Next Article in Journal
Biochemical and Perceptual Markers of Physiological Stress During Acute Exercise Overload in U20 Elite Basketball Players
Next Article in Special Issue
Selective and Mild Transcriptional Modulation of Lectin Genes in Soy Leaves Under Drought Stress
Previous Article in Journal / Special Issue
Response of Sunflower Genotypes to Salinity Stress Under Laboratory Conditions
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Evaluation of Papaya Plants Tolerant to PRSV Obtained Through Conventional Genetic Improvement

by
Luz María Sánchez-Noriega
1,
Manuel R. Kirchmayr
1,
Benjamín Rodríguez-Garay
1,
Diego E. Navarro-López
2 and
Antonia Gutiérrez-Mora
1,*
1
Centro de Investigación y Asistencia en Tecnología y Diseño del Estado de Jalisco, A.C., Ave. Normalistas 800, Guadalajara 44270, Jalisco, Mexico
2
Tecnológico de Monterrey, Escuela de Ingeniería y Ciencias, Ave. General Ramon Corona 2514, Zapopan 45138, Jalisco, Mexico
*
Author to whom correspondence should be addressed.
Stresses 2025, 5(3), 51; https://doi.org/10.3390/stresses5030051
Submission received: 5 April 2025 / Revised: 1 August 2025 / Accepted: 4 August 2025 / Published: 15 August 2025
(This article belongs to the Collection Feature Papers in Plant and Photoautotrophic Stresses)

Abstract

Papaya cultivation is severely affected by the papaya ring spot virus (PRSV), for which one of the alternatives to counteract its damage is to use genetic sources of species and/or varieties tolerant or resistant to the virus. This study aimed to determine the tolerance or resistance of different papaya plant lines obtained through crosses and backcrosses between the Maradol variety and a wild species of Vasconcellea tolerant to PRSV. In this work, an evaluation was conducted on plant lines from a cross between a PRSV-tolerant species (Vasconcellea cauliflora) and the Maradol variety (Carica papaya), both belonging to the Caricaceae family. The study used RT-qPCR to measure the viral load and analyzed disease symptoms at two points (97 and 532 days after planting). Initially, it was observed that all the resulting papaya plants developed symptoms of PSRV; however, as time passed, the results showed that lines resulting from the Criolla, M4, and 54 crosses exhibited moderate tolerance, while papaya lines 89 and 90 proved to have high tolerance. Additionally, it was observed that the M4, 89, and 90 papaya lines exhibited disease recovery, as reflected in a decrease in viral loads and the characteristic symptomatology of the virus. Restoration from a viral infection can be associated with the activation of the plant’s RNA silencing mechanism, which can degrade or prevent the translation of viral RNA in plant cells, thus favoring recovery from the disease. Plants evaluated due to their tolerance and resistance levels could use the mechanisms mentioned above to recover from the damage caused by the PRSV.

1. Introduction

Papaya (Carica papaya L.) is an American fruit member of the Caricaceae family; it is a tropical and subtropical crop of high economic and nutritional value that is widely cultivated in Asia, Latin America, Africa, and the Pacific islands. Recognized for its rapid growth, continuous production capacity, and diverse phytochemical properties, papaya has become an essential source of vitamins, minerals, and bioactive compounds, and it is experiencing increasing demand in international markets [1,2]. Its origin is in the Caribbean region of Central America, from where it has expanded widely around the world [3,4].
Despite its significance in the agro-industry, papaya production faces serious phytosanitary threats. Among these, the papaya ringspot virus (PRSV) is considered the most destructive pathogen. This potyvirus, efficiently transmitted by various aphid species, causes severe symptoms such as mosaicism, leaf deformation, stem and petiole necrosis, and concentric rings on fruits, directly impacting the quality and yield of plantations [5]. Several authors have reported the losses caused by PRSV; however, there is no worldwide statistic that represents the losses generated by the virus. In many cases, the presence of PRSV limits production to a single harvest per cycle, resulting in economic losses of up to 100% [6,7]. Due to the damage that PRSV causes in plantations, it can limit the production of large areas to only one crop a year, principally affecting productivity and decreasing fruit quality [8]. Each country where it is grown is creating alternatives for crop management, aphid control, generation of new genetic lines, and growing seasons, among others. To date, there are no reports on genetic lines that are resistant to PRSV; only some tolerance has been reported.
Currently, management strategies rely on vector control, removing infected plants, and using tolerant varieties sparingly. These methods are often unsustainable and less effective, especially under conditions of high viral pressure or climatic challenges. Although some transgenic lines show effective resistance, their commercial and regulatory approval remains limited in many countries. Faced with these challenges, traditional genetic resistance remains a strategic and sustainable option. Several wild species of the genus Vasconcellea, such as V. cauliflora, V. pubescens, and V. quercifolia, have demonstrated natural resistance to PRSV [9,10,11]. This has led to research focusing on developing intergeneric hybrids using classical breeding methods, like crosses and backcrosses, to transfer resistance genes to commercial strains of C. papaya.
According to Bruening (2006) [12], tolerance refers to systems in which the symptoms are significantly reduced in intensity or absence. Still, the viral load is not reduced or only slightly reduced relative to the reference infection. On the other hand, resistance refers to a class of plants that reduce the multiplication of viruses, as well as decrease or prevent the proliferation of the virus in the plant and reduce the symptomatology of the disease [13].
Although the effects of PRSV and the vectors that transmit the virus are known, little is known about the effect on the growth stage and the correlation between viral load and disease severity [5].
In this context, the present study aims to evaluate the effective transfer of tolerance and/or resistance to PRSV from V. cauliflora to C. papaya var. Maradol through intergeneric breeding strategies. Additionally, the new hybrid lines were examined using molecular techniques, including RT-qPCR, to measure viral load and establish connections with symptom severity and plant agronomic performance. This research not only enhances our understanding of plant defense mechanisms but also opens new opportunities for developing more resilient and sustainable cultivars, directly impacting productivity, food security, and a reduction in biotic stress in tropical crops.

2. Results

2.1. Symptomatology Evaluation

All plants evaluated at the Experimental Field of Valle de Apatzingán, Michoacán, developed characteristic symptoms of the papaya ring spot virus. The results of the evaluation of incidence and severity are presented in Table 1.
Plants in the field showed a visual recovery in the severity of the disease. Disease incidence of the Criolla line decreased from 9 to 3 on the scale, while the severity remained at a value of 3 during the two samplings.
The M4 line decreased its incidence from 8 to 7 and its severity from 4 to 2 on the scale. Line 89 registered an initial value of 9 in incidence, which decreased to 6; on the other hand, in severity, this line remained at a value of 3 over time—a behavior similar to that of Criolla.
Finally, line 90 had an incidence of 9 during both samples; however, it had a recovery in the severity of the disease, registering a value of 3 at 97 DAP and a value of 2 at 532 DAP, i.e., despite the fact that the infection remained in every plant, its severity decreased.
Figure 1 compares the percentage of the severity of each genotype between Sampling 1 (97 DAP) and Sampling 2 (532 DAP) based on their severity scale. In Sampling 1, Maradol had a 60% severity grade 5, while Criolla had a 60% severity grade 3. Similarly, line 89 is highlighted with a 75% severity grade 3. This reflects Maradol’s susceptibility to PRSV. On the other hand, in Sampling 2, Criolla maintained its 60% severity between grades 3 and 2. Similarly, in line 89, 75% severity ranged between degrees 3, 2, and 1 compared with Maradol, where 40% of the severity increased to 9 on the scale.
According to the disease index at Sampling 2 (Table 2), it was determined that Maradol is moderately susceptible. At the same time, the Criolla line proved to be somewhat tolerant, as well as the M4 line, while line 89 was highly tolerant. Lines 54 and 90, , are not reported in this analysis because they have insufficient samples.

2.2. Evaluation of Viral Load

The viral load analyzed at 97 and 532 DAP is presented in Table 3 and Table 4, respectively, and graphically in Figure 2. In all papaya plant lines, a decrease in viral load was observed (p-value < 0.05), with the most significant decreases noted in the Chica-2, M4, and 89 lines.
A significant decrease in viral load (Figure 2) and severity was observed between the first and second sampling (p-value < 0.05). It can be associated with the recovery of the plant. Recovery is a phenomenon characterized by the systemic infection of the virus, which is associated with symptoms, followed by a decrease and eventual disappearance of these symptoms in the young leaves of the recovered plant.
On the other hand, the Chica-2 line exhibited a behavior similar to that of Maradol, with both showing an increase in severity from Sampling one to Sampling two. Additionally, both were found to be moderately susceptible, although their viral load decreased over time and they had lower initial viral loads.

3. Discussion

The results obtained in the present study reveal apparent differences in the response of hybrid papaya lines to PRSV, enabling the analysis of their tolerance levels and agronomic potential for field production. Different levels of tolerance have been found in different papaya varieties. In the case of the Sinta hybrid, whose female parent is the V. cariflora species, both are considered resistant, and the disease index was used as a tool to classify the levels of resistance and tolerance to PRSV. These lines were compared with the Solo variety, which is susceptible to the virus. The results indicated that Sinta and V. cariflora exhibit moderate tolerance to PRSV [13]. Similarly, in the present study, the Criolla, M4, and 54 lines were classified as moderately tolerant based on their disease index (Table 2), which suggests that these lines could have phytosanitary behavior comparable to previously reported tolerant materials. It is essential to note that tolerance is defined as the host’s ability to withstand a systemic viral infection, exhibiting attenuated symptoms compared to susceptible plants [14]. Likewise, tolerance can also be considered as the ability of the plant to minimize the impact of the infection on its physiological state [15]. Interestingly, tolerant lines derived from the landrace Madhubala, known as Pune Selection (PS), have been observed to show superior tolerance to PRSV compared to commercial varieties such as Red Lady. This highlights the value of local and wild lines as sources of tolerance genes in breeding programs [16].
In this study, the Criolla, M4, 54, 89, and 90 lines demonstrated levels of tolerance to PRSV, as evidenced by a reduction in symptom severity and disease incidence (Table 1). Furthermore, these lines did not show significant adverse effects on growth, in contrast to the highly susceptible Maradol variety, where plant losses were observed due to the severity of the infection. This may be because tolerance can be effective against single-virus infections. Still, its efficacy decreases in mixed infections [17], such as those produced by the combination of PRSV with Papaya Mosaic Virus, where symptoms tend to be more severe [9]. Furthermore, overlapping symptoms between PRSV and other viruses can make it challenging to accurately identify the cause of the disease.
RNA silencing has been identified as a crucial mechanism in plant antiviral defense [18,19]. A couple of properties associated with RNA silencing have been established, such as “viral accommodation” and “tolerance” [19]. In viral accommodation, the plant maintains a high viral load and persistent symptoms without achieving recovery. At the same time, tolerance implies a reduction in symptoms and the viral load is unreduced or only slightly reduced, allowing for growth that is comparable to that of healthy plants. In this study, the Criolla, M4, 89, and 90 lines showed signs of recovery, since the severity and incidence progressively decreased compared to Maradol. However, their viral loads, in some cases, were higher than those of the susceptible plant. This suggests the activation of defense mechanisms that limit physiological damage, regardless of the total viral load. It is also highlighted that a variety can be considered tolerant when the virus multiplies with only a slight reduction in yield [17]. However, when the reduction in symptoms is associated with a decrease in viral load, variety could present both tolerance and resistance.
Lines M4 and 89 exhibited precisely this behavior, maintaining reduced symptoms alongside lower viral loads during the second sampling, suggesting a combined effect of tolerance and partial resistance. A critical sustainable approach with low or zero environmental impact for tolerance and/or resistance to disease control is through the development of new cultivars. Natural sources of resistance have been widely utilized in conventional breeding programs, underscoring the potential of the studied lines as valuable germplasm. These new approaches in the generation of hybrids with these properties mark differences in miRNA expression between susceptible and tolerant papayas to PRSV, as well as in their wild relative, Vasconcellea cauliflora [9,10,11]. They detected 44 known miRNAs and 291 potentially novel ones that are differentially regulated during infection. These findings suggest that miRNA-mediated silencing mechanisms may, at least in part, explain the differential response observed in the M4 and 89 lines, which reduced their viral load during infection. This opens a promising avenue for future studies focused on identifying key miRNAs involved in PRSV tolerance, with potential applications in genetic improvement and biotechnology.

4. Materials and Methods

4.1. Plant Material and Sampling Collection

Papaya lines were obtained in the Plant Biotechnology unit of the Center for Research and Assistance in Technology and Design of the State of Jalisco A.C. (CIATEJ), resulting from crosses between the wild species Vasconcellea cauliflora, known as Criolla (tolerant parent), and the Maradol variety (susceptible parent). A selection of plants obtained from crosses was made in a commercial plantation located along the Barra de Navidad-La Huerta Road in the municipality of Jaluco, Jalisco. The genetic lines that showed tolerance to PRSV were self-fertilized and seeds from these lines were used for this experiment.
Based on their progeny, it is believed that these lines may exhibit tolerance or resistance to PRSV. Twenty plants of approximately 15 cm, from the lines derived from the crosses M4, Chica-2, 54, 89, and 90, were planted in the Experimental Field of Valle de Apatzingán, Michoacán. For the sampling of papaya plants, young leaves showing the characteristic symptoms of the virus in nine plants were selected (symptoms such as mosaicism, leaf deformation, stem and petiole necrosis), infection of the plants was not necessary since they were infected naturally. These were placed in labeled plastic bags and stored at −80 °C. Collections of plant material were conducted at two different time points. “Sampling 1” was made 97 days after planting (DAP) in February 2015, and “Sampling 2” at 532 DAP in May 2016.
The evaluation was performed by measuring the incidence and severity of the virus symptoms in papaya plants; with the severity value, the disease index (DI) was calculated to determine the tolerance or resistance of the plants; subsequently, the DI was related to the viral load of each line in two different samplings at 97 and 532 DAP. All plant lines appeared in the analyses, except for lines 54 and 90, of which there was only one plant; however, their behavior is mentioned later in some sections.

4.2. Quantification of PRSV Viral Load

A genomic strategy similar to that of Premchand et al. (2025) [5] was followed in this work. In nine plants total RNA extraction was performed using the TRIzol method, as described by Liu et al. (2013) [20]. Then, reverse transcription PCR (RT-PCR) was performed to generate complementary DNA (cDNA) from 1 µg of RNA, with the First Script Strand Synthesis SuperMix Kit for qRT-PCR (Invitrogen). Next, an end-point PCR was performed, using primers for the amplification of the papaya Annular Stain Virus (CPV) capsid protein of PRSV, GACCATGGCCAAGAATGAAGCTGTG (forward) and TTTTTTTTCTCATATTAAGAGGCTC (reverse) [21] and amplification of the fragment was verified by 1% agarose gel electrophoresis.
Papaya ring spot virus was quantified using real-time PCR (qPCR) with the Maxima Probe Kit qPCR Master Mix (2X), and ROX solution (Thermo Scientific), following the manufacturer’s instructions. For this test, a pair of Forward AGAAATCGAAAGCGTATCTAGCAA and Reverse CCGTCATTTAGGCAGATTATGG primers were designed, a probe (TCAGTCAAATTCCTTTTATTCCATACCGC) labeled with the JOE ™ fluorophore and a DNA standard of 148 bp (AGAAATCGAAAGCGTATCTAGCAAGGCTAATGTCAGTCAAATTCCTTTTTATTCCATACCGCGGCATGTACTTCTCAGTAGCATTCCTCTTTGCAATATATGCTTCTGCCGCGTTACTAAAGTGAGCCATAATCTGCCTAAATGACGG) (T4 Oligo, Irapuato, Mexico) was used for the standard curve), following the recommendations of the qPCR guide [22].

4.3. Evaluation of Plant Symptoms and Calculation of the Disease Index

Symptomatology evaluation was performed using the severity scale reported by Janthasri et al. (2015) [23] with some modifications (Table 5).
From the disease severity obtained from the evaluated lines, the disease index was calculated using the following formula [24]:
D I % = ( a × b ) N × K × 100
where DI = Disease Index (%); a = total of plants in each grade of the scale; b = grade of the corresponding scale; N = total number of plants evaluated; K = maximum degree of the scale (K = 9).
As shown in Table 6 (Alviar et al., 2012) [13], the disease index was used to determine whether the plant lines exhibited tolerance or susceptibility to the disease caused by PRSV.
To evaluate incidence, the selected plants were physically analyzed considering the characteristic symptoms of PRSV, using the rice disease evaluation scales (International Rice Testing Program 1988): 0—No incidence, 1—1–5%, 2—6–10%, 3—11–20%, 4—21–30%, 5—31–40%, 6—1–50%, 7—51–60%, 8—61–80%, 9—81–100%.

4.4. Statistical Analyisis

Normality and homogeneity of variance tests were conducted to ensure that the assumptions necessary for analysis of variance (ANOVA) were met. ANOVA was then applied to assess the effects of the strains on viral loads between the two samples. Statistical analysis was carried out using R software (R Core Team, version 4.5.0) and the RStudio integrated development environment (RStudio Team, version 2025.05.1+513).

5. Conclusions

The plant lines evaluated in these experiments were found to have a tolerance to PRSV. M4, like the Criolla line—the tolerant parent—was classified as moderately tolerant; on the other hand, line 89 proved highly tolerant to PRSV.
Considering the mentioned terms of tolerance and resistance, plant lines M4 and 89 may possess both characteristics as they exhibited recovery from the disease, which was reflected in the decrease in severity and viral load in the lines between Sampling 1 and Sampling 2.
Compared to Maradol (the susceptible parent), the Criolla plant lines, as well as M4 and 89, had lower severity levels. During Sampling 1, the viral load of the three lines mentioned was more significant than the viral load of Maradol; however, in Sampling 2, a recovery of the disease was observed, with a decrease in the viral load in the plant lines.
This study allowed us to know the behavior of the new lines of papaya plants against the virus, relating the severity of the disease with the viral load in the plants. The genetic lines M4 and 89 may be considered for future studies on the genetic improvement and behavior of PRSV-tolerant or resistant plants.
In the case of lines 54 and 90, it is essential to re-evaluate them because they presented tolerance to the virus; however, the lack of plant material prevented them from being considered in the analysis.

Author Contributions

Conceptualization: A.G.-M., M.R.K. and B.R.-G.; methodology: L.M.S.-N., A.G.-M., B.R.-G. and M.R.K.; writing and editing: L.M.S.-N., A.G.-M., B.R.-G. and M.R.K.; statistics analysis: D.E.N.-L.; review and supervision: L.M.S.-N., A.G.-M., B.R.-G. and M.R.K. All authors have read and agreed to the published version of the manuscript.

Funding

Consejo Nacional de Ciencia y Tecnología (CONACyT), for the grant given during the study for a Master’s in science and technology in the specialty of productive biotechnology of the postgraduate program in science and technology. Consejo Nacional de Ciencia y Tecnología (CONACyT), for the grant given for the project with number MICH-2012-05-197737.

Data Availability Statement

All relevant data are within the paper.

Acknowledgments

The authors would like to thank Andrea Pérez Gutiérrez for the artwork of the figures. We would also like to thank the PlanTECC laboratory for facilitating this research project.

Conflicts of Interest

The authors declare that there are no conflicts of interest nor personal relations that have influenced the presentation of this manuscript.

References

  1. Koul, B.; Pudhuvai, B.; Sharma, C.; Kumar, A.; Sharma, V.; Yadav, D.; Jin, J.-O. Carica papaya L.: A Tropical Fruit with Benefits beyond the Tropics. Diversity 2022, 14, 683. [Google Scholar] [CrossRef] [Scilit]
  2. Miranda-Ramírez, J.M.; Aguilar-García, O.; Miranda-Medina, D. Comparación de la productividad agrícola-económica sustentable y convencional de papaya, en Michoacán, México. Agron. Mesoam. 2020, 31, 384–403. [Google Scholar] [CrossRef] [Scilit]
  3. Arango, L.; Román, C. Aspectos botánicos. In Manual de Asistencia Técnica No. 4. Cultivo de la Papaya en los Llanos Orientales de Colombia; Corporación Colombiana de Investigación Agropecuaria; Asociación de Horticultores y Fruticultores de Colombia; Servicio Nacional de Aprendizaje: Villavicencio, Colombia, 1999; pp. 13–21. Available online: https://repository.agrosavia.co/bitstream/handle/20.500.12324/12830/42363_46132.pdf?sequence=1&isAllowed=y (accessed on 19 March 2025).
  4. Manshardt, R. Papaya. In Biotechnology of Perennial Fruit Crops; Hammerschlag, F.A., Litz, R.E., Eds.; CABI: Wallingford, UK, 1992; pp. 489–511. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/19931635613 (accessed on 6 March 2025).
  5. Premchand, U.; Mesta, R.K.; Devappa, V.; Basavarajappa, M.P.; Venkataravanappa, V.; Narasimha Reddy, L.R.C.; Shankarappa, K.S. Survey, Detection, Characterization of Papaya Ringspot Virus from Southern India and Management of Papaya Ringspot Disease. Pathogens 2023, 12, 824. [Google Scholar] [CrossRef] [Scilit] [PubMed] [PubMed Central]
  6. Cartón, I. La biotecnología al servicio del cultivo de la papaya. Vida Rural. 2002, 160, 35–37. Available online: https://www.mapa.gob.es/ministerio/pags/Biblioteca/Revistas/pdf_vrural%2FVrural_2002_160_35_37.pdf (accessed on 10 February 2025).
  7. Muhammad, U.; Mustansar, M.Y.I.; Haider, A.; Muhammad, Z.; Rafia, A.; Mazhar, A.; Malik, A.R.; Ernesto, A.M.E.; Yuejun, H. Papaya Ring Spot Virus: An Understanding of a Severe Positive-Sense Single. Stranded RNA Viral Disease and Its Management. Phyton Int. J. Exp. Bot. 2022, 91, 2099–2110. [Google Scholar] [CrossRef] [Scilit]
  8. Alcántara, J.J.A.; Hernández, C.E.; Ayvar, S.S.; Damián, N.A.; Brito, G.T. Características fenotípicas y agronómicas de seis genotipos de papaya (Carica papaya L.) de Tuxpan, Guerrero, México. Rev. Venez. Cienc. Tecnol. Aliment. 2010, 1, 035–046. Available online: https://oaji.net/articles/2017/4924-1495199597.pdf (accessed on 19 February 2025).
  9. Siar, S.V.; Beligan, G.A.; Sajise, A.J.C.; Villegas, V.N.; Drew, R.A. Papaya ringspot virus resistance in Carica papaya via introgression from Vasconcellea quercifolia. Euphytica 2011, 181, 159–168. [Google Scholar] [CrossRef] [Scilit]
  10. Razean, H.M.R.; Drew, R.A. Isolation and Characterization of PRSV-P Resistance Genes in Carica and Vasconcellea. Int. J. Genom. 2014, 2014, 145403. [Google Scholar] [CrossRef] [Scilit]
  11. Vasugi, C.; Ravishankar, K.V.; Kumar, A.; Poornima, K. Genetic Enhancement of Nutraceuticals in Papaya (Carica papaya L.). In Compendium of Crop Genome Designing for Nutraceuticals; Springer Nature: Singapore, 2023; pp. 1001–1031. [Google Scholar]
  12. Bruening, G. Resistance to Infection. In Natural Resistance Mechanism of Plant to Viruses; Loebenstein, G., Carr, J.P., Eds.; Springer: Dordrecht, The Netherlands, 2006; pp. 211–240. [Google Scholar]
  13. Alviar, A.; Cruz, F.S.; Hautea, D. Assessing the responses of tolerant papaya (Carica papaya L.) varieties to Papaya RingSpot Virus (PRSV) infection and establishment of symptom severity rating scale for resistance screening. Crop Sci. Soc. Phillippines 2012, 37, 20–28. Available online: https://www.cabi.org/gara/mobile/FullTextPDF/2012/20123307085.pdf (accessed on 14 February 2025).
  14. Rubio, L.; Herrero, J.R.; Sarrió, J.; Moreno, P.; Guerri, J. A new approach to evaluate relative resistance and tolerance of tomato cultivars to begomoviruses causing the tomato yellow leaf curl disease in Spain. Plant Pathol. 2003, 52, 763–769. [Google Scholar] [CrossRef] [Scilit]
  15. Pagán, I.; Alonso-Blanco, C.; García-Arenal, F. Differential Tolerance to Direct and Indirect Density-Dependent Costs of Viral Infection in Arabidopsis thaliana. PLoS Pathog. 2009, 5, e1000531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Sharma, S.K.; Tripathi, S. Horticultural characterization and papaya ringspot virus reaction of papaya Pune Selections. Indian J. Hortic. 2019, 76, 32–37. [Google Scholar] [CrossRef] [Scilit]
  17. Bengyella, L.; Waikhom, S.D.; Allie, F.; Rey, C. Virus tolerance and recovery from viral-induced symptoms in plants are associated with transcriptome reprogramming. Plant Mol. Biol. 2015, 89, 243–252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. MacDiarmid, R. RNA silencing in productive virus infections. Annu. Rev. Phytopathol. 2005, 43, 523–544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Patil, B.L.; Tripathi, S. Differential expression of microRNAs in response to apaya ringspot virus infection in differentially responding genotypes of papaya (Carica papaya L.) and its wild relative. Front. Plant Sci. 2024, 15, 1398437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Liu, W.; Zhao, X.; Zhang, P.; Mar, T.; Liu, Y.; Zhang, Z.; Han, C.; Wang, X. A one-step real-time RT-PCR assay for the quantification of Wheat yellow mosaic virus (WYMV). Virol. J. 2013, 10, 173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Ruiz-Castro, S.; Silva-Rosales, L. Use of RT-PCR for papaya ringspotyvirus detection in papaya (Carica papaya) plants from Veracruz, Tabasco and Chiapas. Rev. Mex. Fitopatol 1997, 15, 83–90. [Google Scholar]
  22. Wang, X.; Seed, B. High-throughput primer and probe design. In Real-Time PCR; Dorak, M., Ed.; Taylor and Francis Group: Abingdon, UK, 2006; pp. 93–105. Available online: https://www.taylorfrancis.com/chapters/edit/10.4324/9780203967317-14/high-throughput-primer-probe-design-xiaowei-wang-brian-seed (accessed on 12 February 2025).
  23. Janthasri, R.; Chaiyaboon, W. Yellow Krang—A new cultivar of papaya for green consumption with tolerance to papaya ringspot virus. J. Hortic. Res. 2015, 23, 39–48. [Google Scholar] [CrossRef] [Scilit]
  24. Cabrera, D.; García, D.; Portal, O. Virus de la mancha anular de la papaya (PRSV-p): Biología, epifitología y diversidad genética como base para el manejo mediante técnicas biotecnológicas. Biotecnol. Veg. 2010, 10, 67–77. [Google Scholar]
Figure 1. PRSV severity percentage of papaya genotypes between Sampling 1 and Sampling 2.
Figure 1. PRSV severity percentage of papaya genotypes between Sampling 1 and Sampling 2.
Stresses 05 00051 g001
Figure 2. Viral load of the papaya lines sampled in the “Apatzingán Valley” at 97 DAP and 532 DAP.
Figure 2. Viral load of the papaya lines sampled in the “Apatzingán Valley” at 97 DAP and 532 DAP.
Stresses 05 00051 g002
Table 1. Mean incidence and severity of the disease at 97 and 532 DAP.
Table 1. Mean incidence and severity of the disease at 97 and 532 DAP.
Sampling 1 (97 DAP)Sampling 2 (532 DAP)
Genetic LineNumber of Plants
Evaluated
Incidence Mean Severity MeanIncidence MeanSeverity Mean
Maradol109586
Criolla109333
M4118472
Chica-2129374
5419494
8949363
9019392
Table 2. Disease index of papaya plants in the experimental field Valle de Apatzingán, Michoacán, at 97 and 532 DAP.
Table 2. Disease index of papaya plants in the experimental field Valle de Apatzingán, Michoacán, at 97 and 532 DAP.
Genetic LineNo. Plants TestedDisease IndexComment
97 Days532 Days
Maradol 10 38.89 65.56 Moderately susceptible
Criolla 10 33.33 34.57 Moderately tolerant
M4 11 41.41 28.28 Moderately tolerant
Chica-2 12 35.19 50.93 Moderately susceptible
54 1 44.44 44.44 Moderately tolerant
89 4 36.11 22.22 Highly tolerant
90 1 33.33 22.22 Highly tolerant
Table 3. Viral load analyzed in plant lines at 97 DAP.
Table 3. Viral load analyzed in plant lines at 97 DAP.
SampleCq (Quantification Cycle)Copies/μg of Total RNALog10 of Copies/μg of Total RNA
Maradol 17.799 3.31 × 1099.493 ± 0.174
Criolla 20.845 5.59 × 1098.660 ± 1.670
Chica-2 20.168 1.25 × 101010.116 ± 0.195
M4 23.545 1.41 × 101010.021 ± 0.290
89 22.9 1.81 × 101010.223 ± 0.211
Table 4. Viral load analyzed in plant lines at 532 DAP.
Table 4. Viral load analyzed in plant lines at 532 DAP.
SampleCq (Quantification Cycle)Copies/μg of Total RNALog10 of Copies/μg of Total RNA
Maradol 19.92 1.67 × 1088.186 ± 0.231
Criolla 18.94 3.79 × 1088.373 ± 0.536
Chica-2 21.75 1.84 × 1077.965 ± 0.318
M4 20.86 1.11 × 1087.746 ± 0.150
89 19.85 3.34 × 1088.282 ± 0.560
Table 5. Scale to measure disease severity in papaya plants.
Table 5. Scale to measure disease severity in papaya plants.
Range ScaleSeverity
Percentage (%)
Description of SymptomsComments
00No symptomsResistant
10–0.9Very light speckled no bruises or stripes on petioles and stem.Highly tolerant
21–5Very light speckled yellow areas cover 1–5% of the leaf area, with some rings on the leaves but no noticeable symptoms on the fruit no bruises or streaks on petioles and stems.
36–25Very light speckled yellow areas cover 6–25% of the leaf area, with some rings on the leaves but no noticeable symptoms on the fruit no bruises or stripes on petioles and stem.Moderately tolerant
526–50Very light speckled yellow areas cover 26–50% of the leaf area soft fruit rings no bruises or stripes on petioles or stems.
751–75Speckled yellow areas cover 51–75% of the leaf area, with clear evidence of rings throughout the fruit bruises or streaks on petioles and stems.Moderately susceptible
975–100Severe speckled yellow areas cover 75–100% of the leaf area deformed and fragile leaves with severe distortion with visible ribbing clearly visible rings throughout the fruit crusty spots deformed fruit rough and bitter outer shell and granulated flesh.Highly susceptible
Table 6. Disease index and characteristics of the plants concerning PRSV.
Table 6. Disease index and characteristics of the plants concerning PRSV.
Disease Index (%)Plant Characteristics
0–25Highly tolerant
26–50Moderately tolerant
51–75Moderately susceptible
75–100Highly susceptible
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Sánchez-Noriega, L.M.; Kirchmayr, M.R.; Rodríguez-Garay, B.; Navarro-López, D.E.; Gutiérrez-Mora, A. Evaluation of Papaya Plants Tolerant to PRSV Obtained Through Conventional Genetic Improvement. Stresses 2025, 5, 51. https://doi.org/10.3390/stresses5030051

AMA Style

Sánchez-Noriega LM, Kirchmayr MR, Rodríguez-Garay B, Navarro-López DE, Gutiérrez-Mora A. Evaluation of Papaya Plants Tolerant to PRSV Obtained Through Conventional Genetic Improvement. Stresses. 2025; 5(3):51. https://doi.org/10.3390/stresses5030051

Chicago/Turabian Style

Sánchez-Noriega, Luz María, Manuel R. Kirchmayr, Benjamín Rodríguez-Garay, Diego E. Navarro-López, and Antonia Gutiérrez-Mora. 2025. "Evaluation of Papaya Plants Tolerant to PRSV Obtained Through Conventional Genetic Improvement" Stresses 5, no. 3: 51. https://doi.org/10.3390/stresses5030051

APA Style

Sánchez-Noriega, L. M., Kirchmayr, M. R., Rodríguez-Garay, B., Navarro-López, D. E., & Gutiérrez-Mora, A. (2025). Evaluation of Papaya Plants Tolerant to PRSV Obtained Through Conventional Genetic Improvement. Stresses, 5(3), 51. https://doi.org/10.3390/stresses5030051

Article Metrics

Back to TopTop