Microfluidic Isolation of Aptamers for Intracellular Measurement of Radio-Responsive Proteins
Simple Summary
Abstract
1. Introduction
2. Results and Discussion
2.1. Microfluidic Selection of Aptamers
2.2. In Vivo Colocalization of Anti-BAX Aptamer and Antibody
2.3. Functional Validation of Intracellular BAX Labeling in Human and Mouse Peripheral Blood
3. Experimental Section
3.1. Aptamer Selection and In Vitro Characterizations
3.2. Colocalization Studies in TK6 Cells
3.3. Radiation Blood Studies
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Swartz, H.M.; Barry Flood, A. Matching Biodosimetry to Likely Types of Exposure and Needs for Triage for Medical Management of Radiation Syndrome Following a Nuclear Event. Int. J. Radiat. Biol. 2025, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Brzóska, K.; Kruszewski, M. Toward the Development of Transcriptional Biodosimetry for the Identification of Irradiated Individuals and Assessment of Absorbed Radiation Dose. Radiat. Environ. Biophys. 2015, 54, 353–363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, C.; He, N.; Liu, Y.; Wang, Y.; Liu, Q. Research Progress on Biodosimeters of Ionizing Radiation Damage. Radiat. Med. Prot. 2020, 1, 127–132. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.K.; Han, E.A.; Lee, S.S.; Ha, W.H.; Barquinero, J.F.; Lee, H.R.; Cho, M.S. Cytogenetic Biodosimetry for Fukushima Travelers after the Nuclear Power Plant Accident: No Evidence of Enhanced Yield of Dicentrics. J. Radiat. Res. 2012, 53, 876–881. [Google Scholar] [CrossRef] [Scilit]
- Suto, Y.; Hirai, M.; Akiyama, M.; Kobashi, G.; Itokawa, M.; Akashi, M.; Sugiura, N. Biodosimetry of Restoration Workers for the Tokyo Electric Power Company (TEPCO) Fukushima Daiichi Nuclear Power Station Accident. Health Phys. 2013, 105, 366–373. [Google Scholar] [CrossRef] [Scilit]
- Vaurijoux, A.; Gregoire, E.; Roch-Lefevre, S.; Voisin, P.P.; Martin, C.; Voisin, P.P.; Roy, L.; Gruel, G. Detection of Partial-Body Exposure to Ionizing Radiation by the Automatic Detection of Dicentrics. Radiat. Res. 2012, 178, 357–364. [Google Scholar] [CrossRef] [Scilit]
- Hernández, L.; Terradas, M.; Martín, M.; Tusell, L.; Genescà, A. Highly Sensitive Automated Method for DNA Damage Assessment: Gamma-H2AX Foci Counting and Cell Cycle Sorting. Int. J. Mol. Sci. 2013, 14, 15810–15826. [Google Scholar] [CrossRef] [Scilit]
- Lee, Y.; Wang, Q.; Shuryak, I.; Brenner, D.J.; Turner, H.C. Development of a High-Throughput γ-H2AX Assay Based on Imaging Flow Cytometry. Radiat. Oncol. 2019, 14, 150. [Google Scholar] [CrossRef] [Scilit]
- Qian, Q.Z.; Cao, X.K.; Shen, F.H.; Wang, Q. Effects of Ionising Radiation on Micronucleus Formation and Chromosomal Aberrations in Chinese Radiation Workers. Radiat. Prot. Dosim. 2016, 168, 197–203. [Google Scholar] [CrossRef] [Scilit]
- Sullivan, J.M.; Prasanna, P.G.S.; Grace, M.B.; Wathen, L.K.; Wallace, R.L.; Koerner, J.F.; Coleman, C.N. Assessment of Biodosimetry Methods for a Mass-Casualty Radiological Incident: Medical Response and Management Considerations. Health Phys. 2013, 105, 540–554. [Google Scholar] [CrossRef] [Scilit]
- Acharya, S.S.; Fendler, W.; Watson, J.; Hamilton, A.; Pan, Y.; Gaudiano, E.; Moskwa, P.; Bhanja, P.; Saha, S.; Guha, C.; et al. Serum microRNAs Are Early Indicators of Survival after Radiation-Induced Hematopoietic Injury. Sci. Transl. Med. 2015, 7, 287ra69. [Google Scholar] [CrossRef] [Scilit]
- Tomasik, B.; Fendler, W.; Chowdhury, D. Serum microRNAs—Potent Biomarkers for Radiation Biodosimetry. Oncotarget 2018, 9, 14038–14039. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aryankalayil, M.J.; Chopra, S.; Levin, J.; Eke, I.; Makinde, A.; Das, S.; Shankavaram, U.; Vanpouille-Box, C.; Demaria, S.; Coleman, C.N. Radiation-Induced Long Noncoding RNAs in a Mouse Model after Whole-Body Irradiation. Radiat. Res. 2018, 189, 251–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, Q.; Gong, W.; Wang, J.; Ji, K.; Sun, X.; Xu, C.; Du, L.; Wang, Y.; Liu, Q. Analysis of Changes to lncRNAs and Their Target mRNAs in Murine Jejunum after Radiation Treatment. J. Cell. Mol. Med. 2018, 22, 6357–6367. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brengues, M.; Paap, B.; Bittner, M.; Amundson, S.; Seligmann, B.; Korn, R.; Lenigk, R.; Zenhausern, F. Biodosimetry on small blood volume using gene expression assay. Health Phys. 2010, 98, 179–185. [Google Scholar] [CrossRef] [Scilit]
- Escalona, M.B.; Ryan, T.L.; Balajee, A.S. Current Developments in Biodosimetry Tools for Radiological/Nuclear Mass Casualty Incidents. Environ. Adv. 2022, 9, 100265. [Google Scholar] [CrossRef] [Scilit]
- Sproull, M.; Camphausen, K. State-of-the-Art Advances in Radiation Biodosimetry for Mass Casualty Events Involving Radiation Exposure. Radiat. Res. 2016, 186, 423–435. [Google Scholar] [CrossRef] [Scilit]
- Sproull, M.T.; Camphausen, K.A.; Koblentz, G.D. Biodosimetry: A Future Tool for Medical Management of Radiological Emergencies. Health Secur. 2017, 15, 599–610. [Google Scholar] [CrossRef] [Scilit]
- Wilkins, R.C.; Rodrigues, M.A.; Beaton-Green, L.A. The Application of Imaging Flow Cytometry to High-Throughput Biodosimetry. Genome Integr. 2017, 8, 7. [Google Scholar] [CrossRef] [Scilit]
- Wang, Q.; Lee, Y.; Shuryak, I.; Pujol Canadell, M.; Taveras, M.; Perrier, J.R.; Bacon, B.A.; Rodrigues, M.A.; Kowalski, R.; Capaccio, C.; et al. Development of the FAST-DOSE Assay System for High-Throughput Biodosimetry and Radiation Triage. Sci. Rep. 2020, 10, 12716. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Xu, S.; Yan, H.; Li, X.; Yazd, H.S.; Li, X.; Huang, T.; Cui, C.; Jiang, J.; Tan, W. Nucleic Acid Aptamers for Molecular Diagnostics and Therapeutics: Advances and Perspectives. Angew. Chem. Int. Ed. 2021, 60, 2221–2231. [Google Scholar] [CrossRef] [Scilit]
- Xie, S.; Du, Y.; Zhang, Y.; Wang, Z.; Zhang, D.; He, L.; Qiu, L.; Jiang, J.; Tan, W. Aptamer-Based Optical Manipulation of Protein Subcellular Localization in Cells. Nat. Commun. 2020, 11, 1347. [Google Scholar] [CrossRef] [Scilit]
- Ku, T.H.; Zhang, T.; Luo, H.; Yen, T.M.; Chen, P.W.; Han, Y.; Lo, Y.H. Nucleic Acid Aptamers: An Emerging Tool for Biotechnology and Biomedical Sensing. Sensors 2015, 15, 16281–16313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, H.; Zhu, X.; Lu, P.Y.; Rosato, R.R.; Tan, W.; Zu, Y. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy. Mol. Ther. Nucleic Acids 2014, 3, e182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dunn, M.R.; Jimenez, R.M.; Chaput, J.C. Analysis of Aptamer Discovery and Technology. Nat. Rev. Chem. 2017, 1, 76. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Lai, B.S.; Juhas, M. Recent Advances in Aptamer Discovery and Applications. Molecules 2019, 24, 941. [Google Scholar] [CrossRef] [Scilit]
- Yu, M.; Wang, H.; Fu, F.; Li, L.; Li, J.; Li, G.; Song, Y.; Swihart, M.T.; Song, E. Dual-Recognition Förster Resonance Energy Transfer Based Platform for One-Step Sensitive Detection of Pathogenic Bacteria Using Fluorescent Vancomycin-Gold Nanoclusters and Aptamer-Gold Nanoparticles. Anal. Chem. 2017, 89, 4085–4090. [Google Scholar] [CrossRef] [Scilit]
- Le, T.T.; Bruckbauer, A.; Tahirbegi, B.; Magness, A.J.; Ying, L.; Ellington, A.D.; Cass, A.E.G. A Highly Stable RNA Aptamer Probe for the Retinoblastoma Protein in Live Cells. Chem. Sci. 2020, 11, 4467–4474. [Google Scholar] [CrossRef] [Scilit]
- Sproull, M.; Shankavaram, U.; Camphausen, K. Novel Murine Biomarkers of Radiation Exposure Using an Aptamer-Based Proteomic Technology. Front. Pharmacol. 2021, 12, 33131. [Google Scholar] [CrossRef] [Scilit]
- Dembowski, S.K.; Bowser, M.T. Microfluidic Methods for Aptamer Selection and Characterization. Analyst 2017, 143, 21–32. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.; Zhang, W.; Jia, S.; Guan, Z.; Yang, C.J.; Zhu, Z. Microfluidic Approaches to Rapid and Efficient Aptamer Selection. Biomicrofluidics 2014, 8, 041501. [Google Scholar] [CrossRef] [Scilit]
- Sinha, A.; Gopinathan, P.; Chung, Y.-D.; Lin, H.-Y.; Li, K.-H.; Ma, H.-P.; Huang, P.-C.; Shiesh, S.-C.; Lee, G.-B. An Integrated Microfluidic Platform to Perform Uninterrupted SELEX Cycles to Screen Affinity Reagents Specific to Cardiovascular Biomarkers. Biosens. Bioelectron. 2018, 122, 104–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, X.; Wen, K.; Citartan, M.; Lin, Q. A Comparative Study of Aptamer Isolation by Conventional and Microfluidic Strategies. Analyst 2022, 148, 787–798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Wang, T.; Wu, Y.; Tan, Y.; Jiang, T.; Li, K.; Lou, B.; Chen, L.; Liu, Y.; Liu, Z. Aptamer Based Probes for Living Cell Intracellular Molecules Detection. Biosens. Bioelectron. 2022, 208, 114231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nemzow, L.; Boehringer, T.; Bacon, B.; Turner, H.C. Development of a Human Peripheral Blood Ex Vivo Model for Rapid Protein Biomarker Detection and Applications to Radiation Biodosimetry. PLoS ONE 2023, 18, e0289634. [Google Scholar] [CrossRef] [Scilit]
- Nemzow, L.; Aljian, A.; Boehringer, T.; Phillippi, M.A.; Taveras, M.; Wang, E.; Shuryak, I.; Polikoff, L.A.; Turner, H.C. Intracellular Lymphocyte Protein Biomarkers for Early Radiological Triage in the Human Population. PLoS ONE 2025, 20, e0331230. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, M.; Youle, R.J.; Tjandra, N. Structure of Bax: Coregulation of Dimer Formation and Intracellular Localization. Cell 2000, 103, 645–654. [Google Scholar] [CrossRef] [Scilit]
- Kitada, S.; Krajewski, S.; Miyashita, T.; Krajewska, M.; Reed, J.C. γ-Radiation Induces Upregulation of Bax Protein and Apoptosis in Radiosensitive Cells in Vivo. Oncogene 1996, 12, 187–192. [Google Scholar]
- Peña-Blanco, A.; García-Sáez, A.J. Bax, Bak and beyond—Mitochondrial Performance in Apoptosis. FEBS J. 2018, 285, 416–431. [Google Scholar] [CrossRef] [Scilit]
- Czabotar, P.E.; Westphal, D.; Dewson, G.; Ma, S.; Hockings, C.; Fairlie, W.D.; Lee, E.F.; Yao, S.; Robin, A.Y.; Smith, B.J.; et al. Bax Crystal Structures Reveal How BH3 Domains Activate Bax and Nucleate Its Oligomerization to Induce Apoptosis. Cell 2013, 152, 519–531. [Google Scholar] [CrossRef] [Scilit]
- Shangary, S.; Johnson, D.E. Peptides Derived from BH3 Domains of Bcl-2 Family Members: A Comparative Analysis of Inhibition of Bcl-2, Bcl-x(L) and Bax Oligomerization, Induction of Cytochrome c Release, and Activation of Cell Death. Biochemistry 2002, 41, 9485–9495. [Google Scholar] [CrossRef] [Scilit]
- Shangary, S.; Oliver, C.L.; Tillman, T.S.; Cascio, M.; Johnson, D.E. Sequence and Helicity Requirements for the Proapoptotic Activity of Bax BH3 Peptides. Mol. Cancer Ther. 2004, 3, 1343–1353. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.; Ellington, A.D. Anti-Peptide Aptamers Recognize Amino Acid Sequence and Bind a Protein Epitope. Proc. Natl. Acad. Sci. USA 1996, 93, 7475–7480. [Google Scholar] [CrossRef] [Scilit]
- Hoinka, J.; Backofen, R.; Przytycka, T.M. AptaSUITE: A Full-Featured Bioinformatics Framework for the Comprehensive Analysis of Aptamers from HT-SELEX Experiments. Mol. Ther. Nucleic Acids 2018, 11, 515–517. [Google Scholar] [CrossRef] [Scilit]
- Hsu, Y.T.; Youle, R.J. Nonionic Detergents Induce Dimerization among Members of the Bcl-2 Family. J. Biol. Chem. 1997, 272, 13829–13834. [Google Scholar] [CrossRef] [Scilit]
- Huppert, J.L.; Balasubramanian, S. Prevalence of Quadruplexes in the Human Genome. Nucleic Acids Res. 2005, 33, 2908–2916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moerke, N.J. Fluorescence Polarization (FP) Assays for Monitoring Peptide-Protein or Nucleic Acid-Protein Binding. Curr. Protoc. Chem. Biol. 2009, 1, 1–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.; Li, L.; Yang, G.; Qu, F. Investigating the Influences of Random-Region Length on Aptamer Selection Efficiency Based on Capillary Electrophoresis-SELEX and High-Throughput Sequencing. Anal. Chem. 2021, 93, 17030–17035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liber, H.L.; Thilly, W.G. Mutation Assay at the Thymidine Kinase Locus in Diploid Human Lymphoblasts. Mutat. Res. 1982, 94, 467–485. [Google Scholar] [CrossRef] [Scilit]





| Round | # | Sequence | Cluster Size |
|---|---|---|---|
| 1 | GCAGGGGGGTGGGTGGGTGGATGGTACTGCGTGTTGTGGC | 110,644 | |
| 2 | GGGTGGGATTGGGGGACCGGTGTATTTGGGGGTAGGCTTG | 43,606 | |
| 3 | GCAGGGGGGTGGGTGGGTGGATGGTACTGCGTGTTGTGTG | 6043 | |
| 4 | CATTGTGGCGGGTAGGTTGGAGGGTGGTTGGGGCTTATGG | 3341 | |
| 6 | 5 | GCAGGGGGGTGGGTGGGTGGATGGTACTGCGTGTTGTGAC | 1168 |
| 6 | GCAGGGGGGTGGGCGGGTGGATGGTACTGCGTGTTGTGGC | 1115 | |
| 7 | GCAGGGGGGTGGGTGGGTGGATGGTACTGCGTGTTGTGCC | 1038 | |
| 8 | GCAGGGGGGTGGGTGGGTGGATGGTACTGCGTGTTGCGGC | 858 | |
| 9 | GCAGGGGGGTGGGTGGGTGGATGGTGCTGCGTGTTGTGGC | 829 | |
| 1 | CATTGTGGCGGGTAGGTTGGAGGGTGGTTGGGGCTTATGG | 165,995 | |
| 2 | GGGTGGGATTGGGGGACCGGTGTATTTGGGGGTAGGCTTG | 104,653 | |
| 3 | CACTGTGGCGGGTAGGTTGGAGGGTGGTTGGGGCTTATGG | 6984 | |
| 4 | CATTATGGCGGGTAGGTTGGAGGGTGGTTGGGGCTTATGG | 2200 | |
| 9 | 5 | GCAGGGGGGTGGGTGGGTGGATGGTACTGCGTGTTGTGGC | 1736 |
| 6 | CATTGTGGCGGGTAGGTTGGAGGGTGGCTGGGGCTTATGG | 1209 | |
| 7 | GGGTGGGATTGGGGGACCGGTGTATCTGGGGGTAGGCTTG | 1110 | |
| 8 | CATTGTGGCGGGTAGGTTGGAGGGTGGTTGGGGCTTGTGG | 737 | |
| 9 | CATTGTGGCGGGTAGGTTGGAGGGTGGTTGGGGCTTATTG | 465 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Meng, X.; Nemzow, L.; Han, Y.; Wen, K.; Amundson, S.A.; Turner, H.C.; Lin, Q. Microfluidic Isolation of Aptamers for Intracellular Measurement of Radio-Responsive Proteins. Radiation 2025, 5, 30. https://doi.org/10.3390/radiation5040030
Meng X, Nemzow L, Han Y, Wen K, Amundson SA, Turner HC, Lin Q. Microfluidic Isolation of Aptamers for Intracellular Measurement of Radio-Responsive Proteins. Radiation. 2025; 5(4):30. https://doi.org/10.3390/radiation5040030
Chicago/Turabian StyleMeng, Xin, Leah Nemzow, Yaru Han, Kechun Wen, Sally A. Amundson, Helen C. Turner, and Qiao Lin. 2025. "Microfluidic Isolation of Aptamers for Intracellular Measurement of Radio-Responsive Proteins" Radiation 5, no. 4: 30. https://doi.org/10.3390/radiation5040030
APA StyleMeng, X., Nemzow, L., Han, Y., Wen, K., Amundson, S. A., Turner, H. C., & Lin, Q. (2025). Microfluidic Isolation of Aptamers for Intracellular Measurement of Radio-Responsive Proteins. Radiation, 5(4), 30. https://doi.org/10.3390/radiation5040030

