Host Preferences and Impact of Climate on Blood Feeding in Anopheles funestus Group from South Africa
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design, Study Site, and Sample Collection
2.2. Species Identification of the Anopheles funestus Group
2.3. Plasmodium Falciparum Sporozoite ELISA
2.4. Blood Meal Identification
2.4.1. Sample Preparation
2.4.2. DNA Extraction from Blood-Fed Females
2.5. Climate Data Sets
2.6. Data Analysis
2.7. Ethical Clearance
3. Results
3.1. Species Composition and P. falciparum Infectivity Analysis
3.2. Host Preferences of Species of the An. funestus Group in Mamfene
3.3. Temporal Pattern and Change in Climatic Parameters
3.4. Influence of Climatic Parameters on Annual FPs of Species of the An. funestus Group, per Host Preference
3.4.1. Yearly Cattle Blood-Feeding Dynamics
3.4.2. Yearly Goat Blood-Feeding Dynamics
3.4.3. Influence of Climatic Parameters on Monthly Feeding Proportions in Archived and Newly Collected Data, per Anopheles Species, Irrespective of Host
- Anopheles parensis
- Anopheles vaneedeni
- Anopheles rivulorum
- Anopheles leesoni
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Brooke, B.; Koekemoer, L.; Kruger, P.; Urbach, J.; Misiani, E.; Coetzee, M. Malaria vector control in South Africa. S. Afr. Med. J. 2013, 103, 784–788. [Google Scholar] [CrossRef] [PubMed]
- Maharaj, R.; Seocharan, I.; Qwabe, B.; Mkhabela, M.; Kissoon, S.; Lakan, V. Decadal epidemiology of malaria in KwaZulu-Natal, a province in South Africa targeting elimination. Malar. J. 2019, 18, 368. [Google Scholar] [CrossRef] [PubMed]
- Raman, J.; Gast, L.; Balawanth, R.; Tessema, S.; Brooke, B.; Maharaj, R.; Munhenga, G.; Tshikae, P.; Lakan, V.; Mwamba, T.; et al. High levels of imported asymptomatic malaria but limited local transmission in KwaZulu-Natal, a South African malaria-endemic province nearing malaria elimination. Malar. J. 2020, 19, 152. [Google Scholar] [CrossRef] [PubMed]
- Coetzee, M.; Kruger, P.; Hunt, R.H.; Durrheim, D.N.; Urbach, J.; Hansford, C.F. Malaria in South Africa: 110 years of learning to control the disease. S. Afr. Med. J. 2013, 103, 770–778. [Google Scholar] [CrossRef]
- Moonasar, D.M.; Davies, C.; Balawanth, R.; Misiani, E.; Shandukani, M.B.; Raman, J.; Pillay, Y.G. Progress, challenges and priorities for malaria elimination in South Africa. Trans. R. Soc. S. Afr. 2021, 76, 105–116. [Google Scholar] [CrossRef]
- Dandalo, L.C.; Brooke, B.D.; Munhenga, G.; Lobb, L.N.; Zikhali, J.; Ngxongo, S.P.; Zikhali, P.M.; Msimang, S.; Wood, R.O.; Mofokeng, M.; et al. Population Dynamics and Plasmodium falciparum (Haemosporida: Plasmodiidae) Infectivity Rates for the Malaria Vector Anopheles arabiensis (Diptera: Culicidae) at Mamfene, KwaZulu-Natal, South Africa. J. Med. Entomol. 2017, 54, 1758–1766. [Google Scholar] [CrossRef]
- Burke, A.; Moss, Y.D.; Duncan, F.; Qwabe, B.; Coetzee, M.; Koekemoer, L.; Brooke, B. Anopheles parensis contributes to residual malaria transmission in South Africa. Malar. J. 2019, 18, 257. [Google Scholar] [CrossRef]
- Burke, A.; Dandalo, L.; Munhenga, G.; Dahan-Moss, Y.; Mbokazi, F.; Ngxongo, S.; Coetzee, M.; Koekemoer, L.; Brooke, B. A new malaria vector mosquito in South Africa. Sci. Rep. 2017, 7, 43779. [Google Scholar] [CrossRef]
- De Meillon, B.; Van Eeden, G.J.; Coetzee, L.; Coetzee, M. Meiswinkel RDTCLNHCF. Observations on a species of the Anopheles funestus subgroup, a suspected exophilic vector of malaria parasites in Northeastern Transvaal, South Africa. Mosq.-News 1977, 37, 657–664. [Google Scholar]
- Smith, A.; Hansford, C.F.; Thomson, J.F. Malaria along the southernmost fringe of its distribution in Africa: Epidemiology and control. Bull. World Health Organ. 1977, 55, 95–103. [Google Scholar]
- Temu, E.A.; Minjas, J.N.; Tuno, N.; Kawada, H.; Takagi, M. Identification of four members of the Anopheles funestus (Diptera: Culicidae) group and their role in Plasmodium falciparum transmission in Bagamoyo coastal Tanzania. Acta Trop. 2007, 102, 119–125. [Google Scholar] [CrossRef] [PubMed]
- Mapua, S.A.; Samb, B.; Nambunga, I.H.; Mkandawile, G.; Bwanaly, H.; Kaindoa, E.W.; Odero, J.O.; Masalu, J.P.; Kahamba, N.F.; Hape, E.E.; et al. Entomological survey of sibling species in the Anopheles funestus group in Tanzania confirms the role of Anopheles parensis as a secondary malaria vector. Parasit. Vectors 2024, 17, 261. [Google Scholar] [CrossRef] [PubMed]
- Gillies, M.T.; Meillon, D.B. The Anophelinae of Africa South of the Sahara; Publication of the South African Institute for Medical Research: Johannesburg, South Africa, 1968; p. 343. [Google Scholar]
- Kamau, L.; Munyekenye, G.O.; Koekemoer, L.L.; Hunt, R.H.; Coetzee, M. A Survey of the Anopheles funestus (Diptera:Culicidae) Group of Mosquitoes from 10 Sites in Kenya with Special Emphasis on Population Genetic Structure Based on Chromosomal Inversion Karyotypes. J. Med. Entomol. 2003, 40, 664–671. [Google Scholar] [CrossRef] [PubMed]
- Mouatcho, J.C.; Hargreaves, K.; Koekemoer, L.L.; Brooke, B.D.; Oliver, S.V.; Hunt, R.H.; Coetzee, M. Indoor collections of the Anopheles funestus group (Diptera: Culicidae) in sprayed houses in northern KwaZulu-Natal, South Africa. Malar. J. 2007, 6, 30. [Google Scholar] [CrossRef]
- Kent, R.J.; Norris, D.E. Identification of mammalian blood meals in mosquitoes by a multiplexed polymerase chain reaction targeting cytochrome B. Am. J. Trop. Med. Hyg. 2005, 73, 336–342. [Google Scholar] [CrossRef]
- Cahyadi, M.; Puruhita Barido, F.H.; Hertanto, B.S. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats. IOP Conf. Ser. Earth Environ. Sci. 2018, 102, 012038. [Google Scholar] [CrossRef]
- Wilkes, T.J.; Matola, Y.G.; Charlwood, J.D. Anopheles rivulorum, a vector of human malaria in Africa. Med. Vet. Entomol. 1996, 10, 108–110. [Google Scholar] [CrossRef]
- Koekemoer, L.L.; Rankoe, E.M.; La Grange, J.P.; Govere, J.; Coetzee, M. False detection of Plasmodium falciparum sporozoites in Anopheles marshallii group mosquitoes. J. Am. Mosq. Control Assoc. 2001, 17, 160–165. [Google Scholar]
- Kawada, H.; Dida, G.O.; Sonye, G.; Njenga, S.M.; Mwandawiro, C.; Minakawa, N. Reconsideration of Anopheles rivulorum as a vector of Plasmodium falciparum in western Kenya: Some evidence from biting time, blood preference, sporozoite positive rate, and pyrethroid resistance. Parasit. Vectors. 2012, 5, 230. [Google Scholar] [CrossRef]
- Kinya, F.; Mutero, C.M.; Sang, R.; Owino, E.A.; Rotich, G.; Ogola, E.O.; Wondji, C.S.; Torto, B.; Tchouassi, D.P. Outdoor malaria vector species profile in dryland ecosystems of Kenya. Sci. Rep. 2022, 12, 7131. [Google Scholar] [CrossRef]
- Abbas, H.A.; Bond, W.J.; Midgley, J.J. The worst drought in 50 years in a South African savannah: Limited impact on vegetation. Afr. J. Ecol. 2019, 57, 490–499. [Google Scholar] [CrossRef]
- Ndlovu, M.S.; Demlie, M. Assessment of meteorological drought and wet conditions using two drought indices across Kwazulu-Natal province, South Africa. Atmosphere 2020, 11, 623. [Google Scholar] [CrossRef]
- Vetter, S.; Goodall, V.L.; Alcock, R. Effect of drought on communal livestock farmers in KwaZulu-Natal, South Africa. Afr. J. Range Forage Sci. 2020, 37, 93–106. [Google Scholar] [CrossRef]
- Dia, I.; Guelbeogo, M.W.; Ayala, D. Advances and Perspectives in the Study of the Malaria Mosquito Anopheles funestus. In Anopheles Mosquitoes New Insights Into Malaria Vectors; Manguin, S., Ed.; InTech: Rijeka, Croatia, 2013. [Google Scholar] [CrossRef]
- Kim, Y.; Ratnam, J.V.; Doi, T.; Morioka, Y.; Behera, S.; Tsuzuki, A.; Minakawa, N.; Sweijd, N.; Kruger, P.; Maharaj, R.; et al. Malaria predictions based on seasonal climate forecasts in South Africa: A time series distributed lag nonlinear model. Sci. Rep. 2019, 9, 17882. [Google Scholar] [CrossRef]
- Landman, W.A.; Sweijd, N.; Masedi, N.; Minakawa, N. The development and prudent application of climate-based forecasts of seasonal malaria in the Limpopo province in South Africa. Environ. Dev. 2020, 35, 100522. [Google Scholar] [CrossRef]
- Raman, J.; Morris, N.; Frean, J.; Brooke, B.; Blumberg, L.; Kruger, P.; Mabusa, A.; Raswiswi, E.; Shandukani, B.; Misani, E.; et al. Reviewing South Africa’s malaria elimination strategy (2012–2018): Progress, challenges and priorities. Malar. J. 2016, 15, 438. [Google Scholar] [CrossRef]
- Ikeda, T.; Behera, S.K.; Morioka, Y.; Minakawa, N.; Hashizume, M.; Tsuzuki, A.; Maharaj, R.; Kruger, P. Seasonally lagged effects of climatic factors on malaria incidence in South Africa. Sci. Rep. 2017, 7, 2458. [Google Scholar] [CrossRef]
- Pavan Kumar, S.T.P.R.C.; Neelapu, N.R.R. Factors affecting malaria disease transmission and incidence: A special focus on Visakhapatnam district. Int. J. Recent. Sci. Res. 2014, 5, 312–317. [Google Scholar]
- Walton, W.E.; Reisen, W.K. Influence of climate change on mosquito development and blood-feeding patterns. In Viral Infections and Global Change; Wiley Online Library: Hoboken, NJ, USA, 2013; pp. 35–56. [Google Scholar]
- Shapiro, L.L.M.; Whitehead, S.A.; Thomas, M.B. Quantifying the effects of temperature on mosquito and parasite traits that determine the transmission potential of human malaria. PLoS Biol. 2017, 15, e2003489. [Google Scholar] [CrossRef]
- Klowden, M.J.; Briegel, H. Mosquito gonotrophic cycle and multiple feeding potential: Contrasts between Anopheles and Aedes (Diptera: Culicidae). J. Med. Entomol. 1994, 31, 618–622. [Google Scholar] [CrossRef]
- Afrane, Y.A.; Githeko, A.K.; Yan, G. The Ecology of Anopheles Mosquitoes under Climate Change: Case Studies from the Effects of Environmental Changes in East Africa Highlands. Ann. N. Y. Acad. Sci. 2012, 9, 1249. [Google Scholar]
- Craig, M.H.; Kleinschmidt, I.; Nawn, J.B.; Le Sueur, D.; Sharp, B.L. Exploring 30 years of malaria case data in KwaZulu-Natal, South Africa: Part I. The impact of climatic factors. Trop. Med. Int. Health 2004, 9, 1247–1257. [Google Scholar] [CrossRef] [PubMed]
- Yamana, T.K.; Eltahir, E.A.B. Incorporating the effects of humidity in a mechanistic model of Anopheles gambiae mosquito population dynamics in the Sahel region of Africa. Parasit. Vectors 2013, 6, 235. [Google Scholar] [CrossRef]
- Dahan-Moss, Y.; Sekgele, W.; Matamba, A.; Jamesboy, E.; Munhenga, G.; Riddin, M.; Shanahan, M.; Guarido, M.; Lobb, L.; Mazarire, T.; et al. Malaria Vector Surveillance Report, South Africa, January–December 2020. Spec. Public Health Surveill. Bull. 2021, 19, 1–14. [Google Scholar]
- Mbewe, R.B.; Keven, J.B.; Mangani, C.; Wilson, M.L.; Mzilahowa, T.; Mathanga, D.P.; Valim, C.; Laufer, M.K.; Walker, E.D.; Cohee, L.M. Genotyping of Anopheles mosquito blood meals reveals nonrandom human host selection: Implications for human-to-mosquito Plasmodium falciparum transmission. Malar. J. 2023, 22, 115. [Google Scholar] [CrossRef]
- Alves, G.; Troco, A.D.; Seixas, G.; Pabst, R.; Francisco, A.; Pedro, C.; Garcia, L.; Martins, J.F.; Lopes, S. Molecular and entomological surveillance of malaria vectors in urban and rural communities of Benguela Province, Angola. Parasit. Vectors 2024, 17, 112. [Google Scholar] [CrossRef]
- Coetzee, M. Key to the females of Afrotropical Anopheles mosquitoes (Diptera: Culicidae). Malar. J. 2020, 19, 70. [Google Scholar] [CrossRef]
- Gillies, M.T.; Coetzee, M. A Supplement to the Anophelinae of the South of the Sahara (Afrotropical Region); Publications of the South African Institute for Medical Research: Johannesburg, South Africa, 1987; p. 143. [Google Scholar]
- Koekemoer, L.L.; Kamau, L.; Hunt, R.H.; Coetzee, M. A cocktail polymerase chain reaction assay to identify members of the Anopheles funestus (Diptera: Culicidae) group. Am. J. Trop. Med. Hyg. 2002, 6, 804–811. [Google Scholar] [CrossRef]
- Wirtz, R.A.; Zavala, F.; Charoenvit, Y.; Campbell, G.H.; Burkot, T.R.; Schneider, I.; Esser, K.; Beaudoin, R.; Andre, R. Comparative testing of monoclonal antibodies against Plasmodium falciparum sporozoites for ELISA development. Bull. World Health Organ. 1987, 65, 39–45. [Google Scholar]
- Durnez, L.; Van Bortel, W.; Denis, L.; Roelants, P.; Veracx, A.; Trung, H.D.; Sochantha, T.; Coosemans, M. False positive circumsporozoite protein ELISA: A challenge for the estimation of the entomological inoculation rate of malaria and for vector incrimination. Malar. J. 2011, 10, 195. [Google Scholar] [CrossRef]
- Snounou, G.; Viriyakosol, S.; Zhu, X.P.; Jarra, W.; Pinheiro, L.; de Rosario, V.E.; Thaithong, S.; Brown, K. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol. Biochem. Parasitol. 1993, 61, 315–320. [Google Scholar] [CrossRef] [PubMed]
- Braack, L.; Bornman, R.; Kruger, T.; Dahan-Moss, Y.; Gilbert, A.; Kaiser, M.; Oliver, S.V.; Cornel, A.J.; Lee, Y.; Norris, D.E.; et al. Malaria vectors and vector surveillance in Limpopo province (South Africa): 1927 to 2018. Int. J. Environ. Res. Public Health 2020, 17, 4125. [Google Scholar] [CrossRef] [PubMed]
- Zengenene, M.; Soko, W.; Brooke, B.; Koekemoer, L.; Govere, J.; Mazarire, T.; Mberikunashe, J.; Munhenga, G. Anopheles Species Composition and Breeding Habitat Characterisation in Chiredzi District, Zimbabwe. Afr. Entomol. 2020, 28, 84–94. [Google Scholar] [CrossRef]
- Christian, R.; Dahan-Moss, Y.; Braack, L.; Munhenga, G.; Kaiser, M.; Lobb, L.; Wood, O.; Erlank, E.; Tshikae, P.; Burke, A.; et al. Malaria vector surveillance report, South Africa, January–December 2018. Public Health Surveill. Bull. 2018, 16, 29–35. [Google Scholar]
- Eshetu, T.; Eligo, N.; Massebo, F. Cattle feeding tendency of Anopheles mosquitoes and their infection rates in Aradum village, North Wollo, Ethiopia: An implication for animal-based malaria control strategies. Malar. J. 2023, 22, 81. [Google Scholar] [CrossRef]
- Mbewe, R.B.; Keven, J.B.; Mzilahowa, T.; Mathanga, D.; Wilson, M.; Cohee, L.; Laufer, M.K.; Walker, E.D. Blood-feeding patterns of Anopheles vectors of human malaria in Malawi: Implications for malaria transmission and effectiveness of LLIN interventions. Malar. J. 2022, 21, 67. [Google Scholar] [CrossRef]
- Jaleta, K.T.; Hill, S.R.; Birgersson, G.; Tekie, H.; Ignell, R. Chicken volatiles repel host-seeking malaria mosquitoes. Malar. J. 2016, 15, 354. [Google Scholar] [CrossRef]
- Drakou, K.; Nikolaou, T.; Vasquez, M.; Petric, D.; Michaelakis, A.; Kapranas, A.; Papatheodoulou, A.; Koliou, M. The effect of weather variables on mosquito activity: A snapshot of the main point of entry of Cyprus. Int. J. Environ. Res. Public Health 2020, 17, 1403. [Google Scholar] [CrossRef]
- Lee, S.H.; Nam, K.W.; Jeong, J.Y.; Yoo, S.J.; Koh, Y.-S.; Lee, S.; Heo, S.T.; Seong, S.-Y.; Lee, K.H. The Effects of Climate Change and Globalization on Mosquito Vectors: Evidence from Jeju Island, South Korea on the Potential for Asian Tiger Mosquito (Aedes albopictus) Influxes and Survival from Vietnam Rather Than Japan. PLoS ONE 2013, 8, e68512. [Google Scholar] [CrossRef]
- Lyons, C.L.; Coetzee, M.; Terblanche, J.S.; Chown, S.L. Thermal limits of wild and laboratory strains of two African malaria vector species, Anopheles arabiensis and Anopheles funestus. Malar. J. 2012, 11, 226. [Google Scholar] [CrossRef]
Blood Source | Primer Name | Oligonucleotide Sequence (5′-3′) | Target Gene | Tm (°C) | Amplicon Size (bp) |
---|---|---|---|---|---|
Human | Human741F | GGCTTACTTCTCTTCATTCTCTCCT | cyt b16 | 64.2 | 334 |
Dog | Dog368F | GGAATTGTACTATTATTCGCAACCAT | cyt b16 | 61.6 | 680 |
Cow | Cow121F | CATCGGCACAAATTTAGTCG | cyt b16 | 56.4 | 561 |
Goat | Goat894F | CCTAATCTTAGTACTTGTACCCTTCCTC | cyt b16 | 67.2 | 132 |
Pig | Pig573F | CCTCGCAGCCGTACATCTC | cyt b16 | 61.7 | 453 |
UNREV1025 | GGTTGTCCTCCAATTCATGTTA | cyt b16 | 59.4 | - | |
UNFOR | ACCGCGGTCATACGATTAAC | 12S rRNA17 | - | ||
Cow | SP_R | AGTGCGTCGGCTATTGTAGG | 12S rRNA17 | 155 | |
Pig | BB_R | GAATTGGCAAGGGTTGGTAA | 12S rRNA17 | 357 | |
Chicken | A_R | CGGTATGTACGTGCCTCAGA | 12S rRNA17 | 611 |
Species | Archived Collection (January 2015–December 2016) | New Collection (May 2017–April 2019) | Total |
---|---|---|---|
An. leesoni | 41 | 24 | 65 |
An. parensis | 64 | 360 | 424 |
An. rivulorum | 39 | 98 | 137 |
An. vaneedeni | 44 | 89 | 133 |
Total | 188 | 571 | 759 |
Abdominal Status, n | Blood Meal (BM) PCR, n (%) | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Species | Non-Fed | Blood-Fed | Gravid | Half-Gravid | Total | Dog | Cow | Goat | Pig | Mixed | BM Identified (%) | BM Not Identified (%) | Total |
An. leesoni | 21 | 24 | 16 | 4 | 65 | 0 (0) | 20 (90.9) | 2 (9.1) | 0 (0) | 0 (0) | 22 (91.7) | 2 (8.3) | 24 |
An. parensis | 161 | 135 | 90 | 38 | 424 | 1 (0.8) | 93 (77.5) | 14 (11.7) | 2 (1.7) | 10 (8.3) | 120 (88.9) | 15 (11.1) | 135 |
An. rivulorum | 60 | 43 | 25 | 9 | 137 | 0 (0) | 32 (86.5) | 2 (5.4) | 1 (2.7) | 2 (5.4) | 37 (86.0) | 6 (14.0) | 43 |
An. vaneedeni | 46 | 47 | 31 | 9 | 133 | 0 (0) | 33 (84.6) | 5 (12.8) | 0 (0) | 1 (2.6) | 39 (83.0) | 8 (17.0) | 47 |
Total | 288 | 249 | 162 | 60 | 759 | 1 (0.5) | 178 (81.7) | 23 (10.6) | 3 (1.4) | 13 (6.0) | 218 (87.6) | 31 (12.4) | 249 |
Host | Year | An. Leesoni | An. Parensis | An. Rivulorum | An. Vaneedeni | Annual Mean Temperature (°C) | Annual Mean Relative Humidity (%) | Annual Total Rainfall (mm) |
---|---|---|---|---|---|---|---|---|
Cattle | Year 1–2015 | 11/13 (85%) | 8/11 (73%) | 2/3 (67%) | 9/9 (100%) | 24.5 | 68.4 | 343.4 |
Year 2–2016 | 0 | 2/3 (67%) | 3/3 (100%) | 2/2 (100%) | 24.3 | 69.2 | 386.6 | |
Year 3–May 2017–April 2018 | 5/5 (100%) | 52/58 (90%) | 15/16 (94%) | 5/6 (83%) | 23.1 | 70.7 | 792.8 | |
Year 4–May 2018–April 2019 | 4/4 (100%) | 40/58 (69%) | 14/17 (82%) | 18/23 (78%) | 23.0 | 72.4 | 534.8 | |
Goat | Year 1–2015 | 2/13 (15%) | 3/11 (27%) | 1/3 (33%) | 0 | 24.5 | 68.4 | 343.4 |
Year 2–2016 | 0 | 1/3 (33%) | 0 | 0 | 24.3 | 69.2 | 386.6 | |
Year 3 May 2017–April 2018 | 0 | 5/58 (9%) | 0 | 1/6 (17%) | 23.1 | 70.7 | 792.8 | |
Year 4 May 2018–April 2019 | 0 | 14/58 (24%) | 2/17 (12%) | 4/23 (17%) | 23.0 | 72.4 | 534.8 | |
Dog | Year 1–2015 | 0 | 0 | 0 | 0 | 24.5 | 68.4 | 343.4 |
Year 2–2016 | 0 | 0 | 0 | 0 | 24.3 | 69.2 | 386.6 | |
Year 3 May 2017–April 2018 | 0 | 1/58 (2%) | 0 | 0 | 23.1 | 70.7 | 792.8 | |
Year 4 May 2018–April 2019 | 0 | 1/58 (2%) | 0 | 0 | 23.0 | 72.4 | 534.8 | |
Pig | Year 1–2015 | 0 | 0 | 0 | 0 | 24.5 | 68.4 | 343.4 |
Year 2–2016 | 0 | 0 | 0 | 0 | 24.3 | 69.2 | 386.6 | |
Year 3 May 2017–April 2018 | 0 | 0 | 1/6 (6%) | 0 | 23.1 | 70.7 | 792.8 | |
Year 4 May 2018–April 2019 | 0 | 3/58 (5%) | 1/17 (6%) | 1/23 (4%) | 23.0 | 72.4 | 534.8 | |
Total | 22 | 130 | 39 | 40 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mwamba, T.M.; Dahan-Moss, Y.; Munhenga, G.; Maposa, I.; Koekemoer, L.L. Host Preferences and Impact of Climate on Blood Feeding in Anopheles funestus Group from South Africa. Trop. Med. Infect. Dis. 2024, 9, 251. https://doi.org/10.3390/tropicalmed9100251
Mwamba TM, Dahan-Moss Y, Munhenga G, Maposa I, Koekemoer LL. Host Preferences and Impact of Climate on Blood Feeding in Anopheles funestus Group from South Africa. Tropical Medicine and Infectious Disease. 2024; 9(10):251. https://doi.org/10.3390/tropicalmed9100251
Chicago/Turabian StyleMwamba, Tshiama Miriam, Yael Dahan-Moss, Givemore Munhenga, Innocent Maposa, and Lizette Leonie Koekemoer. 2024. "Host Preferences and Impact of Climate on Blood Feeding in Anopheles funestus Group from South Africa" Tropical Medicine and Infectious Disease 9, no. 10: 251. https://doi.org/10.3390/tropicalmed9100251
APA StyleMwamba, T. M., Dahan-Moss, Y., Munhenga, G., Maposa, I., & Koekemoer, L. L. (2024). Host Preferences and Impact of Climate on Blood Feeding in Anopheles funestus Group from South Africa. Tropical Medicine and Infectious Disease, 9(10), 251. https://doi.org/10.3390/tropicalmed9100251