Single Nucleotide Polymorphisms of FAM13A Gene in Chronic Obstructive Pulmonary Disease—A Case Control Study in Vietnam
Highlights
- Study and investigation of the association of single nucleotide polymorphisms (SNPs) in the FAM13A gene with COPD.
- Determination of the allele frequency and genotype phenotypes of rs2869967 and rs17014601 in the FAM13A gene in individuals with COPD, and investigation of the phenotypic association with COPD risk.
- Further studies should be conducted on nucleotide polymorphisms in the FAM13A gene to understand the relationship between SNP polymorphisms and respiratory function parameters, and to continue the progress towards constructing a predictive model for the severity of COPD with FAM13A gene SNP polymorphisms.
- Future directions include constructing a map of human gene polymorphisms in Vietnam, focusing on the study of genes impacting chronic obstructive pulmonary disease (COPD).
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Population
2.2. Research Content
2.3. Data Analysis
3. Results
3.1. Clinical Characteristics of the Study Population
3.2. Identification of rs2869967 and rs17014601 in the FAM13A Gene
3.3. Allele Frequencies of rs2869967 and rs17014601 in the FAM13A Gene
3.4. Genotypic Ratio of rs2869967 and rs17014601 in the FAM13A Gene
4. Discussion
4.1. Allele Frequencies of rs2869967 and rs17014601 in the FAM13A Gene
4.2. Genotypic Ratio of rs2869967 and rs17014601 in the FAM13A Gene and Its Association with COPD Risk
4.3. Implication and Further Work
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Schirnhofer, L.; Lamprecht, B.; Vollmer, W.M.; Allison, M.J.; Studnicka, M.; Jensen, R.L.; Buist, A.S. COPD Prevalence in Salzburg, Austria: Results from the Burden of Obstructive Lung Disease (BOLD) Study. Chest 2007, 131, 29–36. [Google Scholar] [CrossRef] [Scilit]
- Yawn, B.P.; Wollan, P.; Rank, M. Exacerbations in the pre- and post-COPD diagnosis periods. Pragmatic Obs. Res. 2013, 4, 1–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, M.H.; Boutaoui, N.; Klanderman, B.J.; Sylvia, J.S.; Ziniti, J.P.; Hersh, C.P.; DeMeo, D.L.; Hunninghake, G.M.; Litonjua, A.A.; Sparrow, D.; et al. Variants in FAM13A are associated with chronic obstructive pulmonary disease. Nat. Genet. 2010, 42, 200–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gilowska, I.; Majorczyk, E.; Kasper, L.; Bogacz, K.; Szczegielniak, J.; Kasper, M.; Kaczmarski, J.; Skomudek, A.; Czerwinski, M.; Sładek, K. The role of MMP-12 gene polymorphism-82 A-to-G (rs2276109) in immunopathology of COPD in polish patients: A case control study. BMC Med. Genet. 2019, 20, 19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, Y.; Lin, H.; Gao, K.; Xu, H.; Deng, X.; Zhang, Q.; Luo, Z.; Sun, S.; Deng, H. Genetic analysis of IREB2, FAM13A and XRCC5 variants in Chinese Han patients with chronic obstructive pulmonary disease. Biochem. Biophys. Res. Commun. 2011, 415, 284–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hao, W.; Li, M.; Zhang, Y.; Zhang, C.; Xue, Y. Expressions of MMP-12, TIMP-4, and Neutrophil Elastase in PBMCs and Exhaled Breath Condensate in Patients with COPD and Their Relationships with Disease Severity and Acute Exacerbations. J. Immunol. Res. 2019, 2019, 7142438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hawkins, G.A.; Mora, A.L. FAM13A, A Fatty Acid Oxidation Switch in Mitochondria. Friend or Foe in Chronic Obstructive Pulmonary Disease Pathogenesis? Am. J. Respir. Cell Mol. Biol. 2017, 56, 689–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, B.; Liang, B.; Yang, J.; Xiao, J.; Ma, C.; Xu, S.; Lei, J.; Xu, X.; Liao, Z.; Liu, H.; et al. Association of FAM13A polymorphisms with COPD and COPD-related phenotypes in Han Chinese. Clin. Biochem. 2013, 46, 1683–1688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Qiu, J.; Zhang, P.; Zhang, J.; Jiang, M.; Ma, Z. Genetic variants in FAM13A and IREB2 are associated with the susceptibility to COPD in a Chinese rural population: A case-control study. Int. J. Chronic Obstr. Pulm. Dis. 2018, 13, 1735–1745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hancock, D.B.; Eijgelsheim, M.; Wilk, J.B.; Gharib, S.A.; Loehr, L.R.; Marciante, K.D.; Franceschini, N.; van Durme, Y.M.T.A.; Chen, T.-H.; Barr, R.G.; et al. Meta-analyses of genome-wide association studies identify multiple loci associated with pulmonary function. Nat. Genet. 2009, 42, 45–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Z.; Knudsen, N.H.; Wang, G.; Qiu, W.; Naing, Z.Z.C.; Bai, Y.; Ai, X.; Lee, C.-H.; Zhou, X. Genetic Control of Fatty Acid β-Oxidation in Chronic Obstructive Pulmonary Disease. Am. J. Respir. Cell Mol. Biol. 2017, 56, 738–748. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shrine, N.; Guyatt, A.L.; Erzurumluoglu, A.M.; Jackson, V.E.; Hobbs, B.D.; Melbourne, C.A.; Batini, C.; Fawcett, K.A.; Song, K.; Sakornsakolpat, P.; et al. New genetic signals for lung function highlight pathways and chronic obstructive pulmonary disease associations across multiple ancestries. Nat. Genet. 2019, 51, 481–493, Erratum in Nat. Genet. 2019, 51, 1067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shrine, N.; Izquierdo, A.G.; Chen, J.; Packer, R.; Hall, R.J.; Guyatt, A.L.; Batini, C.; Thompson, R.J.; Pavuluri, C.; Malik, V.; et al. Multi-ancestry genome-wide association analyses improve resolution of genes and pathways influencing lung function and chronic obstructive pulmonary disease risk. Nat Genet. 2023, 55, 410–422. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ziółkowska-Suchanek, I.; Mosor, M.; Gabryel, P.; Grabicki, M.; Żurawek, M.; Fichna, M.; Strauss, E.; Batura-Gabryel, H.; Dyszkiewicz, W.; Nowak, J. Susceptibility loci in lung cancer and COPD: Association of IREB2 and FAM13A with pulmonary diseases. Sci. Rep. 2015, 5, srep13502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Trung, N.C.; Tri, N.V.; Vu, H.A. The Study of Matrix Metalloproteinase-12 (MMP-12) in COPD; University of Medicine and Pharmacy at HCMC: Ho Chi Minh City, Vietnam, 2021. [Google Scholar]
- Kraen, M.; Frantz, S.; Nihlén, U.; Engström, G.; Löfdahl, C.G.; Wollmer, P.; Dencker, M. Matrix Metalloproteinases in COPD and atherosclerosis with emphasis on the effects of smoking. PLoS ONE 2019, 14, e0211987. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vo-Pham-Minh, T.; Duong-Thi-Thanh, V.; Nguyen, T.; Phan-Tran-Xuan, Q.; Phan-Thi, H.; Bui-Anh, T.; Duong-Thien, P. The impact of Risk factors on Treatment outcomes of noso-comial pnermonia due to gram-negative bacteria in the Intensive Care Unit. Pulm. Ther. 2021, 7, 563–574. [Google Scholar] [CrossRef] [Scilit] [PubMed]



| Name of Primer | The Sequence of Nucleotides (3′–5′) | Length (bp) | PCR Size (bp) |
|---|---|---|---|
| FAM-967F | CCTACACTATATGAGTTGTG | 20 | 408 |
| FAM-966R | ATAGATATTCTCAGGCCTTG | 20 | |
| FAM-601F | GACCAAACCAAAAACCTAAG | 20 | 213 |
| FAM-601R | ACTCAGGCATTTTCCACATG | 20 |
| Groups | Disease Group (n = 80) | Control Group (n = 80) | p | |
|---|---|---|---|---|
| Characteristics | n (%) | n (%) | ||
| Gender | Male | 79 (98.8) | 78 (97.5) | 1.000 |
| Female | 1 (1.2) | 2 (2.5) | ||
| Education | Primary | 37 (46.3) | 19 (23.8) | 0.009 |
| Secondary | 21 (26.3) | 34 (42.5) | ||
| High school and tertiary | 22 (27.5) | 27 (33.8) | ||
| Characteristics | Disease Group (n = 80) | Control Group (n = 80) | Total (n = 160) | p * |
|---|---|---|---|---|
| Age (years) | 66.71 ± 7.93 | 65.96 ± 7.91 | 66.34 ± 7.90 | 0.525 |
| Height (cm) | 162.70 ± 6.24 | 161.91 ± 5.34 | 162.31 ± 5.81 | 0.167 |
| Weight (kg) | 58.91 ± 9.84 | 59.69 ± 9.52 | 59.30 ± 9.66 | 0.613 ** |
| BMI (kg/m2) | 22.27 ± 3.65 | 22.77 ± 3.49 | 22.52 ± 3.57 | 0.379 ** |
| Pulse (times/min) | 86.86 ± 11.12 | 85.73 ± 10.87 | 86.29 ± 10.98 | 0.475 |
| SYS (mmHg) | 138.23 ± 14.42 | 136.34 ± 11.56 | 137.28 ± 13.06 | 0.436 |
| DIA (mmHg) | 88.40 ± 9.41 | 88.18 ± 7.04 | 88.29 ± 8.29 | 0.843 |
| Allele | Disease Group | Control Group | p | |||
|---|---|---|---|---|---|---|
| n | % | n | % | |||
| FAM13A-rs2869967 | C | 81 | 50.6% | 76 | 47.5% | 0.576 |
| T | 79 | 49.4% | 84 | 52.5% | ||
| FAM13A-rs17014601 | C | 51 | 31.9% | 34 | 21.3% | 0.031 |
| T | 109 | 68.1% | 126 | 78.8% | ||
| FAM13A-rs2869967 | Disease Group | Control Group | p | OR (CI 95%) | |||
|---|---|---|---|---|---|---|---|
| n | % | n | % | ||||
| Genotypes | TT | 18 | 22.5% | 19 | 23.8% | 1 | 1 |
| CT | 43 | 53.8% | 46 | 57.5% | 0.973 | 0.987 (0.458–2.125) | |
| CC | 19 | 23.8% | 15 | 18.8% | 0.543 | 1.337 (0.525–3.405) | |
| Recessive Inheritance | CC | 19 | 23.8% | 15 | 18.8% | 0.440 | 1.350 (0.630–2.891) |
| TT + CT | 61 | 76.2% | 65 | 81.3% | 1 | ||
| Dominant Inheritance | TT | 18 | 22.5% | 19 | 23.8% | 0.851 | 0.932 (0.447–1.944) |
| CT + CC | 62 | 77.5% | 61 | 76.3% | 1 | ||
| FAM13A-rs17014601 | Disease Group | Control Group | p | OR (CI 95%) | |||
|---|---|---|---|---|---|---|---|
| n | % | n | % | ||||
| Genotypes | TT | 36 | 45.0% | 52 | 65.0% | 1 | 1 |
| CT | 37 | 46.3% | 22 | 27.5% | 0.010 | 2.429 (1.234–4.783) | |
| CC | 7 | 8.8% | 6 | 7.5% | 0.382 | 1.685 (0.523–5.431) | |
| Recessive Inheritance | CC | 7 | 8.8% | 6 | 7.5% | 0.773 | 1.183 (0.379–3.688) |
| TT + CT | 73 | 91.3% | 74 | 92.5% | 1 | ||
| Dominant Inheritance | TT | 36 | 45.0% | 52 | 65.0% | 0.012 | 0.441 (0.233–0.833) |
| CT + CC | 44 | 55.0% | 28 | 35.0% | 1 | ||
| Variables | B | S.E. | Wald | df | Sig. | Exp (B) | 95% CI |
|---|---|---|---|---|---|---|---|
| Gender | −0.783 | 1.282 | 0.373 | 1 | 0.541 | 0.457 | 0.037–5.64 |
| Age | 0.011 | 0.021 | 0.29 | 1 | 0.590 | 1.011 | 0.971–1.054 |
| BMI | −0.046 | 0.047 | 0.929 | 1 | 0.335 | 0.955 | 0.871–1.048 |
| rs2869967 | |||||||
| TT | 0.437 | 2 | 1 | ||||
| CT | 0.046 | 0.405 | 0.013 | 1 | 0.909 | 1.047 | 0.474–2.316 |
| CC | 0.297 | 0.496 | 0.358 | 1 | 0.550 | 1.345 | 0.509–3.557 |
| rs17014601 | |||||||
| TT | 7.02 | 2 | 1 | ||||
| CT | 0.911 | 0.349 | 6.796 | 1 | 0.009 | 2.486 | 1.254–4.931 |
| CC | 0.666 | 0.616 | 1.167 | 1 | 0.280 | 1.946 | 0.581–6.513 |
| Constant | 0.603 | 2.288 | 0.07 | 1 | 0.792 | 1.828 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pham, K.H.; Tran, N.T.C.; Tran, H.D.; Ngo, T.H.; Tran, V.D.; Ly, H.H.V.; Pham, N.T.N.; Nguyen, T.; Nguyen, B.H.; Nguyen, K.T. Single Nucleotide Polymorphisms of FAM13A Gene in Chronic Obstructive Pulmonary Disease—A Case Control Study in Vietnam. Adv. Respir. Med. 2023, 91, 268-277. https://doi.org/10.3390/arm91030021
Pham KH, Tran NTC, Tran HD, Ngo TH, Tran VD, Ly HHV, Pham NTN, Nguyen T, Nguyen BH, Nguyen KT. Single Nucleotide Polymorphisms of FAM13A Gene in Chronic Obstructive Pulmonary Disease—A Case Control Study in Vietnam. Advances in Respiratory Medicine. 2023; 91(3):268-277. https://doi.org/10.3390/arm91030021
Chicago/Turabian StylePham, Khanh Hoang, Nhung Thi Cam Tran, Hung Do Tran, Toan Hoang Ngo, Van De Tran, Hung Huynh Vinh Ly, Nga Thi Ngoc Pham, Thang Nguyen, Binh Huy Nguyen, and Kien Trung Nguyen. 2023. "Single Nucleotide Polymorphisms of FAM13A Gene in Chronic Obstructive Pulmonary Disease—A Case Control Study in Vietnam" Advances in Respiratory Medicine 91, no. 3: 268-277. https://doi.org/10.3390/arm91030021
APA StylePham, K. H., Tran, N. T. C., Tran, H. D., Ngo, T. H., Tran, V. D., Ly, H. H. V., Pham, N. T. N., Nguyen, T., Nguyen, B. H., & Nguyen, K. T. (2023). Single Nucleotide Polymorphisms of FAM13A Gene in Chronic Obstructive Pulmonary Disease—A Case Control Study in Vietnam. Advances in Respiratory Medicine, 91(3), 268-277. https://doi.org/10.3390/arm91030021

