Effects of Environmental Enrichment on the Growth, Gonadal Development, and Welfare of the Chinese Hooksnout Carp (Opsariichthys bidens)

Abstract

To investigate the effects of environmental enrichment on the growth and welfare level of the Chinese hooksnout carp (Opsariichthys bidens), an experiment was carried out for 56 d with four types of enrichment environments: low-density physical enrichment, high-density physical enrichment, low-density social enrichment, and high-density social enrichment. The experimental results revealed that both physical and social enrichment treatments positively affected the growth and gonadal development of O. bidens. The physical enrichment treatment was found to increase the antioxidants’ content, such as CAT, SOD, and GSH, in the liver of O. bidens. Moreover, this treatment was able to lead to a reduction in MDA content and enhancement of the fish’s antioxidant capabilities. Behavioral observations, cortisol level analysis, and pcna gene expression analysis indicated that the physical enrichment treatment redused the clustering, aggression, and stress behaviors of O. bidens, maintaining them in a low-stress state. In most respects, the high-density physical enrichment has more positive effects than the low-density one. In contrast, the social enrichment treatments resulted in higher stress levels for O. bidens.

1. Introduction

Animal welfare is categorized into three main aspects: vital functions, natural behaviors, and psychological feelings [1]. The welfare level of fish is particularly centered on the maintenance of health and the prevention of chronic stress [2]. Environmental enrichment, which involves introducing external elements such as plants, animals, and physical structures to enhance the complexity of the environment, plays a crucial role in optimizing the living conditions of captive animals, thereby improving their welfare, ensuring their physical and mental health, and boosting their physiological, behavioral, and commercial values [3,4]. The enrichment strategy comprises diverse types, such as physical and social enrichment, alongside sensory and dietary enrichment [5]. Nonetheless, this study specifically delves into physical and social enrichment levels. Physical enrichment mainly involves adjustments in breeding space and layout, including changes in the shape of breeding containers, increasing the complexity of environmental structures, etc. [6]. Frequently utilized enrichment materials include artificial plants and substrates typically found in streams. On the other hand, social enrichment mainly refers to the contact and interaction between farmed animals and animals with similar habits or other groups to change the survival pressure of farmed animals and the social structure of the entire farming environment [7]. A large number of studies have shown that environmental enrichment technology can reduce the survival pressure and environmental discomfort of farmed fish under breeding conditions [8], promote their growth development in the breeding environment [9], and effectively improve the quality of life of farmed fish [5].

Opsariichthys bidens (Cypriniformes, Cyprinidae, Opsariichthys) is an omnivorous but more often carnivorous freshwater fish with a fierce temperament that often feeds on small fish and shrimp in its natural environment [10]. O. bidens is widely distributed in China [11], with rapid growth, high yield, strong fertility, etc., typically reaching sexual maturity by a year [12]. This species inhabits the upper layers of water bodies, often forming clusters, and prefers shallow areas with relatively fast currents and sandy or gravelly substrates, particularly in brooks or river tributaries [13]. In this study, both pale chubs (Zacco platypus) and goldfish (Carassius auratus) used for social enrichment belong to the family Cyprinidae. Z. platypus belongs to the paraphyletic group with O. bidens, has many similarities in living habits, and often congregates [14]. C. auratus inhabits the bottom layers of water bodies, and is a freshwater omnivorous species that feeds on organic detritus, phytoplankton, zooplankton, and other organic matter [15].

O. bidens has edible and economic value and represents a component of the fishery resources in some montane rivers [13]. At present, the main culture methods of O. bidens are net-box culture in reservoirs and circulating-flow water culture in ponds the former is more large-scale and intensive than the latter, but it is easy to cause low welfare problems [16]. While current research on O. bidens has primarily focused on its biological characteristics [17], artificial breeding techniques [18], genetic diversity [19], resource conservation, and development and utilization [20], there is a notable absence of studies aimed at enhancing the welfare of O. bidens through environmental enrichment. Consequently, this study seeks to investigate the impact of physical and social enrichment on the growth and welfare of O. bidens. This investigation utilized antioxidant indicators, cortisol levels, behavioral indicators, and the expression levels of stress-related genes to evaluate the welfare of O. bidens.

2. Materials and Methods

2.1. Experimental Material

The experimental fish for this study were selected from a fish farm specializing in breeding freshwater fish in Zhejiang Province, China. The sample included 400 O. bidens (body mass: 6.36 ± 1.22 g), 80 Z. platypus (body mass: 6.17 ± 1.52 g), and 40 C. auratus (body mass: 7.99 ± 2.88 g). These fish appeared healthy and were juvenile, 4 months old. Before the experiment, the fish were temporarily reared for 7–10 d at a consistent water temperature of 18.45 ± 1.24 °C. The culture tank had a diameter of 0.8 m and a height of 1.2 m, containing 0.5 m³ of culture water. The light regime was 12 h, both light and dark, and daily water exchange is 50%.

2.2. Experimental Design

In this experiment, five groups were utilized: blank control (CK), low-density physical enrichment (LP), high-density physical enrichment (HP), low-density social enrichment (LS), and high-density social enrichment (HS) groups. The setup for the physically enriched groups involved placing plastic plates in the fish tank, following the density settings outlined in the study by Lee et al. [21] and Buenhombre et al. [22]. Specifically, the LP and HP groups (Figure 1A–C) featured plastic water weeds (occupying 10% and 30% of the tank’s bottom area, respectively) and pebbles (respectively covering 40% and 90% of the tank’s bottom area, including plastic water weeds), and each group had 30 O. bidens. Physical enrichment in the form of plastic plates, 740 mm in diameter, with small holes of 5 mm and 10 mm evenly distributed, was provided. Additionally, plastic water plants and pebbles ranging from 20–30 mm in diameter were used as physical enrichment materials during the experiment. The socially enriched groups (Figure 1D,E) included Z. platypus and C. auratus, with enrichment levels based on the completely randomized design (CRD) approach of Omondi et al. [23]. LS group contained 10 Z. platypus and 20 O. bidens, while the HS group housed 10 Z. platypus, 10 C. auratus, and 20 O. bidens. Each group consisted of three parallel groups, with the experiment lasting 56 d. Throughout the study, the water temperature remained at 17.55 ± 1.55 °C, ammonia nitrogen content at 0.30 ± 0.11 mg·L⁻¹, nitrite concentration at 0.036 ± 0.009 mg·L⁻¹, and dissolved oxygen content at 8.21 ± 0.25 mg·L⁻¹. The fish were fed twice daily at 09:00 and 19:00, with the feed amount set at 1% of the fish’s body weight per day. The dietary content of the feed was 40% crude protein, 5% crude fat, 15% crude ash, etc., provided by Zhejiang Yixiang Biotechnology Co., Ltd. (Huzhou, China).

2.3. Behavioral Observation

Infrared cameras were used to observe the behavior of O. bidens. in each group. Statistical analysis was conducted on clustering, aggression, and stress behavior at three specific time slots (8:00–9:00, 14:00–15:00, and 20:00–21:00) on 7 d, 28 d, and 49 d of experiment. The first 30 min were allocated for observing clustering and aggressive behavior, while the following 30 min were dedicated to monitoring stress behavior, according to Mork et al. [24]. The cross section of the culture tank was divided into four equidistant concentric circle regions. When the main part of the fish school crossed an adjacent area, we recorded the number of fish range movements, that is, a clustering behavior. Their intraspecific or interspecific chasing and nipping are regarded as aggressive behaviors. A set of LED light (P = 1 w) sources were above the culture tank and used the flash stimulation method [25], which means that after every 5 min of darkness treatment, the light source was turned on for 1 min, and the number of fish behaviors such as fright and jumping was counted and recorded as the number of stress behaviors.

2.4. Growth Index, Enzyme Activity, and Hormone Determination

At the end of the experimental cycle, six O. bidens were arbitrarily selected from each group and euthanized with buffered tricaine methanesulfonate (MS-222). The body length, body weight, liver weight, and viscera weight of each O. bidens were measured and recorded, and the indexes of fattening, liver-to-body ratio, and viscera-to-body ratio were calculated. Then brain, liver, and gonadal tissues were taken from O. bidens, which were stored frozen at −80 °C.

The catalase and superoxide dismutase activities and glutathione peroxidase and malondialdehyde contents of the liver tissues of O. bidens were determined using the assay kits from Nanjing Jiancheng Bioengineering Research Institute (Nanjing, China) according to the instructions. After the euthanasia, fish serum was immediately extracted from 9 female fish and 9 male fish in each group (comprising 3 female fish and 3 male fish from each replicate), and the fish cortisol kit (Nanjing Jiancheng Biological, Nanjing, China) and fish estradiol and fish testosterone enzyme immunoassay kit (Shanghai Enzyme Link Biotechnology Co., Ltd., Shanghai, China) were used to determine the serum levels of intracellular cortisol and the contents of estradiol (E2) and testosterone (T), respectively.

2.5. Tissue Section Observation

At the end of the experimental cycle, the 9 male and 9 female gonadal tissues in each group were collected, submerged in 4% paraformaldehyde tissue fixative, and left to fix for over 24 h. The tissue specimens were then dehydrated with 75–90% gradient alcohol and anhydrous ethanol, made transparent with xylene, embedded in paraffin and sliced, then dewaxed, H and E staining with hematoxylin and eosin, dehydrated sealing, and photographed under an compound microscope. According to Jun L.’s [26] gonad staging criteria for Cyprinidae fish, the stages were carried out.

2.6. Gene Expression Measurement

Adopted the Animal Total RNA Isolation Kit (Sangon Biotech Co., Ltd., Shanghai, China) to extract total RNA from brain, liver, and gonad tissue samples. The mass and concentration of total RNA were detected after using agarose gel electrophoresis and a spectrophotometer (NanoDrop Lite) and then reverse transcribed to cDNA. Fluorescent quantitative primers for igf, pcna, cyp19a1a, and dmrt1 genes were set according to the transcriptome data of laboratory O. bidens (

Table 1. List of fluorescent quantitative PCR primers.

Target Gene	Primer Sequence (5′–3′)
β-actin	F: TCCGTGACATCAAGGAGAAG	R: GGCAACGGAAACGCTCATT
igf	F: GTAGAGGGAAGGGTGAGATGGT	R: TGTAAAAGCCACGGTCTCCA
pcna	F: ACAAGGAGGATGAAGCGGTGAC	R: TGCTGAGCGTGACGGTCTTG
cyp19a1a	F: GTACACCTCACGCTTTGGGA	R: AGGTTGTGGAAGTGGTGCAA
dmrt1	F: CTCAGTACCGCACACACTCC	R: AGTTGCTCTCACACTCCAGC

), with β-actin as the internal reference gene, and each sample was repeated three times. Finally, the 2^−ΔΔCT method was used to quantitatively analyze the relative expression of target genes.

2.7. Calculation and Analysis of Relevant Data

The main calculation formulas are as follows:

CF = (W_W/L³) × 100%; HIS = W_L/W_W × 100%; VSI = W_V/W_W × 100%

$$\begin{gathered} \mathrm{SOD} \mathrm{activity} (\mathrm{U}/\mathrm{mgprot}) = {\displaystyle \frac{({\mathrm{A}}_{\mathrm{C}}-{\mathrm{A}}_{\mathrm{CB}})-({\mathrm{A}}_{\mathrm{M}}-{\mathrm{A}}_{\mathrm{MB}})}{({\mathrm{A}}_{\mathrm{C}}-{\mathrm{A}}_{\mathrm{CB}})}} \times 2 \times \mathrm{Dilution} \mathrm{ratio} \mathrm{of} \mathrm{reaction} \mathrm{system} \\ \mathrm{and} \mathrm{protein} \mathrm{concentration} \mathrm{of} \mathrm{the} \mathrm{sample} \mathrm{to} \mathrm{be} \mathrm{measured} (\mathrm{mgprot}/\mathrm{mL}) \end{gathered}$$

CAT activity (U/mgprot) = (A_C − A_M) × 271/V_S/T/Protein concentration of the sample to be measured (mgprot/mL)

$$\mathrm{GSH} \mathrm{content} (\mathrm{gGSH}/\mathrm{L})={\displaystyle \frac{({\mathrm{A}}_{\mathrm{M}}-{\mathrm{A}}_{\mathrm{B}})}{({\mathrm{A}}_{\mathrm{S}}-{\mathrm{A}}_{\mathrm{B}})}} \times {{\mathrm{C}}_{\mathrm{S}}}^1 \times \mathrm{Mr}(\mathrm{GSH}) \times 5$$

$$\mathrm{MDA} \mathrm{content} (\mathrm{nmol}/\mathrm{mgprot})={\displaystyle \frac{({\mathrm{A}}_{\mathrm{M}}-{\mathrm{A}}_{\mathrm{C}})}{({\mathrm{A}}_{\mathrm{S}}-{\mathrm{A}}_{\mathrm{B}})}} \times {{\mathrm{C}}_{\mathrm{S}}}^2/\mathrm{Protein} \mathrm{concentration} \mathrm{of} \mathrm{the} \mathrm{sample} \mathrm{to} \mathrm{be} \mathrm{measured} (\mathrm{mgprot}/\mathrm{mL})$$

where CF: condition factor, HSI: hepatosmatic index, VSI: viscerasomatic index, Ww: experimental final body weight per fish (g), L: experimental final body length per fish (cm). W_L: experimental final liver weight per fish, W_V: experimental final visceral weight per fish. A_C: charge absorbance value; A_CB: the absorbance value of the blank tube; A_M: measuring the absorbance value of the tube; A_MB: determined blank tube absorbance value; A_B: blank tube absorbance value; A_S: standard tube absorbance value; V_S: Sample size, 0.05 mL; T: reaction time, 60 s; C_S¹: 20 × 10⁻⁶ mol/L; Mr(GSH): GSH relative molecular weight, 307 g/mol; C_S²:10 nmol/mL.

The data obtained were processed by Excel and expressed as Mean ± LS, and analyzed by the single-factor ANOVA method and the S-N-K and Duncan test methods for statistical analysis. Statistical significance was set to p > 0.05, and the software used was IBM SPSS Statistics 27 (R26.0.0.0).

3. Results

3.1. Growth Indicators

As can be seen from

Table 2. Effect of environmental enrichment on growth indexes of O. bidens.

	Group	CK Group	LP Group	HP Group	LS Group	HS Group
Indicators
Body length (mm)		93.47 ± 2.91 a	96.46 ± 2.70 ab	108.91 ± 2.71 c	97.04 ± 2.51 ab	100.07 ± 2.67 b
Weight (g)		13.73 ± 1.98 a	17.38 ± 0.91 b	20.58 ± 2.53 c	15.38 ± 2.81 ab	18.47 ± 2.67 bc
CF (g/cm3)		1.67 ± 0.15 a	1.84 ± 0.12 a	1.58 ± 0.07 a	1.67 ± 0.19 a	1.83 ± 0.14 a
HSI (%)		2.04 ± 0.33 a	2.37 ± 0.05 a	2.21 ± 0.21 a	2.00 ± 0.46 a	2.00 ± 0.19 a
VSI (%)		11.31 ± 0.31 a	15.04 ± 2.57 b	18.45 ± 0.52 c	12.36 ± 0.04 a	11.89 ± 6.61 a

Note: Different lowercase letters indicate significant differences between different treatment groups (p < 0.05).

, the body length and weight of O. bidens in the environmental enrichment group surpassed those in the control group significantly (p < 0.05). Moreover, the high-enriched groups (HP and HS) exhibited substantial increases in body length and weight compared to the CK group (p < 0.05), and the LP group was significantly higher only in terms of weight (p < 0.05). We also found that the HP group was significantly higher on VSI than other groups (p < 0.05). Conversely, there were no notable variations in HSI and CF across the diverse treatment groups (p > 0.05).

3.2. Gonadal Development

Upon staining the gonadal tissue sections and analyzing the results (Figure 2), it was revealed that stage III and IV oocytes were prevalent in the CK group, while stage V cells were predominant in the HP group. LP, LS, and HS groups showed a co-dominance of both stage IV and V oocytes. Interestingly, the development of spermathecae within each group exhibited a similar pattern, with all groups observed to be in the stage IV spermathecae state, shown as Sg, St, and Sz in Figure 2.

3.3. Behavioral Response

Different degrees of decreasing trends in the three behavioral indicators of clustering, aggression, and stress behavior were observed in all groups, as depicted in Figure 3. The socially enriched group (LS and HS) of O. bidens, in the early stage of the experiment, exhibited a notably high level of stress behavior (Figure 3C). Also higher aggression and clustering for HS (Figure 3A,B) at the beginning. Else quite close to CK. The frequency of behaviors is always higher for HS than LS, even though not always significant. For HP and LP groups, same 3 behaviors as CK at the beginning, but lower frequency at the middle and late stages of the experiment (p < 0.05). The frequency of behaviors is mostly lower for HP than for LP, even though not always significant.

3.4. Antioxidant Index

The results of antioxidant capacity indices in each group are shown in Figure 4. The results showed that SOD activity in the high-enriched groups (HP and HS) was significantly higher than that in the low-enriched groups (LP and LS) (p < 0.05), and CK was the lowest. HP had the lowest MDA content, even though not significant with LP and HS, while CK was the highest. However, only HP was significantly higher in CAT and GSH (p < 0.05).

3.5. Hormone Level

The effects of environmental enrichment on the cortisol levels within the serum of O. bidens in each group with the estradiol content in females and the testosterone content in males are shown in Figure 5. Cortisol levels were significantly lower in the LP and HP groups than the rest of the groups (p < 0.05) and were significantly higher in the CK and the HS groups. Estradiol content in females in the HP group was significantly higher than that in the rest of the groups (p < 0.05), and the testosterone content in males in the various groups did not differ significantly (p > 0.05).

3.6. Expression of Genes

The effects of environmental enrichment on the gene expression of igf, pcna, cyp19ala, and dmrt1 in C. maritimus are shown in Figure 6. The expression of igf was higher in both HP and HS than in the CK group (p < 0.05) and was particularly high in HP (p < 0.01). The same trend applied to cyp19ala gene expression, while there was no significant difference in dmrt1 gene expression (p > 0.05). In terms of PCNA gene expression, only the LP and HP groups showed a significant decrease relative to the CK group (p < 0.05), and the degree of enrichment had little effect.

4. Discussions

Physical enrichment treatments were able to significantly promote the growth of the length and weight of O. bidens. In Batzina et al.’s [27] study on gilthead seabream (Sparus aurata), the researchers conducted different levels of physical enrichment using a variety of colors of substrates, and the results showed that there was a significant increase in growth and welfare of the farmed fish treated with enrichment. Similarly, Crank et al. [28] conducted an investigation on rainbow trout (Oncorhynchus mykiss) raised in a vertically suspended environmental enrichment structure. The study demonstrated noteworthy enhancements in length, weight, weight gain, and feed conversion rate among fish provided physical enrichment compared to the CK group. In the present study, the effective introduction of physical structures and plastic plants into aquatic environments used for fish farming can offer visual barriers and shelters, diminish natural aggressive behaviors and social stress among cultured fish, stimulate their appetite and digestive capacity, and consequently support overall growth [29]. In LS and HS, social enrichment treatment significantly promoted the growth and gonadal development of O. bidens. Social enrichment is an essential factor influencing the enrichment effect by enhancing social interactions and relationships among different fish, potentially contributing to improved growth performance [30]. The HSI and CF did not differ significantly (p > 0.05) among the groups; however, the VSI of O. bidens in LP and HP was significantly higher compared to the other groups (p < 0.05). Since the O. bidens were in the pre-breeding stage during the experimental period, the elevated VSI may be linked to gonadal development. Analysis of serum endogenous sex hormone levels and H and E staining results of gonadal sections indicated a significant promotion of gonadal development in females in the HP group, with other treatment groups also exhibiting faster development compared to the CK group. This reflects that environmental enrichment treatments, particularly physical ones, have a significant effect on the gonadal development of O. bidens. Previous research has illustrated the substantial influence of the igf gene on fish growth [31] and the cyp19ala and dmrt1 genes on fish gonadal development [32,33]. This study’s results showed no significant difference in dmrt1 gene expression among the groups (p > 0.05), but high-enriched groups (HP and HS, particularly HP) demonstrated significantly higher expression levels of igf and cyp19ala genes (p < 0.05). The upregulation of growth and reproduction genes related to environmental enrichment treatments in O. bidens further supports the conclusion that fish in enriched environments exhibit enhanced growth performance [7].

Aquatic organisms are known to be affected by environmental factors, leading to the excessive production of reactive oxygen species (ROS) in their bodies [34,35]. The accumulation of ROS negatively impacts the cellular structure and function of organisms, necessitating the activation of the antioxidant system for the alleviation of damage [36]. Antioxidant capacity is a crucial parameter for assessing the health of fish, with CAT and SOD representing essential antioxidant enzymes that regulate peroxide levels and shield organisms from oxidative stress [37]. Furthermore, GSH functions as a non-enzymatic antioxidant in fish, aiding in the neutralization of oxidative free radicals [38]. In cases where excess ROS react with lipids, the resultant MDA levels provide insight into the degree of lipid peroxidation and oxidative harm within fish cells or tissues [39]. In the present study, it was found that the SOD activity was significantly higher (p < 0.05) and MDA content was significantly lower (p < 0.05) in both physically and socially enriched groups of O. bidens than in the CK group, and CAT activity and GSH content were significantly higher (p < 0.05) in the HP group than in the rest of the groups. High-enriched groups (HP and HS) exhibited a greater impact on enhancing antioxidant performance and shielding O. bidens from oxidative stress, implying that enriched environments can enhance antioxidant enzyme activity in fish and bolster overall antioxidant capacity [40]. LS and HS groups showed significant enhancement in SOD activity only, while CAT activity and GSH content were not significantly different. Li et al. [41] found that the SOD and CAT vigor of cultured fish under mixed culture of Chinese mitten crab (Eriocheir sinensis) and Mandarin fish (Siniperca chuatsi) were not significantly enhanced compared with monoculture, and the reason was hypothesized to be related to the competition between the species, which was consistent with this study.

Stress level is an important indication of the welfare level of cultured fish [29], and cortisol hormone level is a reliable and direct indicator for assessing the stress level of fish [42]. Usually, high levels of cortisol hormone indicate that cultured fish are in a high-stress state and are uncomfortable with the environment, thus inferring that the welfare level of cultured fish is low [43]. The pcna gene is related to the proliferation of distal brain neuronal cells [44], and it has been demonstrated that external environmental stimuli can cause a stress response in animals, which will lead to the up-regulation of the expression of the pcna gene [45]. Therefore, the pcna gene can be used as a stress-related gene. In this study, we found that the stress response and aggression behavior performance of LP and HP was significantly lower than that of CK, and their serum cortisol hormone levels and pcna gene expression were significantly lower (p < 0.05), which was consistent with the findings of Näslund et al. [46], using hatchery tank enrichment. The LP and HP groups showed a significant decrease (p < 0.05) in the frequency of the three behaviors of clustering, aggression, and stress, with a “precipitous” decrease in the middle of the experiment, as also shown in the studies of Mork et al. [24] and Einfalt et al. [47]. The socially enriched group (LS and HS, particularly LS), despite the decreasing trend during the experiment, had a significantly lower frequency than the CK group only in the clustering behavior and closed to the CK group in the rest two. The results showed that physical enrichment treatments helped to reduce the environmental stress and survival pressure of O. bidens, regulate their behavior, and enhance their welfare level, which is consistent with the findings of Fazekas et al. [48] at Acipenser ruthenus. However, the phenomenon of increased aggression and stressful behaviors in the socially enriched groups (LS and HS) showed that neither high-density nor low-density social enrichment treatments had a significant enhancing effect on the welfare level of O. bidens in terms of their psychological condition. Social enrichment, and especially the high-density one, may cause more survival stress to O. bidens, mainly in terms of space utilization and food competition [49], and less space utilization due to the amount of farming is perhaps the most important reason. In contrast, the low-density one, we speculate, may be due to the dominance hierarchy created by social interactions, which negatively affected the welfare level of O. bidens. Perhaps the social enrichment at medium densities may promote welfare levels on the psychological condition of O. bidens. It has also been noted that, in general, dominant fish are more territorial, better feeders, and more aggressive [50,51]. This could explain the results of the increase in stress and aggression behavior of O. bidens [52], which is a ferocious fish, in an environment where it is mixed with docile fishes such as Z. platypus and C. auratus. This discovery suggests that O. bidens may use an adaptive strategy to increase population survival in a limited environment.

5. Conclusions

In summary, physical enrichment treatments have shown significant positive effects on the growth, gonadal development, and welfare of O. bidens. These treatments have been particularly impactful on the growth and gonadal development of O. bidens, as well as in enhancing their antioxidant abilities, reducing stress, aggression, and clustering, and therefore improving welfare. Even though social enrichment treatments have displayed some positive effects on the growth and gonadal development of O. bidens, their impact on welfare levels was mildly negative. It is important to note that environmental enrichment is a multifaceted system, and further research is needed to fully explore the effects of environmental enrichment on the welfare level of O. bidens.