoilage microbiota during vacuum-packed storage at 4 °C. Foods 2022, 11, 334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Bassi, D.; Gazzola, S.; Sattin, E.; Dal Bello, F.; Simionati, B.; Cocconcelli, P.S. Lactic acid bacteria adjunct cultures exert a mitigation effect against spoilage microbiota in fresh cheese. Microorganisms 2020, 8, 1199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Madureira, A.R.; Pintado, M.E.; Gomes, A.M.P.; Malcata, F.X. Incorporation of probiotic bacteria in whey cheese: Decreasing the risk of microbial contamination. J. Food Prot. 2011, 74, 1194–1199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Silva, C.C.G.; Silva, S.P.M.; Ribeiro, S.C. Application of bacteriocins and protective cultures in dairy food preservation. Front. Microbiol. 2018, 9, 594. [Google Scholar] [CrossRef] [Scilit]
  66. Yi, Y.; Li, P.; Zhao, F.; Zhang, T.; Shan, Y.; Wang, X.; Liu, B.; Chen, Y.; Zhao, X.; Lu, X. Current status and potentiality of class II bacteriocins from lactic acid bacteria: Structure, mode of action and applications in the food industry. Trends Food Sci. Technol. 2022, 120, 387–401. [Google Scholar] [CrossRef] [Scilit]
  67. Dimov, S. The controversial nature of some non-starter lactic acid bacteria actively participating in cheese ripening. BioTech 2023, 12, 63. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Campedelli, I.; Flórez, A.B.; Salvetti, E.; Delgado, S.; Orrù, L.; Cattivelli, L.; Alegria, A.; Fellis, G.E.; Torriani, S.; Mayo, B. Draft genome sequence of three antibiotic-resistant Leuconostoc mesenteroides strains of dairy origin. Gen. Announc. 2015, 3, e01018-15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Basic sugar fermentation patterns and dextran-producing ability (slime; SLM) of 24 Leuconostoc mesenteroides (biotypes L1A to L4B) and 2 Leuconostoc lactis (biotype L5) isolates, obtained from terminally spoiled Greek Anthotyros whey cheeses. Red-brown boxes indicate acid production from L-arabinose (LARA), cellobiose (CEL), galactose (GAL), lactose (LAC), maltose (MAL), mannitol (MAN), melibiose (MEL), raffinose (RAF), ribose (RIB), sorbitol (SOR), sucrose (SUC), trehalose (TRE), and xylose (XYL). Light-pink boxes indicate a weak positive fermentation reaction. CNT, no acid production in MRS broth base without sugar. Uncoloured boxes, negative reaction.
Figure 1. Basic sugar fermentation patterns and dextran-producing ability (slime; SLM) of 24 Leuconostoc mesenteroides (biotypes L1A to L4B) and 2 Leuconostoc lactis (biotype L5) isolates, obtained from terminally spoiled Greek Anthotyros whey cheeses. Red-brown boxes indicate acid production from L-arabinose (LARA), cellobiose (CEL), galactose (GAL), lactose (LAC), maltose (MAL), mannitol (MAN), melibiose (MEL), raffinose (RAF), ribose (RIB), sorbitol (SOR), sucrose (SUC), trehalose (TRE), and xylose (XYL). Light-pink boxes indicate a weak positive fermentation reaction. CNT, no acid production in MRS broth base without sugar. Uncoloured boxes, negative reaction.
Applmicrobiol 04 00076 g001
Figure 2. Multiplex-PCR profiles of 12 Leuconostoc mesenteroides (WM) isolates from terminally spoiled Greek Anthotyros whey cheeses. Lane 1: Nippon Genetics ready-to-use DNA ladder, 100 to 3000 bp fragments; Lanes 2–13: Ln. mesenteroides WM isolates; Lane 14: Leuconostoc lactis WM118 (negative control strain); L15: negative control (no bacterial DNA). At 925 bp is the rpoB gene band; at 774 bp is the araA gene band; at 549 bp is the dsr gene band; at 253 bp is the sorA gene band.
Figure 2. Multiplex-PCR profiles of 12 Leuconostoc mesenteroides (WM) isolates from terminally spoiled Greek Anthotyros whey cheeses. Lane 1: Nippon Genetics ready-to-use DNA ladder, 100 to 3000 bp fragments; Lanes 2–13: Ln. mesenteroides WM isolates; Lane 14: Leuconostoc lactis WM118 (negative control strain); L15: negative control (no bacterial DNA). At 925 bp is the rpoB gene band; at 774 bp is the araA gene band; at 549 bp is the dsr gene band; at 253 bp is the sorA gene band.
Applmicrobiol 04 00076 g002
Table 1. Representative Leuconostoc (Ln.) spp. isolates from two spoiled batches (C, D) of fresh, untreated (CN) or enterocin (A-B-P)-treated (Ent+), vacuum-packaged, cold-stored (4 °C) Anthotyros whey cheeses used in this study 1.
Table 1. Representative Leuconostoc (Ln.) spp. isolates from two spoiled batches (C, D) of fresh, untreated (CN) or enterocin (A-B-P)-treated (Ent+), vacuum-packaged, cold-stored (4 °C) Anthotyros whey cheeses used in this study 1.
Group/
Isolate
Biotype
Cheese Batch/
Treatment
Isolate
Code 2
Species IdentificationClosest
Ref. Strain
in BLAST
16S rRNA
Gene Seq
Similarity
L1C/CNWM106Ln. mesenteroidesMT545072.1100
C/CNWM109ALn. mesenteroidesNT-
C/CNWM109BLn. mesenteroidesMT545072.1100
C/Ent+WM117Ln. mesenteroidesNT-
C/Ent+WM119Ln. mesenteroidesNT-
C/Ent+WM123Ln. mesenteroidesMT545101.1100
C/Ent+WM124Ln. mesenteroidesNT-
C/Ent+WM125ALn. mesenteroidesNT-
C/Ent+WM125BLn. mesenteroidesNT-
D/CNWM136Ln. mesenteroidesMT545072.1100
D/CNWM137Ln. mesenteroidesMT545072.1100
D/CNWM138Ln. mesenteroidesNT-
D/Ent+WM147Ln. mesenteroidesNT-
D/Ent+WM151Ln. mesenteroidesNT-
D/Ent+WM153Ln. mesenteroidesMT545072.1100
L2C/CNWM103Ln. mesenteroidesNT-
C/CNWM105Ln. mesenteroidesMT545072.1100
C/CNWM110ALn. mesenteroidesMT545113.1100
C/CNWM110BLn. mesenteroidesNT-
C/Ent+WM122ALn. mesenteroidesMT545072.1100
C/Ent+WM122BLn. mesenteroidesNT-
L3C/Ent+WM121Ln. mesenteroidesMT545113.1100
L4C/CNWM107Ln. mesenteroidesMT545113.1100
C/CNWM108Ln. mesenteroidesMT545072.1100
L5C/Ent+WM118Ln. lactisMF354765.1100
C/Ent+WM129Ln. lactisNT-
1 All data in Table 1 are adapted from Sameli et al. [21]. Grouping of the Leuconostoc spp. isolates in five main biotypes, L1 to L5, based on their reactions to five key phenotypic traits, namely slime formation and fermentation of L-arabinose, raffinose, trehalose, and D-xylose, is presented in Table 3 of the Sameli et al. [21] study. 2 The representative LAB isolates identified by 16S rRNA gene sequencing by Sameli et al. [21] are listed with their code numbers written in bold. NT, not tested.
Table 2. List of primers used for the multiplex-PCR in this study.
Table 2. List of primers used for the multiplex-PCR in this study.
GenePrimerSequence (5′-3′)Amplicon
Size (bp)
Annealing Temperature (°C)Reference
rpoBrpob-F GTCCGCATTGATCGCACGC95260Ricciardi et al. [46]
rpob-R CACCCGGTCCAAGAGCTGAC
araAL-ara-F TTTGGCTGGACGGTTGACT744
L-ara-R TGTTGTGTGATGTCCGCCAC
dsrdextran-F TGGCACCATTACCATAACGAACT549
dextran-R TGCCAGCAGTCGATCAATATGG
sorAPTS-sorb-F GTGCCTTACTCCCCTGTGTAG253
PTS-sorb-R TCCTCGTCTTCCTCATCATCGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sameli, N.; Sioziou, E.; Bosnea, L.; Paramithiotis, S.; Samelis, J. Multiplex-PCR Detection of an Atypical Leuconostoc mesenteroides subsp. jonggajibkimchii Phenotype Dominating the Terminal Spoilage Microbial Association of a Fresh Greek Whey Cheese Stored at 4 °C in Vacuum. Appl. Microbiol. 2024, 4, 1124-1141. https://doi.org/10.3390/applmicrobiol4030076

AMA Style

Sameli N, Sioziou E, Bosnea L, Paramithiotis S, Samelis J. Multiplex-PCR Detection of an Atypical Leuconostoc mesenteroides subsp. jonggajibkimchii Phenotype Dominating the Terminal Spoilage Microbial Association of a Fresh Greek Whey Cheese Stored at 4 °C in Vacuum. Applied Microbiology. 2024; 4(3):1124-1141. https://doi.org/10.3390/applmicrobiol4030076

Chicago/Turabian Style

Sameli, Nikoletta, Eleni Sioziou, Loulouda Bosnea, Spiros Paramithiotis, and John Samelis. 2024. "Multiplex-PCR Detection of an Atypical Leuconostoc mesenteroides subsp. jonggajibkimchii Phenotype Dominating the Terminal Spoilage Microbial Association of a Fresh Greek Whey Cheese Stored at 4 °C in Vacuum" Applied Microbiology 4, no. 3: 1124-1141. https://doi.org/10.3390/applmicrobiol4030076

APA Style

Sameli, N., Sioziou, E., Bosnea, L., Paramithiotis, S., & Samelis, J. (2024). Multiplex-PCR Detection of an Atypical Leuconostoc mesenteroides subsp. jonggajibkimchii Phenotype Dominating the Terminal Spoilage Microbial Association of a Fresh Greek Whey Cheese Stored at 4 °C in Vacuum. Applied Microbiology, 4(3), 1124-1141. https://doi.org/10.3390/applmicrobiol4030076

Article Metrics

Back to TopTop