Barcoding Quantitative PCR Assay to Distinguish Between Aedes aegypti and Aedes sierrensis
Abstract
1. Introduction
2. Materials and Methods
2.1. Mosquito Collection
2.2. eDNA Sampling
2.3. eDNA Filtering
2.4. Alternative Prefilter Media: Coffee Filters
2.5. DNA Extraction
2.6. qPCR Barcoding Assay for Identifying Ae. sierrensis and Ae. aegypti
2.7. Species Identification, Sensitivity, and Specificity Using the AegySierr.ID-qPCR Assay
3. Results and Discussion
3.1. DNA Concentrations and Ct Values
3.2. eDNA Sample Species-Designation by Latent Class Analysis
3.3. AegySierr.ID-qPCR Assay Amplification Plots
3.4. Comparison of Prefiltration Materials for eDNA Recovery
3.5. eDNA Samples
3.6. Sensitivity and Specificity of the AegySierr.ID-qPCR Assay
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Correction Statement
References
- Lwande, O.W.; Obanda, V.; Lindström, A.; Ahlm, C.; Evander, M.; Näslund, J.; Bucht, G. Globe-Trotting Aedes aegypti and Aedes albopictus: Risk Factors for Arbovirus Pandemics. Vector-Borne Zoonotic Dis. 2019, 20, 71–81. [Google Scholar] [CrossRef] [Scilit]
- Näslund, J.; Ahlm, C.; Islam, K.; Evander, M.; Bucht, G.; Lwande, O.W. Emerging Mosquito-Borne Viruses Linked to Aedes aegypti and Aedes albopictus: Global Status and Preventive Strategies. Vector-Borne Zoonotic Dis. 2021, 21, 731–746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simmons, C.P.; Farrar, J.J.; van Vinh Chau, N.; Wills, B. Dengue. N. Engl. J. Med. 2012, 366, 1423–1432. [Google Scholar] [CrossRef] [Scilit]
- Vairo, F.; Haider, N.; Kock, R.; Ntoumi, F.; Ippolito, G.; Zumla, A. Chikungunya. Infect. Dis. Clin. N. Am. 2019, 33, 1003–1025. [Google Scholar] [CrossRef] [Scilit]
- Bertolotti, A.; Thioune, M.; Abel, S.; Belrose, G.; Calmont, I.; Césaire, R.; Cervantes, M.; Fagour, L.; Javelle, É.; Lebris, C.; et al. Prevalence of Chronic Chikungunya and Associated Risks Factors in the French West Indies (La Martinique): A Prospective Cohort Study. PLoS Neglected Trop. Dis. 2020, 14, e0007327. [Google Scholar] [CrossRef] [Scilit]
- Petersen, L.R.; Jamieson, D.J.; Powers, A.M.; Honein, M.A. Zika Virus. N. Engl. J. Med. 2016, 374, 1552–1563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roiz, D.A.; Pontifes, P.A.; Jourdain, F.; Diagne, C.; Leroy, B.; Anne-Charlotte Vaissière; María José Tolsá-García; Salles, J.-M.; Simard, F.; Courchamp, F. The Rising Global Economic Costs of Invasive Aedes Mosquitoes and Aedes-Borne Diseases. Sci. Total Environ. 2024, 933, 173054. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Getachew, D.; Tekie, H.; Gebre-Michael, T.; Balkew, M.; Mesfin, A. Breeding Sites of Aedes aegypti: Potential Dengue Vectors in Dire Dawa, East Ethiopia. Interdiscip. Perspect. Infect. Dis. 2015, 2015, 706276. [Google Scholar] [CrossRef] [Scilit]
- Forsyth, J.E.; Mutuku, F.M.; Kibe, L.; Mwashee, L.; Bongo, J.; Egemba, C.; Ardoin, N.M.; LaBeaud, A.D. Source Reduction with a Purpose: Mosquito Ecology and Community Perspectives Offer Insights for Improving Household Mosquito Management in Coastal Kenya. PLoS Neglected Trop. Dis. 2020, 14, e0008239. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kesavaraju, B.; Leisnham, P.T.; Keane, S.; Delisi, N.; Pozatti, R. Interspecific Competition between Aedes albopictus and A. Sierrensis: Potential for Competitive Displacement in the Western United States. PLoS ONE 2014, 9, e89698. [Google Scholar] [CrossRef] [Scilit]
- Sacks, N.B.; Chomel, B.B.; W. Kasten, R. Modeling the Distribution and Abundance of the Non-Native Parasite, Canine Heartworm, in California Coyotes. Oikos 2004, 105, 415–425. [Google Scholar] [CrossRef] [Scilit]
- Maciá, A.; Bradshaw, W.E. Seasonal Availability of Resources and Habitat Degradation for the Western Tree-Hole Mosquito, Aedes sierrensis. Oecologia 2000, 125, 55–65. [Google Scholar] [CrossRef] [Scilit]
- Lenhart, A.E.; Walle, M.; Cedillo, H.; Kroeger, A. Building a Better Ovitrap for Detecting Aedes aegypti Oviposition. Acta Trop. 2005, 96, 56–59. [Google Scholar] [CrossRef] [Scilit]
- Champion, S.R.; Vitek, C.J. Aedes aegypti and Aedes albopictus Habitat Preferences in South Texas, USA. Environ. Health Insights 2014, 8 (Suppl. S2), 35–42. [Google Scholar] [CrossRef] [Scilit]
- Washburn, J.O.; Anderson, J.R. Habitat Overflow, a Source of Larval Mortality for Aedes sierrensis (Diptera: Culicidae). J. Med. Entomol. 1993, 30, 802–804. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Organisation Mondiale De La Santé. Handbook for Integrated Vector Management; World Health Organization, Cop: Geneva, Switzerland, 2012. [Google Scholar]
- Baldacchino, F.; Caputo, B.; Chandre, F.; Drago, A.; della Torre, A.; Montarsi, F.; Rizzoli, A. Control methods against invasive Aedes mosquitoes in Europe: A review. Pest. Manag. Sci. 2015, 71, 1471–1485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chaves, L.F.; Reissen, N.; White, G.S.; Scott Gordon, S.; Faraji, A. Trap Comparison for Surveillance of the Western Tree Hole Mosquito, Aedes sierrensis (Diptera: Culicidae). J. Insect Sci. 2020, 20, 3. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beebe, N.W. DNA Barcoding Mosquitoes: Advice for Potential Prospectors. Parasitology 2018, 145, 622–633. [Google Scholar] [CrossRef] [Scilit]
- Park, J.; Kim, D.I.; Choi, B.; Kang, W.; Kwon, H.W. Classification and Morphological Analysis of Vector Mosquitoes Using Deep Convolutional Neural Networks. Sci. Rep. 2020, 10, 1012. [Google Scholar] [CrossRef] [Scilit]
- Faull, K.J.; Williams, C.R. Differentiation of Aedes aegypti and Aedes notoscriptus (Diptera: Culicidae) Eggs Using Scanning Electron Microscopy. Arthropod Struct. Dev. 2016, 45, 273–280. [Google Scholar] [CrossRef] [Scilit]
- Matsuo, K.; Yoshida, Y.; Lien, J.C. Scanning Electron Microscopy of Mosquitoes: II. The Egg Surface Structure of 13 Species of Aedes from Taiwan. J. Med. Entomol. 1974, 11, 179–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- de Morais, L.M.O.; Jussiani, E.I.; Zequi, J.A.C.; dos Reis, P.J.; Andrello, A.C. Morphological Study of Aedes aegypti and Aedes albopictus (Diptera: Culicidae) Eggs by X-Ray Computed Microtomography. Micron 2019, 126, 102734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rafferty, C.; Raise, G.; Scaife, J.; Abongo, B.; Omondi, S.; Milanoi, S.; Muchoki, M.M.; Onyango, B.; Ochomo, E.; Zohdy, S. Loop-Mediated Isothermal Amplification Assay to Detect Invasive Malaria Vector Anopheles stephensi Mosquitoes. Emerg. Infect. Dis. 2024, 30, 1779–1789. [Google Scholar] [CrossRef] [Scilit]
- Brault, A.C.; Fang, Y.; Reisen, W.K. Multiplex qRT-PCR for the Detection of Western Equine Encephalomyelitis, St. Louis Encephalitis, and West Nile Viral RNA in Mosquito Pools (Diptera: Culicidae). J. Med. Entomol. 2015, 52, 491–499. [Google Scholar] [CrossRef] [Scilit]
- Chan, A.; Chiang, L.-P.; Hapuarachchi, H.C.; Tan, C.-H.; Pang, S.-C.; Lee, R.; Lee, K.-S.; Ng, L.-C.; Lam-Phua, S.-G. DNA Barcoding: Complementing Morphological Identification of Mosquito Species in Singapore. Parasites Vectors 2014, 7, 569. [Google Scholar] [CrossRef]
- Kumar, N.P.; Rajavel, A.R.; Natarajan, R.; Jambulingam, P. DNA Barcodes Can Distinguish Species of Indian Mosquitoes (Diptera: Culicidae). J. Med. Entomol. 2007, 44, 1–7. [Google Scholar] [CrossRef]
- Hebert, P.D.N.; Ratnasingham, S.; de Waard, J.R. Barcoding Animal Life: Cytochrome c Oxidase Subunit 1 Divergences among Closely Related Species. Proceedings of the Royal Society of London. Ser. B Biol. Sci. 2003, 270 (Suppl. S1), S96–S99. [Google Scholar] [CrossRef] [Scilit]
- Adeniran, A.A.; Hernández-Triana, L.M.; Ortega-Morales, A.I.; Garza-Hernández, J.A.; de la Cruz-Ramos, J.; Chan-Chable, R.J.; Vázquez-Marroquín, R.; Huerta-Jiménez, H.; Nikolova, N.I.; Fooks, A.R.; et al. Identification of Mosquitoes (Diptera: Culicidae) from Mexico State, Mexico Using Morphology and COI DNA Barcoding. Acta Trop. 2021, 213, 105730. [Google Scholar] [CrossRef] [Scilit]
- Schneider, J.; Valentini, A.; Dejean, T.; Montarsi, F.; Taberlet, P.; Glaizot, O.; Fumagalli, L. Detection of Invasive Mosquito Vectors Using Environmental DNA (EDNA) from Water Samples. PLoS ONE 2016, 11, e0162493. [Google Scholar] [CrossRef] [Scilit]
- Kristan, M.; Acford-Palmer, H.; Campos, M.; Collins, E.; Phelan, J.E.; Portwood, N.M.; Pelloquin, B.; Clarke, S.; Lines, J.; Clark, T.G.; et al. Towards Environmental Detection, Quantification, and Molecular Characterization of Anopheles stephensi and Aedes aegypti from Experimental Larval Breeding Sites. Sci. Rep. 2023, 13, 2729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meyer, R.P.; Durso, S.L. Identification of the Mosquitoes of California; MVC Association of California: Sacramento, CA, USA, 1993. [Google Scholar]
- Alemayehu, D.; Reyes, T.; Haas-Stapleton, E.J. Field Evaluation of a Redesigned Oviposition Trap to Monitor Gravid Invasive Aedes Mosquitoes in a Suburban Environment. J. Am. Mosq. Control Assoc. 2018, 34, 67–69. [Google Scholar] [CrossRef] [Scilit]
- Takasaki, K.; Aihara, H.; Imanaka, T.; Matsudaira, T.; Tsukahara, K.; Usui, A.; Osaki, S.; Doi, H. Correction: Water Pre-Filtration Methods to Improve Environmental DNA Detection by Real-Time PCR and Metabarcoding. PLoS ONE 2021, 16, e0258073. [Google Scholar] [CrossRef] [Scilit]
- Spens, J.; Evans, A.R.; Halfmaerten, D.; Knudsen, S.W.; Sengupta, M.E.; Mak, S.S.T.; Sigsgaard, E.E.; Hellström, M. Comparison of Capture and Storage Methods for Aqueous Macrobial EDNA Using an Optimized Extraction Protocol: Advantage of Enclosed Filter. Methods Ecol. Evol. 2016, 8, 635–645. [Google Scholar] [CrossRef] [Scilit]
- Raden Reza Rizkiansyah; Yati Mardiyati; Arief Hariyanto; Steven, S.; Dirgantara, T. Non-Wood Paper from Coffee Pulp Waste: How Its Performance as Coffee Filter. Clean. Mater. 2024, 12, 100241. [Google Scholar] [CrossRef] [Scilit]
- Michisaki, R.P. Environmental DNA (eDNA) Extraction Using Qiagen DNeasy Blood and Tissue Kit. protocols.io. Available online: https://www.protocols.io/view/environmental-dna-edna-extraction-using-qiagen-dne-81wgbo7olpko/v2 (accessed on 5 October 2023).
- EMBL-EBI. MUSCLE < Multiple Sequence Alignment < EMBL-EBI. Ebi.ac.uk. Available online: https://www.ebi.ac.uk/Tools/msa/muscle/ (accessed on 18 July 2025).
- Parikh, R.; Mathai, A.; Parikh, S.; Chandra Sekhar, G.; Thomas, R. Understanding and Using Sensitivity, Specificity and Predictive Values. Indian J. Ophthalmol. 2008, 56, 45. [Google Scholar] [CrossRef] [Scilit]
- Newcombe, R.G. Two-Sided Confidence Intervals for the Single Proportion: Comparison of Seven Methods. Stat. Med. 1998, 17, 857–872. [Google Scholar] [CrossRef] [Scilit]
- Paradis, M.-È.; Haine, D.; Gillespie, B.W.; Oliver, S.; Messier, S.; Comeau, J.P.; Scholl, D.T. Bayesian Estimation of the Diagnostic Accuracy of a Multiplex Real-Time PCR Assay and Bacteriological Culture for 4 Common Bovine Intramammary Pathogens. J. Dairy Sci. 2012, 95, 6436–6448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Linzer, D.A.; Lewis, J.B. PoLCA: AnRPackage for Polytomous Variable Latent Class Analysis. J. Stat. Softw. 2011, 42, 1–29. [Google Scholar] [CrossRef] [Scilit]
- Altman, D.G. Statistics with Confidence: Confidence Intervals and Statistical Guidelines; BMJ Books: London, UK, 2011. [Google Scholar]
- Caraguel, C.G.B.; Stryhn, H.; Gagné, N.; Dohoo, I.R.; Hammell, K.L. Selection of a Cutoff Value for Real-Time Polymerase Chain Reaction Results to Fit a Diagnostic Purpose: Analytical and Epidemiologic Approaches. J. Vet. Diagn. Investig. 2011, 23, 2–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bohart, R.M.; Washino, R.K. Mosquitoes of California; University of California, Agriculture and Natural Resources: Davis, CA, USA, 1978. [Google Scholar]
- Zahouli, J.B.Z.; Utzinger, J.; Adja, M.A.; Müller, P.; Malone, D.; Tano, Y.; Koudou, B.G. Oviposition Ecology and Species Composition of Aedes spp. A\and Aedes aegypti Dynamics in Variously Urbanized Settings in Arbovirus Foci in Southeastern Côte D’Ivoire. Parasites Vectors 2016, 9, 523. [Google Scholar] [CrossRef] [Scilit]
- NCBI. BLAST: Basic Local Alignment Search Tool. Nih.gov. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 5 October 2023).
- Dieffenbach, C.W.; Lowe, T.M.; Dveksler, G.S. General Concepts for PCR Primer Design. Genome Res. 1993, 3, S30–S37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raso, A.; Mascelli, S.; Nozza, P.; Ugolotti, E.; Vanni, I.; Capra, V.; Biassoni, R. Troubleshooting Fine-Tuning Procedures for QPCR System Design. J. Clin. Lab. Anal. 2011, 25, 389–394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stein, E.D.; White, B.P.; Mazor, R.D.; Miller, P.E.; Pilgrim, E.M. Evaluating Ethanol-Based Sample Preservation to Facilitate Use of DNA Barcoding in Routine Freshwater Biomonitoring Programs Using Benthic Macroinvertebrates. PLoS ONE 2013, 8, e51273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gunay, M.; Balasubramaniyan, R. Robust CTPrediction Algorithm for RTPCR. Filomat 2016, 30, 1103–1110. [Google Scholar] [CrossRef] [Scilit]
- Tsang, W.Y.; Lemire, B.D. Mitochondrial Genome Content Is Regulated during Nematode Development. Biochem. Biophys. Res. Commun. 2002, 291, 8–16. [Google Scholar] [CrossRef] [Scilit]
- Menezes, A.; Owens, B.; Rouw, S.; Rose, S. Real-Time QPCR Guide: Part 3-Troubleshooting First Edition. Available online: https://go.idtdna.com/rs/400-UEU-432/images/IDT_Real%20Time%20qPCR%20guide_Part%203-Troubleshooting.pdf?aliId=eyJpIjoiQzRHbkNza2ZHQ3BDR1ZcL1EiLCJ0IjoiU1BwczZpckx0T3FaZzVWSVlUMXA3UT09In0%253D) (accessed on 26 June 2025).
- de la Cruz-Ramosa, J.; Hernández-Trianac, L.; García-De la Peñad, C.; González-Álvareze, V.; Weger-Lucarellif, J.; Siller-Rodríguezd, Q.; Rámosa, F.; Rodríguezg, D.; Ortega-Moralesa, A. Comparison of two DNA extraction methods from larvae, pupae, and adults of Aedes aegypti. Heliyon 2019, 5, e02660. [Google Scholar] [CrossRef] [Scilit]
- Joseph, C.; Faiq, M.E.; Li, Z.; Chen, G. Persistence and Degradation Dynamics of EDNA Affected by Environmental Factors in Aquatic Ecosystems. Hydrobiologia 2022, 849, 4119–4133. [Google Scholar] [CrossRef] [Scilit]
- Wittwer, C.; Sharif, C.; Schöck, I.; Klimpel, S. Mosquitoes on a Chip—Environmental DNA-Based Detection of Invasive Mosquito Species Using High-Throughput Real-Time PCR. PeerJ 2024, 12, e17782. [Google Scholar] [CrossRef] [Scilit]
- VectorSurv Development Team. VectorSurv—VectorborneVectorborne Disease Surveillance System 2025. Available online: https://vectorsurv.org/ (accessed on 25 July 2025).









| Life Stage | |||
|---|---|---|---|
| Field Ae. sierrensis | Colony Ae. aegy-MV | Colony Ae. sierr-C | |
| Egg | 0 | 119 | 114 |
| 4th Instar Larva | 132 | 31 | 24 |
| Adult | 47 | 72 | 40 |
| Name | Sequence (5′ → 3′) |
|---|---|
| Primers | |
| aegypti-F | TGATTAGCAACTTTACACGGAAC |
| aegypti-R | AGCTAATACTACTCCTGTTAAACCT |
| sierrensis-F | CCTCCTTCATTAACCCTACTACTTT |
| sierrensis-R | GATGATACTCCAGCTAAATGAAGAG |
| Probes | |
| aegypti-PRB | ABY-TCCAGCCCTTCTATGATCATTAGGATCTGT-IAbRQSp |
| sierrensis-PRB | FAM-TGGAGCTGG/ZEN/TACAGGATGAACTGT-IABkFQ |
| Life Stage | Egg | Larva | Adult | |||||
|---|---|---|---|---|---|---|---|---|
| Sample | Ae. sierr-C | Ae. aegy-MV | Ae. sierr-C | Field-Collected Ae. sierrensis | Ae. aegy-MV | Ae. sierr-C | Field-Collected Ae. sierrensis | Ae. aegy-MV |
| Proportion of False Positives (%) | 0.9% | 10.0% | 0.0% | 0.7% | 0.0% | 0.0% | 25.0% | 8.3% |
| Proportion of False Negatives (%) | 1.7% | 4.2% | 0.0% | 11.8% | 0.0% | 0.0% | 0.0% | 0.0% |
| Life Stage | Sample | Mean Ct | SD |
|---|---|---|---|
| Egg | Ae. sierr-C | 24.819 | 3.117 |
| Ae. aegy-MV | 24.533 | 2.314 | |
| Larva | Ae. sierr-C | 17.725 | 1.244 |
| Field-collected Ae. sierrensis | 17.576 | 4.940 | |
| Ae. aegy-MV | 19.713 | 1.594 | |
| Adult | Ae. sierr-C | 14.259 | 0.881 |
| Ae. sierr-C | 14.567 | 1.231 | |
| Ae. aegy-MV | 16.684 | 1.033 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Barretto, M.; Olson, A.; Alemayehu, D.; Clausnitzer, R.; Haas-Stapleton, E.J. Barcoding Quantitative PCR Assay to Distinguish Between Aedes aegypti and Aedes sierrensis. Trop. Med. Infect. Dis. 2025, 10, 230. https://doi.org/10.3390/tropicalmed10080230
Barretto M, Olson A, Alemayehu D, Clausnitzer R, Haas-Stapleton EJ. Barcoding Quantitative PCR Assay to Distinguish Between Aedes aegypti and Aedes sierrensis. Tropical Medicine and Infectious Disease. 2025; 10(8):230. https://doi.org/10.3390/tropicalmed10080230
Chicago/Turabian StyleBarretto, Miguel, Annika Olson, Dereje Alemayehu, Ryan Clausnitzer, and Eric J. Haas-Stapleton. 2025. "Barcoding Quantitative PCR Assay to Distinguish Between Aedes aegypti and Aedes sierrensis" Tropical Medicine and Infectious Disease 10, no. 8: 230. https://doi.org/10.3390/tropicalmed10080230
APA StyleBarretto, M., Olson, A., Alemayehu, D., Clausnitzer, R., & Haas-Stapleton, E. J. (2025). Barcoding Quantitative PCR Assay to Distinguish Between Aedes aegypti and Aedes sierrensis. Tropical Medicine and Infectious Disease, 10(8), 230. https://doi.org/10.3390/tropicalmed10080230

