Detection of the Xanthi Chryso-like Virus in New Geographical Area and a Novel Arthropod Carrier
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples Collection and Study Area
2.2. Nucleic Acid Extraction and qPCR
2.3. Conventional PCR and DNA Sequencing
2.4. Phylogenetic Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kim, J.M.; Jung, J.E.; Park, J.A.; Park, S.M.; Cha, B.J.; Kim, D.H. Biological function of a novel chrysovirus, CnV1-BS122, in the Korean Cryphonectria nitschkei BS122 strain. J. Biosci. Bioeng. 2013, 115, 1–3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bao, X.; Roossinck, M.J. Multiplexed interactions: Viruses of endophytic fungi. Adv. Virus Res. 2013, 86, 37–58. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghabrial, S.A.; Dunn, S.E.; Li, H.; Xie, J.; Baker, T.S. Viruses of Helminthosporium (Cochlioblus) victoriae. Adv. Virus Res. 2013, 86, 289–325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dawe, A.L.; Nuss, D.L. Hypovirus molecular biology: From Koch’s postulates to host self-recognition genes that restrict virus transmission. Adv. Virus Res. 2013, 86, 109–147. [Google Scholar] [CrossRef] [Scilit]
- Hillman, B.I.; Cai, G. The family narnaviridae: Simplest of RNA viruses. Adv. Virus Res. 2013, 86, 149–176. [Google Scholar] [CrossRef] [Scilit]
- Jamal, A.; Bignell, E.M.; Coutts, R. Complete nucleotide sequences of four dsRNAs associated with a new chrysovirus infecting Aspergillus fumigatus. Virus Res. 2010, 153, 64–70. [Google Scholar] [CrossRef] [Scilit]
- Urayama, S.; Fukuhara, T.; Moriyama, H.; Toh-E, A.; Kawamoto, S. Heterologous expression of a gene of Magnaporthe oryzae chrysovirus 1 strain A disrupts growth of the human pathogenic fungus Cryptococcus neoformans. Microbiol. Immunol. 2014, 58, 294–302. [Google Scholar] [CrossRef] [Scilit]
- Urayama, S.; Sakoda, H.; Takai, R.; Katoh, Y.; Minh Le, T.; Fukuhara, T.; Arie, T.; Teraoka, T.; Moriyama, H. A dsRNA mycovirus, Magnaporthe oryzae chrysovirus 1-B, suppresses vegetative growth and development of the rice blast fungus. Virology 2014, 448, 265–273. [Google Scholar] [CrossRef] [Scilit]
- Moriyama, H.; Urayama, S.I.; Higashiura, T.; Le, T.M.; Komatsu, K. Chrysoviruses in Magnaporthe oryzae. Viruses 2018, 10, 697. [Google Scholar] [CrossRef] [Scilit]
- Van de Sande, W.W.; Lo-Ten-Foe, J.R.; van Belkum, A.; Netea, M.G.; Kullberg, B.J.; Vonk, A.G. Mycoviruses: Future therapeutic agents of invasive fungal infections in humans? Eur. J. Clin. Microbiol. Infect. Dis. 2010, 29, 755–763. [Google Scholar] [CrossRef] [Scilit]
- García-Pedrajas, M.D.; Cañizares, M.C.; Sarmiento-Villamil, J.L.; Jacquat, A.G.; Dambolena, J.S. Mycoviruses in Biological Control: From Basic Research to Field Implementation. Phytopathology 2019, 109, 1828–1839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- International Committee on Taxonomy of Viruses. Chrysoviridae. Available online: https://talk.ictvonline.org/ictv-reports/ictv_online_report/dsrna-viruses/w/chrysoviridae (accessed on 23 February 2022).
- Konstantinidis, K.; Dovrolis, N.; Kouvela, A.; Kassela, K.; Freitas, M.G.R.; Nearchou, A.; de Courcy, W.M.; Veletza, S.; Karakasiliotis, I. Defining virus-carrier networks that shape the composition of the mosquito core virome of a local ecosystem. Virus Evol. 2022, 8, veac036. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peyambari, M.; Warner, S.; Stoler, N.; Rainer, D.; Roossinck, M.J. A 1000-Year-Old RNA Virus. J. Virol. 2018, 93, e01188-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, K.; Stanojević, M.; Stamenković, G.; Ilić, B.; Paunović, M.; Lu, M.; Pešić, B.; Đurić Maslovara, I.; Siljic, M.; Cirkovic, V.; et al. Insight into diversity of bacteria belonging to the order Rickettsiales in 9 arthropods species collected in Serbia. Sci. Rep. 2019, 9, 18680. [Google Scholar] [CrossRef] [Scilit]
- Petrović, T.; Šekler, M.; Petrić, D.; Vidanović, D.; Potkonjak, A.; Hrnjaković Cvjetković, I.; Savić, S.; Debeljak, Z.; Lazić, G.; Ignjatović Ćupina, A.; et al. Flaviviruses at the territory of Serbia—Present situation and challenges. Arch. Vet. Med. 2019, 11, 53–70. [Google Scholar] [CrossRef] [Scilit]
- Gligic, A.; Stamatovic, I.; Stojanovic, R.; Obradovic, M.; Boskovic, R. The first isolation of the Crimean hemorraghic fever virus in Yugoslavia. Vojn. Pregl. 1977, 34, 318–321. [Google Scholar]
- Popovic, N.; Miloševic, B.; Uroševic, A.; Poluga, J.; Lavadinovic, L.; Nedelijkovic, J.; Jevtovic, D.; Dulovic, O. Outbreak of west nile virus infection among humans in Serbia, august to october 2012. Eur. Surveill. 2013, 18, 20613. [Google Scholar] [CrossRef] [Scilit]
- Stanojević, M.; Li, K.; Stamenković, G.; Ilić, B.; Paunović, M.; Pešić, B.; Maslovara, I.Đ.; Šiljić, M.; Ćirković, V.; Zhang, Y. Depicting the RNA Virome of Hematophagous Arthropods from Belgrade, Serbia. Viruses 2020, 12, 975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vázquez, A.; Sánchez-Seco, M.P.; Palacios, G.; Molero, F.; Reyes, N.; Ruiz, S.; Aranda, C.; Marqués, E.; Escosa, R.; Moreno, J.; et al. Novel flaviviruses detected in different species of mosquitoes in Spain. Vector Borne Zoonotic Dis. 2012, 12, 223–229. [Google Scholar] [CrossRef] [Scilit]
- Veith, M.; Kosuch, J.; Vences, M. Climatic oscillations triggered post-Messinian speciation of Western Palearctic brown frogs (Amphibia, Ranidae). Mol. Phylogenet. Evol. 2003, 26, 310–327. [Google Scholar] [CrossRef] [Scilit]
- Martin, D.P.; Murrell, B.; Golden, M.; Khoosal, A.; Muhire, B. RDP4: Detection and analysis of recombination patterns in virus genomes. Virus Evol. 2015, 1, vev003. [Google Scholar] [CrossRef] [Scilit]
- Posada, D. jModelTest: Phylogenetic model averaging. Mol. Biol. Evol. 2008, 25, 1253–1256. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MRBAYES 3.2: Efficient Bayesian phylogenetic inference and model selection across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Scilit]
- Rambaut, A.; Drummond, A.J. Molecular evolution, phylogenetics and epidemiology. FigTree v1.3.1: Tree Figure Drawing Tool. 2009. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 15 April 2022).
- Habarugira, G.; Suen, W.W.; Hobson-Peters, J.; Hall, R.A.; Bielefeldt-Ohmann, H. West Nile Virus: An Update on Pathobiology, Epidemiology, Diagnostics, Control and “One Health” Implications. Pathogens 2020, 9, 589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, H.; Pang, R.; Cheng, T.; Xue, L.; Zeng, H.; Lei, T.; Chen, M.; Wu, S.; Ding, Y.; Zhang, J.; et al. Abundant and Diverse RNA Viruses in Insects Revealed by RNA-Seq Analysis: Ecological and Evolutionary Implications. mSystems 2020, 5, e00039-20. [Google Scholar] [CrossRef] [Scilit]
- Shi, M.; Lin, X.D.; Chen, X.; Tian, J.H.; Chen, L.J.; Li, K.; Wang, W.; Eden, J.S.; Shen, J.J.; Liu, L.; et al. The evolutionary history of vertebrate RNA viruses. Nature 2018, 556, 197–202. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernandes, C.; Mota, M.; Barros, L.; Dias, M.I.; Ferreira, I.C.F.R.; Piedade, A.P.; Casadevall, A.; Gonçalves, T. Pyomelanin Synthesis in Alternaria alternata Inhibits DHN-Melanin Synthesis and Decreases Cell Wall Chitin Content and Thickness. Front. Microbiol. 2021, 12, 691433. [Google Scholar] [CrossRef] [Scilit]
- Ejmal, M.A.; Holland, D.J.; MacDiarmid, R.M.; Pearson, M.N. A novel chrysovirus from a clinical isolate of Aspergillus thermomutatus affects sporulation. PLoS ONE 2018, 13, e0209443. [Google Scholar] [CrossRef] [Scilit]
- Atoni, E.; Wang, Y.; Karungu, S.; Waruhiu, C.; Zohaib, A.; Obanda, V.; Agwanda, B.; Mutua, M.; Xia, H.; Yuan, Z. Metagenomic virome analysis of culex mosquitoes from Kenya and China. Viruses 2018, 10, 30. [Google Scholar] [CrossRef] [Scilit]
- Harvey, E.; Rose, K.; Eden, J.S.; Lo, N.; Abeyasuriya, T.; Shi, M.; Doggett, S.L.; Holmes, E.C. Extensive diversity of RNA viruses in Australian ticks. J. Virol. 2019, 93, e01358-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.Z.; Chen, Y.M.; Wang, W.; Qin, X.C.; Holmes, E.C. Expanding the RNA Virosphere by Unbiased Metagenomics. Annu. Rev. Virol. 2019, 6, 119–139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suzuki, Y.; Baidaliuk, A.; Miesen, P.; Frangeul, L.; Crist, A.B.; Merkling, S.H.; Fontaine, A.; Lequime, S.; Moltini-Conclois, I.; Blanc, H.; et al. Non-retroviral Endogenous Viral Element Limits Cognate Virus Replication in Aedes aegypti Ovaries. Curr. Biol. 2020, 30, 3495–3506.e6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gilbert, C.; Belliardo, C. The diversity of endogenous viral elements in insects. Curr. Opin. Insect Sci. 2022, 49, 48–55. [Google Scholar] [CrossRef] [Scilit]
- Shi, M.; Neville, P.; Nicholson, J.; Eden, J.S.; Imrie, A.; Holmes, E.C. High-Resolution Metatranscriptomics Reveals the Ecological Dynamics of Mosquito-Associated RNA Viruses in Western Australia. J. Virol. 2017, 91, e00680-17. [Google Scholar] [CrossRef] [Scilit] [PubMed]


| Target | Primer Name | Primer Sequence (5′-3′) | Annealing Temperature (°C) | Primer Position in Genome (nt)/Expected Product Length (bp) | Reference |
|---|---|---|---|---|---|
| 16S rRNA | 16 Sar | CGCCTGTTTATCAAAAACAT | 60 | 837-1416/579 | [21] |
| 16 SBR OiR | CCGGTCTGAACTCAGATCACGT | ||||
| WNV NS5 gene | 1NS5F | GCATCTAYAWCAYNATGGG | 50 | 9035-10146 | [20] |
| 1NS5R | CCANACNYNRTTCCANAC | ||||
| 2NS5F | GCNATNTGGTWYATGTGG | 50 | 9103-10122/1019 | ||
| 2NS5R | TRTCTTCNGTNGTCATCC | ||||
| XCLV | Xanthi_out_F | TGCGGTGTGACAT | 52 | 2108-2904 | Designed in this study * |
| Xanthi_out_R | AATATTACCAGCTT | ||||
| Xanthi_inn_F | TTACTTGTGCAGGTACT | 52 | 2141-2876/735 | ||
| Xanthi_inn_R | GGGCAGATCTAATTCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jankovic, M.; Cirkovic, V.; Stamenkovic, G.; Loncar, A.; Todorovic, M.; Stanojevic, M.; Siljic, M. Detection of the Xanthi Chryso-like Virus in New Geographical Area and a Novel Arthropod Carrier. Trop. Med. Infect. Dis. 2023, 8, 225. https://doi.org/10.3390/tropicalmed8040225
Jankovic M, Cirkovic V, Stamenkovic G, Loncar A, Todorovic M, Stanojevic M, Siljic M. Detection of the Xanthi Chryso-like Virus in New Geographical Area and a Novel Arthropod Carrier. Tropical Medicine and Infectious Disease. 2023; 8(4):225. https://doi.org/10.3390/tropicalmed8040225
Chicago/Turabian StyleJankovic, Marko, Valentina Cirkovic, Gorana Stamenkovic, Ana Loncar, Marija Todorovic, Maja Stanojevic, and Marina Siljic. 2023. "Detection of the Xanthi Chryso-like Virus in New Geographical Area and a Novel Arthropod Carrier" Tropical Medicine and Infectious Disease 8, no. 4: 225. https://doi.org/10.3390/tropicalmed8040225
APA StyleJankovic, M., Cirkovic, V., Stamenkovic, G., Loncar, A., Todorovic, M., Stanojevic, M., & Siljic, M. (2023). Detection of the Xanthi Chryso-like Virus in New Geographical Area and a Novel Arthropod Carrier. Tropical Medicine and Infectious Disease, 8(4), 225. https://doi.org/10.3390/tropicalmed8040225

