Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis)
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Treatment
2.2. Extraction of RNA and Synthesis of cDNA
2.3. qRT-PCR and Data Analysis
2.4. Validation of Reference Gene Stability
2.5. Statistical Analyses
3. Results
3.1. Quality and Efficiency of qRT-PCR
3.2. Expression Levels of the Internal Reference Genes in CAB and CAK Cells
3.2.1. Expression Levels of Reference Genes in CAB and CAK Cells Under Normal Physiological Conditions
3.2.2. Expression Levels of Reference Genes in CAB and CAK Cells Under LPS Stimulation Condition
3.2.3. Expression Levels of Reference Genes in CAB and CAK Cells Under Poly I: C Stimulation Condition
3.3. Gene Expression Stability in CAB and CAK Cells
3.3.1. Consistency of Reference Gene Expression in CAB and CAK Cells Under Basal Physiological Conditions
3.3.2. Stability of Reference Gene Transcripts in CAB and CAK Cells Following LPS Stimulation
3.3.3. Reference Gene Expression Stability in CAB and CAK Cells Stimulated by Poly I: C
3.4. Validation of Selected Reference Genes in CAB and CAK Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Valasek, M.A.; Repa, J.J. The power of real-time PCR. Adv. Physiol. Educ. 2005, 29, 151–159. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Geng, Y.; Hu, T.; Zhao, Y.; Yang, S.; Hao, D. Evaluation of Optimal Reference Genes for qRT-PCR Analysis in Hyphantria cunea (Drury). Insects 2022, 13, 97. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative real-time RT-PCR--a perspective. J. Mol. Endocrinol. 2005, 34, 597–601. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.F.; Fu, W.F.; Zeng, Z.Y.; Guo, S.Q.; Yan, Y.L.; Tu, Y.F.; Gou, T.G.; Zhang, Q.Z. Establishment and application of a TaqMan probe-based qPCR for the detection of Enterocytozoon hepatopenaei in shrimp Litopenaeus vannamei. Parasitol. Res. 2022, 121, 2263–2274. [Google Scholar] [CrossRef]
- Najafpanah, M.J.; Sadeghi, M.; Bakhtiarizadeh, M.R. Reference genes selection for quantitative real-time PCR using RankAggreg method in different tissues of Capra hircus. PLoS ONE 2013, 8, e83041. [Google Scholar] [CrossRef]
- Yang, Y.W.; Chen, M.K.; Yang, B.Y.; Huang, X.J.; Zhang, X.R.; He, L.Q.; Zhang, J.; Hua, Z.C. Use of 16S rRNA gene-targeted group-specific primers for Real-Time PCR analysis of predominant bacteria in mouse feces. Appl. Environ. Microbiol. 2015, 81, 6749–6756. [Google Scholar] [CrossRef]
- Huggett, J.; Dheda, K.; Bustin, S.; Zumla, A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005, 6, 279–284. [Google Scholar] [CrossRef]
- Chapman, J.R.; Waldenström, J. With reference to reference genes: A systematic review of endogenous controls in gene expression studies. PLoS ONE 2015, 10, e0141853. [Google Scholar] [CrossRef]
- Wang, X.; Peng, F.; Dong, G.; Sun, Y.; Dai, X.; Yang, Y.; Liu, X.; Bai, Z. Identification and validation of appropriate reference genes for qRT-PCR analysis in Corynebacterium glutamicum. FEMS Microbiol. Lett. 2018, 365, fny030. [Google Scholar] [CrossRef]
- Su, R.R.; Huang, Z.Y.; Qin, C.W.; Zheng, X.L.; Lu, W.; Wang, X.Y. Evaluation of reference genes in glenea cantor (Fabricius) by using qRT-PCR. Genes 2021, 12, 1984. [Google Scholar] [CrossRef] [PubMed]
- Thellin, O.; Zorzi, W.; Lakaye, B.; De Borman, B.; Coumans, B.; Hennen, G.; Grisar, T.; Igout, A.; Heinen, E. Housekeeping genes as internal standards: Use and limits. J. Biotechnol. 1999, 75, 291–295. [Google Scholar] [CrossRef] [PubMed]
- Butte, A.J.; Dzau, V.J.; Glueck, S.B. Further defining housekeeping, or “maintenance,” genes focus on “A compendium of gene expression in normal human tissues”. Physiol. Genom. 2001, 7, 95–96. [Google Scholar] [CrossRef] [PubMed]
- Gao, Z.H.; Wei, J.H.; Yang, Y.; Zhang, Z.; Zhao, W.T. Selection and validation of reference genes for studying stress-related agarwood formation of Aquilaria sinensis. Plant Cell Rep. 2012, 31, 1759–1768. [Google Scholar] [CrossRef] [PubMed]
- Płachetka-Bożek, A.; Augustyniak, M. Evaluation of candidate reference genes for quantitative gene expression analysis in Spodoptera exigu a after long-time exposure to cadmium. Sci. Rep. 2017, 7, 8338. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Luo, J.; Xu, S.; Wang, W.; Liu, T.; Han, C.; Chen, Y.; Kong, L. Selection of reference genes for gene expression normalization in Peucedanum praeruptorum Dunn. under abiotic stresses, hormone treatments and different tissues. PLoS ONE 2016, 11, e0152356. [Google Scholar] [CrossRef]
- Li, L.; Tian, Y.; Li, Z.; Li, Z.; Duan, P.; Wang, X.; Chen, S.; Wang, L.; Wang, Q.; Zhai, J. Cryopreservation of embryos of humpback grouper (Cromileptes altivelis) using combinations of non-permeating cryoprotectants. Aquaculture 2022, 548, 737524. [Google Scholar] [CrossRef]
- Liu, J.; Sun, H.; Tang, L.; Wang, Y.; Wang, Z.; Mao, Y.; Huang, H.; Zhang, Q. Chromosome-level genome assembly of humpback grouper using PacBio HiFi reads and Hi-C technologies. Sci. Data 2024, 11, 51. [Google Scholar] [CrossRef]
- Mu, W.; Wang, X.; Wu, X.; Li, X.; Dong, Y.; Geng, L.; Ma, L.; Ye, B. The optimal arginine requirement in diets for juvenile humpback grouper, Cromileptes altivelis. Aquaculture 2020, 514, 734509. [Google Scholar] [CrossRef]
- Subekti, S.; Amiin, M.K.; Ardiyanti, H.B.; Yudarana, M.A.; Achmadi, I.; Akbar, R.E.K. Molecular epidemiology of helminth diseases of the humpback grouper, Cromileptes altivelis, as a pattern for mapping fish diseases in the Sunda Strait, Indonesia. Vet. World 2021, 14, 1324–1329. [Google Scholar] [CrossRef]
- Sun, Y.; Xiang, Y.; He, M.; Zhang, X.; Wang, S.; Guo, W.; Liu, C.; Cao, Z.; Zhou, Y. Evaluation of Lactococcus lactis HNL12 combined with Schizochytrium limacinum algal meal in diets for humpback grouper (Cromileptes altivelis). Fish Shellfish Immunol. 2019, 94, 880–888. [Google Scholar] [CrossRef]
- Wang, L.; Cao, Z.; Liu, Y.; Xiang, Y.; Sun, Y.; Zhou, Y.; Wang, S.; Guo, W. Establishment and characterization of a new cell line from the muscle of humpback grouper (Cromileptes altivelis). Fish Physiol. Biochem. 2020, 46, 1897–1907. [Google Scholar] [CrossRef] [PubMed]
- Jia, P.; Jin, F.; Xiang, Y.; Li, J.; Pan, H.; Cui, K.; Yi, M.; Jia, K. Establishment and characterization of a fin cell line from yellowfin sea bream (Acanthopagrus latus) and its application to fish virology and toxicology. Aquaculture 2022, 549, 737801. [Google Scholar] [CrossRef]
- Liu, Y.; Wei, C.; Liu, Z.; Cao, Z.; Sun, Y.; Zhou, Y.; Wang, S.; Guo, W. Establishment of a new fish cell line from the brain of humpback grouper (Cromileptes altivelis) and its application in toxicology and bacterial susceptibility. Fish Physiol. Biochem. 2021, 47, 1645–1658. [Google Scholar] [CrossRef] [PubMed]
- Wei, C.; Yang, X.; Kang, M.; Cao, Z.; Sun, Y.; Zhou, Y. An established kidney cell line from humpback grouper (Cromileptes altivelis) and its susceptibility to bacteria and heavy metals. Fish Physiol. Biochem. 2022, 48, 521–533. [Google Scholar] [CrossRef]
- Chen, X.; Sun, Y.; Zhang, P.; Li, J.; Li, H.; Wei, C.; Cao, Z.; Zhou, Y. Screening of stable internal reference genes by quantitative real-time PCR in humpback grouper Cromileptes altivelis. J. Oceanol. Limnol. 2021, 39, 1985–1999. [Google Scholar] [CrossRef]
- Uciechowski, P.; Dempke, W.C.M. Interleukin-6: A masterplayer in the cytokine network. Oncology 2020, 98, 131–137. [Google Scholar] [CrossRef]
- Lu, X.; Hu, Z.; Qin, Z.; Huang, H.; Yang, T.; Yi, M.; Jia, K. IFNh and IRF9 influence the transcription of MHCII mediated by IFNγ to maintain immune balance in sea perch Lateolabrax japonicus. Fish Shellfish Immunol. 2024, 153, 109857. [Google Scholar] [CrossRef]
- Lee, P.D.; Sladek, R.; Greenwood, C.M.; Hudson, T.J. Control genes and variability: Absence of ubiquitous reference transcripts in diverse mammalian expression studies. Genome Res. 2002, 12, 292–297. [Google Scholar] [CrossRef] [PubMed]
- Wang, G.H.; Liang, C.C.; Li, B.Z.; Du, X.Z.; Zhang, W.Z.; Cheng, G.; Zan, L.S. Screening and validation of reference genes for qRT-PCR of bovine skeletal muscle-derived satellite cells. Sci. Rep. 2022, 12, 5653. [Google Scholar] [CrossRef]
- Dickson, K.; Lehmann, C. Inflammatory response to different toxins in experimental sepsis models. Int. J. Mol. Sci. 2019, 20, 4341. [Google Scholar] [CrossRef]
- Qureshi, S.T.; Gros, P.; Malo, D. The Lps locus: Genetic regulation of host responses to bacterial lipopolysaccharide. Inflamm. Res. 1999, 48, 613–620. [Google Scholar] [CrossRef]
- Jiang, B.J.; Li, Q.; Zhang, Z.Q.; Huang, Y.X.; Wu, Y.Q.; Li, X.; Huang, M.L.; Huang, Y.; Jian, J.C. Selection and evaluation of stable reference genes for quantitative real-time PCR in the head kidney leukocyte of Oreochromis niloticus. Aquac. Rep. 2023, 31, 101660. [Google Scholar] [CrossRef]
- Chen, X.; Liu, X.; Cai, D.; Wang, W.; Cui, C.; Yang, J.; Xu, X.; Li, Z. Sequencing-based network analysis provides a core set of genes for understanding hemolymph immune response mechanisms against Poly I:C stimulation in Amphioctopus fangsiao. Fish Shellfish Immunol. 2023, 133, 108544. [Google Scholar] [CrossRef]
- Chen, X.J.; Zhang, X.Q.; Huang, S.; Cao, Z.J.; Qin, Q.W.; Hu, W.T.; Sun, Y.; Zhou, Y.C. Selection of reference genes for quantitative real-time RT-PCR on gene expression in Golden Pompano (Trachinotus ovatus). Pol. J. Vet. Sci. 2017, 20, 583–594. [Google Scholar] [CrossRef]
- Zhai, Y.; Lin, Q.; Zhou, X.; Zhang, X.; Liu, T.; Yu, Y. Identification and validation of reference genes for quantitative real-time PCR in Drosophila suzukii (Diptera: Drosophilidae). PLoS ONE 2014, 9, e106800. [Google Scholar] [CrossRef]
- Sagri, E.; Koskinioti, P.; Gregoriou, M.E.; Tsoumani, K.T.; Bassiakos, Y.C.; Mathiopoulos, K.D. Housekeeping in Tephritid insects: The best gene choice for expression analyses in the medfly and the olive fly. Sci. Rep. 2017, 7, 45634. [Google Scholar] [CrossRef]
- Dharmaratnam, A.; Sudhagar, A.; Nithianantham, S.R.; Das, S.; Swaminathan, T.R. Evaluation of candidate reference genes for quantitative RTqPCR analysis in goldfish (Carassius auratus L.) in healthy and CyHV-2 infected fish. Vet. Immunol. Immunopathol. 2021, 237, 110270. [Google Scholar] [CrossRef]
- Zhao, N.; Zhang, H.; Zhu, L.; Hou, Y.; Wu, Y.; Cao, Z.; Sun, Y. Selection and verification of reference genes for gene expression studies in different cell lines of golden pompano (Trachinotus ovatus). Fishes 2022, 8, 8. [Google Scholar] [CrossRef]
- González-Bermúdez, L.; Anglada, T.; Genescà, A.; Martín, M.; Terradas, M. Identification of reference genes for RT-qPCR data normalisation in aging studies. Sci. Rep. 2019, 9, 13970. [Google Scholar] [CrossRef]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, Research0034. [Google Scholar] [CrossRef]
- Su, J.; Zhang, R.; Dong, J.; Yang, C. Evaluation of internal control genes for qRT-PCR normalization in tissues and cell culture for antiviral studies of grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2011, 30, 830–835. [Google Scholar] [CrossRef] [PubMed]
- Peña, A.A.; Bols, N.C.; Marshall, S.H. An evaluation of potential reference genes for stability of expression in two salmonid cell lines after infection with either Piscirickettsia salmonis or IPNV. BMC Res. Notes 2010, 3, 101. [Google Scholar] [CrossRef] [PubMed]
- Germain, L.; Pereira, D.; Winn, L.M. Reference gene considerations for toxicological assessment of the flame retardant triphenyl phosphate in an in vitro fish embryonic model. J. Appl. Toxicol. 2024. online ahead of print. [Google Scholar] [CrossRef]
- Shu, B.; Zhang, J.; Zeng, J.; Cui, G.; Zhong, G. Stability of selected reference genes in Sf9 cells treated with extrinsic apoptotic agents. Sci. Rep. 2019, 9, 14147. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Tan, Z.; Hu, B.; Yang, Z.; Xu, B.; Zhuang, L.; Huang, B. Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol. Plant. 2015, 155, 138–148. [Google Scholar] [CrossRef]
- Wang, H.L.; Chen, J.; Tian, Q.; Wang, S.; Xia, X.; Yin, W. Identification and validation of reference genes for Populus euphratica gene expression analysis during abiotic stresses by quantitative real-time PCR. Physiol. Plant. 2014, 152, 529–545. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′→3′) |
---|---|
Actin | F:CTGCGGAATCCATGAGACCA R:CATCGTACTCCTGCTTGCTGA |
B2M | F:CCGTCAATGGCTAAAGATGC R:CAATGGTGATTTCTGGTGGGT |
GAPDH | F:CAAATACGACGACATCAAGAAGGT R:ATCCGAACTCGTTGTCATACCAT |
TTLL1 | F:CACCCTCAACATCGTCACTCC R:AGGTCACGCTCGGCATTCT |
RPL13 | F:CGGACGTGGCTTCACTCTG R:CTTGATGGGCATGACTGGAC |
EF1A | F:CAACTTCAACGCCCAGGTCA R:CTCATGTCACGCACAGCAAAA |
Reference Gene | Treatments | CAB | CAK | ||||||
---|---|---|---|---|---|---|---|---|---|
2 h | 4 h | 8 h | 12 h | 2 h | 4 h | 8 h | 12 h | ||
Actin | PBS | 12.8 ± 0.5 | 13.2 ± 0.9 | 12.2 ± 0.5 | 13.0 ± 0.9 | 12.6 ± 0.7 | 12.4 ± 1.0 | 12.8 ± 0.5 | 12.1 ± 0.6 |
LPS | 10.7 ± 0.8 | 10.5 ± 0.5 | 10.8 ± 0.3 | 9.6 ± 0.5 | 13.7 ± 0.4 | 11.7 ± 0.3 | 11.5 ± 1.0 | 11.7 ± 0.4 | |
Poly I: C | 12.0 ± 0.2 | 12.1 ± 0.3 | 10.9 ± 0.8 | 11.4 ± 0.8 | 13.4 ± 0.3 | 12.4 ± 0.4 | 10.7 ± 0.2 | 11.6 ± 0.4 | |
B2M | PBS | 19.8 ± 0.6 | 18.1 ± 1.1 | 18.2 ± 1.3 | 19.7 ± 0.5 | 19.3 ± 0.9 | 19.4 ± 0.6 | 19.2 ± 0.9 | 19.0 ± 0.6 |
LPS | 18.4 ± 0.6 | 18.0 ± 0.2 | 18.2 ± 0.3 | 17.3 ± 0.3 | 20.3 ± 0.5 | 19.8 ± 0.3 | 19.1 ± 0.8 | 19.1 ± 0.3 | |
Poly I: C | 18.9 ± 0.2 | 18.7 ± 0.3 | 17.4 ± 0.8 | 18.0 ± 1.0 | 19.0 ± 0.0 | 19.0 ± 1.1 | 17.4 ± 0.1 | 18.0 ± 0.5 | |
GAPDH | PBS | 27.4 ± 0.5 | 26.9 ± 0.6 | 27.0 ± 0.1 | 28.2 ± 0.4 | 29.8 ± 0.4 | 30.5 ± 1.1 | 31.7 ± 2.2 | 30.5 ± 1.1 |
LPS | 30.6 ± 0.9 | 31.7 ± 0.8 | 32.3 ± 0.6 | 31.7 ± 0.4 | 30.4 ± 1.5 | 30.2 ± 0.1 | 30.6 ± 0.4 | 30.3 ± 1.0 | |
Poly I: C | 29.3 ± 0.2 | 29.9 ± 0.5 | 29.2 ± 0.7 | 30.5 ± 1.6 | 30.5 ± 1.3 | 30.0 ± 2.1 | 30.3 ± 0.1 | 28.1 ± 0.5 | |
RPL13 | PBS | 15.3 ± 0.6 | 14.6 ± 0.9 | 15.1 ± 0.2 | 15.5 ± 0.4 | 14.5 ± 0.6 | 14.4 ± 0.4 | 14.6 ± 0.5 | 14.7 ± 0.4 |
LPS | 13.3 ± 0.6 | 13.6 ± 0.0 | 13.1 ± 0.7 | 12.6 ± 0.6 | 15.6 ± 1.3 | 14.1 ± 0.1 | 14.3 ± 0.9 | 14.2 ± 0.4 | |
Poly I: C | 14.9 ± 0.3 | 14.9 ± 0.7 | 13.6 ± 0.9 | 14.5 ± 1.2 | 15.7 ± 0.7 | 15.2 ± 1.2 | 14.3 ± 0.7 | 14.5 ± 0.3 | |
EF1A | PBS | 13.4 ± 0.6 | 12.6 ± 1.1 | 13.2 ± 0.2 | 13.6 ± 0.4 | 12.1 ± 0.9 | 12.4 ± 0.9 | 12.2 ± 0.8 | 11.9 ± 0.5 |
LPS | 11.3 ± 0.8 | 11.0 ± 0.3 | 11.4 ± 0.2 | 10.4 ± 0.7 | 11.9 ± 0.7 | 11.4 ± 0.2 | 10.6 ± 0.3 | 10.5 ± 0.3 | |
Poly I: C | 12.9 ± 0.3 | 12.9 ± 0.2 | 12.4 ± 0.2 | 12.3 ± 0.9 | 11.2 ± 0.1 | 11.4 ± 0.3 | 12.1 ± 0.0 | 10.5 ± 0.1 | |
TTLL1 | PBS | 27.2 ± 0.3 | 27.3 ± 1.0 | 26.9 ± 0.6 | 26.2 ± 0.9 | 27.8 ± 0.8 | 28.4 ± 1.0 | 27.9 ± 0.8 | 28.4 ± 1.2 |
LPS | 25.4 ± 1.0 | 25.7 ± 0.5 | 25.9 ± 0.3 | 23.9 ± 0.6 | 29.7 ± 0.0 | 28.2 ± 0.1 | 27.7 ± 0.9 | 27.1 ± 0.3 | |
Poly I: C | 27.8 ± 0.2 | 28.5 ± 0.2 | 27.5 ± 0.7 | 26.5 ± 0.2 | 30.2 ± 0.4 | 29.8 ± 1.1 | 28.8 ± 0.3 | 28.7 ± 0.3 |
Cell Line | Ranking Order | geNorm | NormFinder | BestKeeper | Recommended Comprehensive Ranking |
---|---|---|---|---|---|
CAB | 1 | EF1A/RPL13 | Actin | RPL13 | RPL13 |
2 | RPL13 | EF1A | EF1A | ||
3 | Actin | TTLL1 | GAPDH | Actin | |
4 | TTLL1 | EF1A | TTLL1 | TTLL1 | |
5 | B2M | GAPDH | Actin | GAPDH | |
6 | GAPDH | B2M | B2M | B2M | |
CAK | 1 | EF1A/Actin | RPL13 | RPL13 | RPL13 |
2 | TTLL1 | Actin | Actin | ||
3 | B2M | B2M | B2M | EF1A | |
4 | RPL13 | EF1A | EF1A | B2M | |
5 | TTLL1 | Actin | TTLL1 | TTLL1 | |
6 | GAPDH | GAPDH | GAPDH | GAPDH |
Cell Line | Stimulus | Ranking Order | geNorm | NormFinder | BestKeeper | Recommended Comprehensive Ranking | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
2 h | 4 h | 8 h | 12 h | 2 h | 4 h | 8 h | 12 h | 2 h | 4 h | 8 h | 12 h | 2 h | 4 h | 8 h | 12 h | |||
CAB | LPS | 1 | EF1A/ Actin | TTLL1/ EF1A | RPL13/ EF1A | TTLL1/ B2M | TTLL1 | TTLL1 | TTLL1 | TTLL1/ B2M | B2M | B2M | TTLL1 | TTLL1 | TTLL1 | TTLL1 | TTLL1 | TTLL1 |
2 | B2M | RPL13 | B2M | RPL13 | RPL13 | B2M | B2M | B2M | RPL13 | B2M | B2M | |||||||
3 | RPL13 | RPL13 | Actin | RPL13 | RPL13 | B2M | Actin | RPL13 | TTLL1 | TTLL1 | Actin | RPL13 | RPL13 | B2M | EF1A | RPL13 | ||
4 | TTLL1 | Actin | TTLL1 | EF1A | Actin | EF1A | EF1A | EF1A | Actin | EF1A | EF1A | EF1A | Actin | EF1A | Actin | EF1A | ||
5 | B2M | B2M | B2M | Actin | EF1A | Actin | RPL13 | Actin | EF1A | Actin | RPL13 | Actin | EF1A | Actin | RPL13 | Actin | ||
6 | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | ||
Poly I: C | 1 | EF1A/ RPL13 | EF1A/ RPL13 | EF1A/ B2M | Actin/ B2M | RPL13 | EF1A/ RPL13 | EF1A | RPL13 | EF1A | EF1A | EF1A | TTLL1 | EF1A | EF1A | EF1A | EF1A | |
2 | EF1A | B2M | EF1A | TTLL1 | RPL13 | TTLL1 | EF1A | RPL13 | RPL13 | B2M | RPL13 | |||||||
3 | Actin | B2M | Actin | EF1A | TTLL1 | B2M | TTLL1 | TTLL1 | RPL13 | B2M | Actin | RPL13 | TTLL1 | B2M | Actin | Actin | ||
4 | B2M | TTLL1 | RPL13 | RPL13 | Actin | TTLL1 | Actin | Actin | Actin | TTLL1 | B2M | Actin | Actin | TTLL1 | TTLL1 | TTLL1 | ||
5 | TTLL1 | Actin | TTLL1 | TTLL1 | B2M | Actin | RPL13 | B2M | B2M | Actin | RPL13 | B2M | B2M | Actin | RPL13 | B2M | ||
6 | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | GAPDH | ||
CAK | LPS | 1 | RPL13/B2M | RPL13/TTLL1 | RPL13/TTLL1 | RPL13/ Actin | RPL13/B2M | RPL13/ TTLL1 | GAPDH | RPL13/ Actin | EF1A | RPL13 | RPL13 | B2M | RPL13 | RPL13 | RPL13 | RPL13 |
2 | Actin | RPL13 | B2M | B2M | RPL13 | B2M | TTLL1 | TTLL1 | Actin | |||||||||
3 | Actin | GAPDH | B2M | GAPDH | Actin | GAPDH | RPL13 | GAPDH | Actin | TTLL1 | TTLL1 | Actin | Actin | GAPDH | B2M | B2M | ||
4 | GAPDH | Actin | GAPDH | B2M | GAPDH | Actin | TTLL1 | TTLL1 | B2M | GAPDH | Actin | EF1A | GAPDH | Actin | Actin | GAPDH | ||
5 | TTLL1 | EF1A | Actin | TTLL1 | TTLL1 | EF1A | B2M | B2M | GAPDH | Actin | EF1A | GAPDH | EF1A | B2M | GAPDH | TTLL1 | ||
6 | EF1A | B2M | EF1A | EF1A | EF1A | B2M | EF1A | EF1A | TTLL1 | EF1A | GAPDH | TTLL1 | TTLL1 | EF1A | EF1A | EF1A | ||
Poly I: C | 1 | Actin/ GAPDH | B2M/ GAPDH | Actin/ B2M | Actin/ RPL13 | Actin/ GAPDH | Actin | RPL13 | Actin | B2M | Actin | EF1A | RPL13 | Actin | Actin | RPL13 | Actin | |
2 | B2M | GAPDH | B2M | Actin | B2M | RPL13 | Actin | GAPDH | B2M | EF1A | RPL13 | |||||||
3 | RPL13 | Actin | GAPDH | B2M | RPL13 | GAPDH | EF1A | EF1A | EF1A | EF1A | TTLL1 | TTLL1 | B2M | GAPDH | B2M | B2M | ||
4 | B2M | EF1A | RPL13 | EF1A | B2M | RPL13 | B2M | RPL13 | RPL13 | RPL13 | B2M | B2M | RPL13 | EF1A | Actin | EF1A | ||
5 | EF1A | RPL13 | EF1A | TTLL1 | EF1A | EF1A | Actin | TTLL1 | GAPDH | TTLL1 | Actin | EF1A | EF1A | RPL13 | GAPDH | TTLL1 | ||
6 | TTLL1 | TTLL1 | TTLL1 | GAPDH | TTLL1 | TTLL1 | TTLL1 | GAPDH | TTLL1 | GAPDH | GAPDH | GAPDH | TTLL1 | TTLL1 | TTLL1 | GAPDH |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Du, X.; Zhang, H.; Zhu, L.; Cao, Z.; Zhang, C.; Wu, Y.; Zhou, Y.; Sun, Y. Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis). Fishes 2024, 9, 491. https://doi.org/10.3390/fishes9120491
Du X, Zhang H, Zhu L, Cao Z, Zhang C, Wu Y, Zhou Y, Sun Y. Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis). Fishes. 2024; 9(12):491. https://doi.org/10.3390/fishes9120491
Chicago/Turabian StyleDu, Xiangyu, Han Zhang, Longfei Zhu, Zhenjie Cao, Chen Zhang, Ying Wu, Yongcan Zhou, and Yun Sun. 2024. "Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis)" Fishes 9, no. 12: 491. https://doi.org/10.3390/fishes9120491
APA StyleDu, X., Zhang, H., Zhu, L., Cao, Z., Zhang, C., Wu, Y., Zhou, Y., & Sun, Y. (2024). Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis). Fishes, 9(12), 491. https://doi.org/10.3390/fishes9120491