Next Article in Journal
Screening and Identification of Interacting Proteins of Mitfa in Red Tilapia
Next Article in Special Issue
Year-Round Spawning, Filial Cannibalism, and Embryonic and Larval Development of the Coral Reef Fish Orchid Dottyback, Pseudochromis fridmani
Previous Article in Journal
Dorsal Fin Spines and Rays for Nonlethal Ageing of Goliath Grouper Epinephelus itajara
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 8
Issue 5
10.3390/fishes8050240
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of a New Insulin-like Growth Factor 3 (igf3) in Turbot (Scophthalmus maximus): Comparison and Expression Analysis of IGF System Genes during Gonadal Development

by
Chunyan Zhao
1,2,†,
Sujie Zheng
1,†,
Yongji Dang
1,
Mengshu Wang
1 and
Yichao Ren
1,*
1
School of Marine Science and Engineering, Qingdao Agricultural University, Qingdao 266109, China
2
Department of Biological Sciences, National University of Singapore, Singapore 117543, Singapore
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2023, 8(5), 240; https://doi.org/10.3390/fishes8050240
Submission received: 28 March 2023 / Revised: 22 April 2023 / Accepted: 26 April 2023 / Published: 4 May 2023
(This article belongs to the Special Issue Reproductive Biology and Breeding of Fish)
Browse Figures
Review Reports Versions Notes

Abstract

:
Fish reproduction is closely related to the regulation of the brain and liver, making it essential to identify the factors that control this process. The turbot (Scophthalmus maximus) is an economically significant species that has been successfully breeding through industrial aquaculture. Investigation of factors into the involvement of gonadal development is crucial for artificial breeding. In this study, a new insulin-like growth factor 3 igf3 gene was cloned and characterized. Additionally, all three types of turbot IGFs contain a distinct IGF domain, with IGF3 and IGF2 being grouped with other teleosts, demonstrating a closely related genetic relationship. The expression analysis showed that igf3 mRNA is predominantly expressed in the gonad and brain (specifically in the pituitary and hypothalamus), suggesting its effects at multiple levels in the brain–pituitary–gonadal axis. Furthermore, the mRNA levels of igfs during gonadal development were examined. In the gonad and liver of female turbots, the expression levels of igfs mRNA significantly increased from stage II to VI during the process of oogenesis, including maturation and degeneration. In the testis and liver of male turbots, igf3 mRNA maintained high expression levels during the proliferation of spermatogonia at stages II and III. In addition, the highest levels of igf1 and igf2 were observed at the beginning of spermatogenesis and during sperm production at stages V and VI. All the results suggest that the IGFs were closely related to the gonadal development in turbot and improve a better understanding of the IGF system in the regulation of gonadal development in teleost.
Keywords:
Scophthalmus maximus; insulin-like growth factor 3; brain; gonadal development
Key Contribution: This study characterizes a new igf3 in turbot, analyzes the differential expression in gonad and liver during gonadal development in breeding season, and contributes to a better understanding of the potential roles of IGF system in turbot breeding and reproduction.

1. Introduction

Reproduction is an essential life process for animals, ensuring the preservation and continuity of genetic information within populations. The brain–pituitary–gonad (BPG) axis plays a vital role in regulating reproduction [1], involving feedback regulation of gonadal hormones on target organs in teleost fish. Previous research has demonstrated that the reproductive system demands substantial amounts of energy-related biomolecules, such as vitellogenin and lipids, which are primarily derived from the liver [2]. Consequently, reproductive success is closely linked to growth and energy metabolism [3].
The liver has been reported to regulate fish gonad development by modulating the BPG axis [2,4,5]. Various growth factors, including insulin-like growth factor (IGF), influence gamete production, and energy metabolism during gonad development [1,4]. Research has shown that IGF is a highly conserved polypeptide throughout the evolutionary process and plays a crucial role in fish reproduction [6,7]. Typically, IGF1 and IGF2 have been identified in a wide variety of teleost, and similarly to mammals, are produced in the liver [7]. The IGF1 has been shown to directly impact the follicle-stimulating hormone (FSH) [8]. Additionally, it is widely accepted that IGF1 and IGF2 can affect gonadal development and germ cell proliferation in male and female gonads through endocrine function when released into circulation [7,9].
Previous studies have shown that a novel igf3 has been identified in zebrafish (Danio rerio), exhibiting unique expression patterns in the gonad and brain. The igf3 levels progressively increase in zebrafish follicle cells [10,11] and exhibit strong regulatory effects on gonadotropin analogs and human chorionic gonadotropin (HCG) [9]. Two transcripts of igf3 have also been discovered in zebrafish [11]. Studies in tilapia (Oreochromis niloticus) [12,13] and orange-spotted grouper (Epinephelus coioides) [13,14] have also revealed that igf3 mRNA is present in the gonads and brain during the early stages of sex determination and differentiation. Moreover, IGF3 can work synergistically with FSH to stimulate spermatogonial proliferation and differentiation [14]. This evidence suggests that IGF3 is involved in gonadal and reproductive development in teleost.
Turbot (Scophthalmus maximus) possesses significant economic value in both Europe and China. Previous studies have indicated that turbot reaches sexual maturity at two years of age [15]. Although igf1 and igf2 have been isolated in turbot, and their expression patterns were examined in the regulation of ovarian development [8], a comprehensive characterization of the turbot IGF system remains elusive. In this study, a new igf3 in turbot was identified and characterized. Additionally, we analyzed cross-species variations in IGFs compared to other teleost. Concurrently, the expression levels of igfs in the gonad and liver were investigated during the gonadal development of turbot. These findings could contribute to a better understanding of the potential roles of the IGF system in breeding and reproduction in turbot.

2. Materials and Methods

2.1. Fish Sampling

All turbots used in the study were obtained from a fish farm in Laiyang, China. Turbot is raised under suitable conditions with temperature of 17 ± 0.5 °C, dissolved oxygen of 7.55 ± 0.05 mg/L, and fed with fresh miscellaneous fish twice a day. During the stages of gonadal development, 25 female turbots and 25 male turbots were anesthetized and sampled. Half of each gonad was placed in Bouin’s solution for 24 h until the histology analysis. The remaining half was frozen in liquid nitrogen for qPCR for the expression analysis. The body weight, liver weight, and gonad weight were measured during the experiment. The gonadal somatic index (GSI) defined as the ratio of gonad weight to body weight and liver somatic index (LSI) defined as the ratio of liver weight to body weight were calculated. All experimental procedures were conducted strictly in accordance with the research protocols approved by Qingdao Agricultural University for the ethical treatment of experimental animals.

2.2. Histological Observation

The fixed gonadal tissues were dehydrated by a series of gradient alcohol, transparented by xylene, and embedded by paraffin. Then the paraffin blocks were cut into 5 μm sections. After being stained with hematoxylin and eosin, the slices were observed with a microscope (Axioscope 5, Zeiss, Oberkochen, Germany).

2.3. igf3 Isolation

The testis tissue at stage II was prepared, and the total RNA from testis was extracted, using SPARK easy Improved Tissue/Cell RNA Kit (SparkJade, Qingdao, China). The purity of RNA extracts was detected with UV spectroscopy. First-strand cDNA was synthesized followed by a transcript first-strand cDNA synthesis kit (TranStart, Zaozhuang, China). A conserved fragment of igf3 based on the gene-specific primers was obtained with the PCR amplification procedures using 2 × Taq Plus Master Mix II (Dye Plus) (Vazyme, Nanjing, China). Then, a series of RACE-PCRs according to a SMARTer RACE 5′/3′ Kit (Takara, Tokyo, Japan) were performed to obtain the full length of igf3. The purified PCR products were sequenced with corresponding inserts into the pMD18-T cloning vector (Takara, Tokyo, Japan). All the primers used are listed in Table 1.

2.4. Phylogenetic and Bioinformatics Analyses

The amino acid sequence of turbot IGF3 was deduced using BioEdit (Ibis Biosciences, Carlsbad, CA, USA). The protein sequences of IGF1 and IGF2 of turbot and IGFs in other teleost were collected from National Center of Biotechnology Information website (http://www.ncbi.nlm.nih.gov/, accessed on 15 July 2022). The multi-aligned turbot IGFs (IGF1, IGF2, and IGF3) were performed by BioEdit (Ibis Biosciences, Carlsbad, CA, USA). The domain was predicted by SMART (https://smart.embl-heidelberg.de/, accessed on 15 July 2022), and the three-dimensional structure was predicted by RCSB PDB (https://www.pdbus.org/, accessed on 20 July 2022). The phylogenetic analyses were conducted by MEGA7 software (version 7.0, Mega Limited, Auckland, New Zealand) using neighbor (NJ)-based molecular evolution method and was visualized in iTOL(https://itol.embl.de/itol_account.cgi, accessed on 20 July 2022). The position and orientation of igfs and their adjacent genes in humans, chickens, zebrafish, and medaka (Oryzias latipes) on the chromosome were determined using NCBI database for syntenic analysis.

2.5. Quantitative Real-Time PCR (qPCR)

The qPCR was performed using 2 × SYBR Green qPCR Mix (SparkJade, Shandong, China) a quantitative thermal cycler (Quantagene, Beijing, China). Specific primers of igfs and reference genes of β-actin are listed in Table 1. The qPCR mixture reaction is a total of 10 μL, with 5 μL of 2 × SYBR qPCR Mix, 3.4 μL of ddH2O, 0.4 μL of forward primers (10 μM), and 0.4 μL of reverse primers (10 μM), and 0.8 μL of cDNA template. The procedure of PCR reaction was performed with 3 min at 94 °C;10 s at 94 °C and 30 s at 58 °C for 40 cycles; 10 s at 95 °C, 5 s at 65 °C. The relative gene expression levels were analyzed using the method of 2−ΔΔCT.

2.6. Statistical Analysis

Statistical analysis was performed using SPSS version 26.0, and all the results showed as mean ± SEM. Data were analyzed using two-way analysis of variance (ANOVA) followed by Duncan’s multiple range tests. Differences were considered to be significant at p < 0.05.

3. Results

3.1. Gonadal Histology and Reproductive Stages Assessment

Based on the histology, five gonadal stages of II to VI were identified during the breeding season of turbot (Figure 1A–J). In females, the oocyte development of five stages were primary growth oocytes and perinucleolar oocytes at stage II (Figure 1A), beginning the early vitellogenesis with increasing lipid granules at stage III (Figure 1B), undergoing late vitellogenesis with lipid and yolk granules filling most of the ooplasm at stage IV (Figure 1C), ovulated oocytes with completed vitellogenesis at stage V (Figure 1D), and residual postovulatory follicle in the degenerated ovaries at stage VI (Figure 1E), respectively. In males, the spermiogenesis of five stages was observed and assessed by the major type of male germ cell (Figure 1F–J). At stage II, the testis was filled with spermatogonia with the largest diameters (Figure 1F). Following stage III, the spermatogonia developed into primary spermatocytes which had a smaller diameter but a relatively bigger nucleus (Figure 1G). At stage IV, the testis was filled with secondary spermatocytes with deep staining, and a litter number of haploid spermatids appeared (Figure 1H). At stage V, spermatozoa with smaller sizes and darker staining were in the seminiferous tubules (Figure 1I). Then at stage VI, the testis was empty with spermatozoa expelled out.
The GSI and LSI were also calculated (Figure 1K,L). In female turbot, the GSI increased from stage II to IV and peaked at stage IV. Then, the GSI decreased at stage V when oocytes ovulated, followed by an increase at stage VI. The LSI showed a trend of increasing at first and then decreasing with the peak at stage V. In male turbot, the GSI peaked at stage V, and the LSI increased from stage II to stage VI.

3.2. Molecular Cloning of Turbot igf3

The cloned igf3 cDNA is 2261 bp in full length, including an open reading frame (ORF) of 891 bp and a 3′ untranslated terminal region (UTR) of 1370 bp. The predicted protein contains 296 amino acids, including a signal peptide and 5 domains of B, C, A, D, and E, with 6 conserved cysteine residues in domains of B and A (Figure 2A). The turbot IGF1 (GenBank accession No. NC_049689.1) and IGF2 (GenBank accession No. NC_049689.1) were obtained from NCBI. An obvious IGF domain was involved in IGF1, IGF2, and IGF3 (Figure 2B and Figure 3B) based on the sequence analysis. The modeled three-dimensional structure of the IGF1, IGF2, and IGF3 is visualized and shown in Figure 3C.

3.3. Cross-Species Changes in igfs Members and Copy Numbers

A total of 68 igf genes were screened from NCBI in 23 representative teleost species (Table 2). Among these genes, the igf2 typically consisted of two paralogs (igf2a and igf2b) in several fish, such as zebrafish and Atlantic salmon (Salmo salar L.). The igf3 was usually found in Atherinomorpha, Protacanthopterygii, Ostariophysi, Clupeomorpha, Osteoglossomorpha, and Holostei.

3.4. Phylogenetic and Synteny Analysis

Turbot IGF3 exhibited high identity to other teleosts, ranging from 75% to Japanese medaka, 74% to Zebrafish, 70% to channel catfish (Ictalurus punctatus), and 68% to rainbow trout (Oncorhynchus mykiss). Meanwhile, IGF1 exhibited 51.7% identity and 73.5% similarity with IGF2, 36.7% identity, and 69.8% similarity with IGF3. In addition, IGF2 showed 75.1% similarity with IGF3. The phylogenetic analysis revealed relatively higher degrees of identity of IGF2 and IGF3 among the analyzed fish species. While IGF1 showed a variety of clusters (Figure 4).
Synteny analysis of the igf1, igf2, and igf3, using turbot as the base reference, was performed to confirm their origin in fish and human species. Consistent with this, a total of 8 genes (pmch, parpbp, nup37, th2, pah, itfg2, ascl1a, and nrip2) neighbor the turbot igf1 gene (Figure 5A); a total of 8 genes (mrpl23, th, nap1|4a, phlda2, osbpl5, dusp8a, mob2a) neighbor the turbot igf2 gene (Figure 5B); a total of 6 gene (stk38a, irif1, renbp, ndufb11, dedd and efhd2) neighbor the turbot igf3 gene (Figure 5C). It showed that the igf1, igf2, and igf3 are relatively conserved in various fish species.
Humans lost larger numbers of genes next to igf1. Similarly, humans lost several genes next to igf2, which also happens in medaka. Moreover, the genetic relationship between turbot and zebrafish igf1 is close. The genetic relationship between turbot and medaka igf3 is close. The genetic relationship between turbot and zebrafish igf2 is close.

3.5. Tissue Expression Pattern of igf3 mRNA

All the tissues of the testis, ovary, liver, brain, heart, kidney, muscle, pituitary, eye, intestines, gill, skin, spleen, and stomach of male and female turbot were obtained. The expression levels of turbot igf3 transcripts were detected by qPCR. As shown in Figure 6, the igf3 transcript was detected in all analyzed tissues. The expression level of igf3 in the gonad was significantly higher than in other tissues, followed by the liver, brain, heart, and pituitary gland. The expression pattern was similar in males and females.
The expression levels of igf3 transcript in five brain structures (cerebellum, hypothalamus, pituitary gland, telencephalon, and diencephalon) of male turbot were also analyzed. As shown in Figure 7, igf3 mRNA showed high expression levels in the hypothalamus and pituitary, and the levels of igf3 in the hypothalamus were the highest among all structures of the brain.

3.6. Expression Patterns igfs in Gonad and Liver during Gonadal Development

According to the previous research on gonadal morphology [2,16] and histology, the relative expression of igfs mRNA during gonadal development in the gonad and liver of both sexes of turbot was examined.

3.6.1. Gonad

The expression levels of igf1 mRNA gradually decreased from stage II to stage III, with the lowest values at stage III, and then significantly increased to stage VI, with the highest levels at stage VI in females and males of turbot (Figure 8A,B). The expression level of igf2 mRNA remained unchanged from stage II to stage IV, and gradually increased from stage IV to stage VI in female turbot (Figure 8E). Additionally, igf2 mRNA significantly increased from stage II to stage VI in male turbot (Figure 8F).
For the expression of igf3 in the ovary of turbot, it showed an increasing trend during gonadal development, with the lowest levels at stage III, and the highest levels at stage VI (Figure 8I). In testis, the highest level of igf3 was at stage III (Figure 8J), followed by a decreasing trend from stage III to stage VI, with the lowest levels at stage VI.

3.6.2. Liver

The igf1 mRNA levels in the liver gradually increased from stage II to stage VI, peaking at stage VI in female turbot (Figure 8C). In contrast, in male turbot, the igf1 mRNA levels significantly increased from stage II to stage III and reached to the lowest value at stage VI (Figure 8D). The igf2 mRNA remained unchanged from stage II to stage IV, but gradually increased from stage IV to stage VI, with the highest values observed at stage VI in female turbot (Figure 8G). In addition, for males, igf2 mRNA significantly decreased from stage II to stage VI, and there was no significant difference from stage III to stage VI (Figure 8H).
As shown in Figure 8K, there is an increase in igf3 expression in the female liver between stages II and VI, being the highest expression at stage VI. Additionally, in the male liver in Figure 8L, the expression of igf3 mRNA increased from stage II to stage III, reaching the highest levels at stage III and dropping to the lowest level at stage VI.

4. Discussion

To date, the IGF system has been reported in more than 23 fish species, and three igf genes, igf1, igf2 (igf2a, igf2b), and igf3 have been identified in teleost. The igf3 is a novel gonad-specific isoform that identified in several teleost species, including tilapia, zebrafish, common carp (Cyprinus carpio), and medaka [7,13]. In this study, we isolated a new member igf3 in turbot. The predicted protein of turbot IGF3 has typical characteristics of the IGF system, which showed five conserved domains and six cysteine residues, similar to the IGF3 protein structure in common carp [17]. Turbot IGF3 has cysteine residues in the domains of B, C, A, D, and E, and amino acid residues for binding to IGF receptors [18]. Conversely, in orange-spotted grouper, it has not only five domains but also seven conserved cysteine residues [14]. While in zebrafish and tilapia, the IGF peptides consisted of only four domains [13] and six conserved cysteine residues [10]. These peptides shared high similarity with human IGF in their primary structure. All these results show that different fish species have taken different evolutionary branches, resulting in differences in specific protein structures. However, phylogenetic analysis showed that IGF3 exhibits a relatively low sequence homology among teleost, and the evolutionary diversity of IGF3 may be due to different genome duplications. It is interesting to note that IGF3 appears to have a closer relationship to IGF1 in the phylogenetic tree. This might be caused by whole genome duplication in vertebrates [19].
It was found that the predicted amino acid of IGF3 in turbot contained a transmembrane domain, similar to that of the silver pomfret, indicating that IGF3 of turbot is located in the cell membrane. While the proteins of IGF1 and IGF2 do not have transmembrane domains [8,16,20], which indicated that the protein of IGF1 and IGF2 are located in the cytoplasm. Generally, among all proteins found in eukaryotic organisms, one-third were transmembrane proteins [19]. Additionally, there were two types of transmembrane proteins, the bitopic proteins, and the polytopic proteins. The type of bitopic proteins crosses the membrane only once, while the type of polytopic proteins crosses the membrane multiple times. Each type of cell membrane reflected a special function [17]. In this study, the structural analysis demonstrated that the IGF3 of turbot belonged to the single-span membrane protein [19], which contained most of the growth factors and cell factors. These factors made them effective by binding to specific protein molecules to regulate cell-to-cell signaling, suggesting that IGF3 of turbot might also play a crucial role in intercellular signal transmission.
For sequence alignment and phylogenetic analysis, both IGF1 and IGF2 have similar protein sequences and domains [8]. In addition, their structures are also similar in zebrafish [9,21] and sliver pomfret [19]. This indicates that different amino acid sequences can form similar binding sites after protein folding, which can explain the similar functions of IGF1 and IGF2. It was also found that the IGF1 and IGF2 of turbot shared the highest homology with Japanese flounder and tongue sole, with a homology of 92% and 89%, respectively. This is in accordance with previous studies [2,8,15,20].
In this study, the transcript levels of igf3 were high in the testis, ovary, brain, and pituitary. Taken with other studies in fish, such as common carp [17], zebrafish [10], and medaka [18], it is suggested that igf3 might play a significant role in the gonadal development of teleost. While in silver pomfret (Pampus argenteus), the transcripts of igf3 were specifically detected in the testis and ovary, suggesting that the expression of igf3 is limited to fish species and is gonad-specific. Additionally, the igf3 mRNA was also detected in the brain, especially in the hypothalamus and pituitary gland, which is consistent with that in tilapia [12], orange-spotted grouper [14], and silver pomfret [19]. Therefore, it could be confirmed that the igf3 mRNA is expressed in the tissues of the BPG axis, indicating that it might play an important role in gonadal development involving the BPG axis.
In most teleost, the liver has been considered the main organ for synthesizing and targeting igfs [7]. At the same time, gonadal development is closely related to the liver [2,22]. Studies have demonstrated that paracrine igfs mediated the specific ovarian and spermatic development in several fish species [7,11,12,19]. The highest levels of igf3 mRNA expression were observed during oocyte maturation and yolk formation in zebrafish [11,16] and common carp [17]. Moreover, the igf3, in adult zebrafish testis, played roles in stimulating the proliferation of spermatogonia [23] and had a positive effect on reproduction in male tilapia by 17a-ethinylestradiol (EE2) [12]. What is more, it is also observed that igf3 is involved in gonadal development, especially at the onset of meiosis in tilapia [12]. However, in common carp, the levels of igf3 mRNA peaked during the testis recession period [17], indicating that it also affects sperm release. All the results suggest that the regulation of gonadal igf3 may differ among species [24,25]. This study showed that the expression of igf3 mRNA exhibit the highest level at stage VI in females, which supports a potential role of igf3 in oocyte maturation and degradation [16,17]. In males, igf3 mRNA maintained significantly high expression levels at stages II and III when the spermatogonia began to proliferate. So, it is speculated that the igf3 might play a role in differentiating spermatogonia [26]. Yet, further experimental work to investigate should be required.
There are two other members in the IGF system, igf1 and igf2, which have also been proven to express in gonads of many teleosts, and the regulation and function of IGFs in fish gonads have been summarized in Table 3. Generally, the expression levels of igf1 and igf2 vary depending on the developmental stage [27]. In turbot, the levels of igf1 and igf2 showed an increase during oogenesis and spermatogenesis, leading to the maturation and release of oocytes and sperm. Meanwhile, in the livers of both sexes, the expression levels of igf1 and igf2 are similar to that in the gonads. In most vertebrates, the liver has been confirmed as the main synthesis and target organ for IGFs [2,19], and the hypothesis that IGFs directly participate in the synthesis of nutrient substances for gametogenesis formed [26]. However, in turbot, there is a difference in male and female lives. In male livers, the highest levels of igfs happened at stages II and III, when spermatogenesis was beginning. While in female livers, it showed an increasing trend with the highest level in stage VI. So, it is speculated that more nutrient substances are needed during oocyte maturation in female and spermatogonia differentiation. What is more, studies have demonstrated that the expression levels of igf2 mRNA were always higher than those of igf1 in the gonads and livers of both sexes in some fishes, such as silver pomfret [19] and rainbow trout [28], suggesting that igf2 possess more important role than igf1 in gametogenesis. Further research on the detection and location of igf1 and igf2 is necessary to determine their specific role in gonadal development. In addition, the expression of igf1 and igf2 mRNA of turbot was also detected during the unfertilized egg stage and post-larva stage, indicating that igfs may have a function in cell growth and division in turbot [8]. During the metamorphosis of turbot, igf1, rather than igf2, may play a crucial role in regulating the metamorphic development, as the mRNA igf1 showed significantly higher levels at the early metamorphosis stage, followed by a decrease until the metamorphosis was completed [20]. Therefore, as an important regulator of growth and development, igf1 and igf2 are involved in many regulatory processes in turbot.

5. Conclusions

In conclusion, we have successfully cloned a new specific igf3 in turbot, and it showed a highly similar structure to igf3 to other teleosts. The high expression levels of igf3 happened in the ovaries and testis, which strongly suggests that it might play an important role in oogenesis and spermatogonial development. Additionally, along with igf1 and igf2, all three igfs, in the liver and gonad, are likely to be involved in regulating the gonadal development in both male and female turbot. These results can improve our understanding of the IGF system in the regulation of gonadal development in turbot and provide additional information on IGFs in teleost.

Author Contributions

Conceptualization, C.Z. and Y.R.; methodology, S.Z.; investigation, S.Z.; resources, Y.R.; data curation, S.Z., M.W., and Y.D.; writing—original draft preparation, S.Z.; writing—review and editing, C.Z. and Y.R.; visualization, S.Z.; supervision, C.Z. and Y.R.; project administration, Y.R.; funding acquisition, C.Z. and Y.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation of China (No. 31802319), the Key Research and Development Program of Shandong Province (No. 2021LZC027), Advanced Talents Foundation of QAU (No. 6631119055), and it was also supported by “First class fishery discipline” program in Shandong Province, China.

Institutional Review Board Statement

All experimental procedures were conducted strictly in accordance with the research protocols approved by Qingdao Agricultural University for the ethical treatment of experimental animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data will be made available on request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Biran, J.; Levavi-Sivan, B. Endocrine Control of Reproduction Fish. Encycl. Reprod. 2018, 3, 362–368. [Google Scholar] [CrossRef]
  2. Xue, R.; Wang, X.; Xu, S.; Liu, Y.; Feng, C.; Zhao, C.; Liu, Q.; Li, J. Expression profile and localization of vitellogenin mRNA and protein during ovarian development in turbot (Scophthalmus maximus). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2018, 226, 53–63. [Google Scholar] [CrossRef] [PubMed]
  3. Della Torre, S.; Benedusi, V.; Fontana, R.; Maggi, A. Energy metabolism and fertility: A balance preserved for female health. Nat. Rev. Endocrinol. 2014, 10, 13–23. [Google Scholar] [CrossRef]
  4. Kwintkiewicz, J.; Giudice, L.C. The interplay of insulin-like growth factors, gonadotropins, and endocrine disruptors in ovarian follicular development and function. Semin. Reprod. Med. 2009, 27, 43–51. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, D.; Shi, B.; Shao, P.; Shao, C.; Wang, C.; Li, J.; Liu, X.; Ma, X.; Zhao, X. The identification of miRNAs that regulate ovarian maturation in Cynoglossus semilaevis. Aquaculture 2022, 555, 738250. [Google Scholar] [CrossRef]
  6. Mahardini, A.; Yamauchi, C.; Takeuchi, Y.; Rizky, D.; Takekata, H.; Takemura, A. Changes in mRNA abundance of insulin-like growth factors in the brain and liver of a tropical damselfish, Chrysiptera cyanea, in relation to seasonal and food-manipulated reproduction. Gen. Comp. Endocrinol. 2018, 269, 112–121. [Google Scholar] [CrossRef] [PubMed]
  7. Reinecke, M. Insulin-Like Growth Factors and Fish Reproduction. Biol. Reprod. 2010, 82, 656–661. [Google Scholar] [CrossRef]
  8. Wen, H.; Qi, Q.; Hu, J.; Si, Y.; He, F.; Li, J. Expression analysis of the insulin-like growth factors I and II during embryonic and early larval development of turbot (Scophthalmus maximus). J. Ocean Univ. China 2015, 14, 309–316. [Google Scholar] [CrossRef]
  9. Nelson, S.N.; Van Der Kraak, G. Characterization and regulation of the insulin-like growth factor (IGF) system in the zebrafish (Danio rerio) ovary. Gen. Comp. Endocrinol. 2010, 168, 111–120. [Google Scholar] [CrossRef] [PubMed]
  10. Kwok, H.F.; So, W.K.; Wang, Y.; Ge, W. Zebrafish gonadotropins and their receptors: I. Cloning and characterization of zebrafish follicle-stimulating hormone and luteinizing hormone receptors—Evidence for their distinct functions in follicle development. Biol. Reprod. 2005, 72, 1370–1381. [Google Scholar] [CrossRef]
  11. Li, J.; Liu, Z.; Wang, D.; Cheng, C.H. Insulin-like growth factor 3 is involved in oocyte maturation in zebrafish. Biol. Reprod. 2011, 4, 476–486. [Google Scholar] [CrossRef] [PubMed]
  12. Berishvili, G.; Baroiller, J.F.; Eppler, E.; Reinecke, M. Insulin-like growth factor-3 (IGF-3) in male and female gonads of the tilapia: Development and regulation of gene expression by growth hormone (GH) and 17alpha-ethinylestradiol (EE2). Gen. Comp. Endocrinol. 2010, 167, 128–134. [Google Scholar] [CrossRef]
  13. Wang, D.S.; Jiao, B.; Hu, C.; Huang, X.; Liu, Z.; Cheng, C.H. Discovery of a gonad-specific IGF subtype in teleost. Biochem. Biophys. Res. Commun. 2008, 367, 336–341. [Google Scholar] [CrossRef]
  14. Yang, H.; Chen, H.; Zhao, H.; Liu, L.; Xie, Z.; Xiao, L.; Li, S.; Zhang, Y.; Lin, H. Molecular cloning of the insulin-like growth factor 3 and difference in the expression of igf genes in orange-spotted grouper (Epinephelus coioides). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2015, 186, 68–75. [Google Scholar] [CrossRef] [PubMed]
  15. Jia, Y.; Jing, Q.; Gao, Y.; Huang, B. Involvement and expression of growth hormone/insulin-like growth factor member mRNAs in the ovarian development of turbot (Scophthalmus maximus). Fish Physiol. Biochem. 2019, 45, 955–964. [Google Scholar] [CrossRef]
  16. Zhao, C.; Liu, Q.; Xu, S.; Xiao, Y.; Wang, W.; Yang, J.; Yang, Y.; Wang, Y.; Song, Z.; Li, J. Identification of type A spermatogonia in turbot (Scophthalmus maximus) using a new cell-surface marker of Lymphocyte antigen 75 (ly75/CD205). Theriogenology 2018, 113, 137–145. [Google Scholar] [CrossRef]
  17. Song, F.; Wang, L.; Zhu, W.; Fu, J.; Dong, J.; Dong, Z. A Novel igf3 Gene in Common Carp (Cyprinus carpio): Evidence for Its Role in Regulating Gonadal Development. PLoS ONE 2016, 11, e0168874. [Google Scholar] [CrossRef] [PubMed]
  18. Xie, J.; Zhong, Y.; Zhao, Y.; Xie, W.; Guo, J.; Gui, L.; Li, M. Characterization and expression analysis of gonad specific igf3 in the medaka ovary. Aquac. Fish. 2020, 369, 13–18. [Google Scholar] [CrossRef]
  19. Gu, W.; Yang, Y.; Ning, C.; Wang, Y.; Hu, J.; Zhang, M.; Kuang, S.; Sun, Y.; Li, Y.; Zhang, Y.; et al. Identification and characteristics of insulin-like growth factor system in the brain, liver, and gonad during development of a seasonal breeding teleost, Pampus argenteus. Gen. Comp. Endocrinol. 2021, 300, 113645. [Google Scholar] [CrossRef]
  20. Meng, Z.; Hu, P.; Lei, J.; Jia, Y. Expression of insulin-like growth factors at mRNA levels during the metamorphic development of turbot (Scophthalmus maximus). Gen. Comp. Endocrinol. 2016, 235, 11–17. [Google Scholar] [CrossRef]
  21. Schulz, B.; Altendorf-Hofmann, A.; Kirchner, T.; Katenkamp, D.; Petersen, I.; Knosel, T. Loss of CD34 and high IGF2 are associated with malignant transformation in solitary fibrous tumors. Pathol. Res. Pract. 2014, 210, 92–97. [Google Scholar] [CrossRef]
  22. Dahle, R.; Taranger, G.L.; Karlsen, Ø.; Kjesbu, O.S.; Norberg, B. Gonadal development and associated changes in liver size and sexual steroids during the reproductive cycle of captive male and female Atlantic cod (Gadus morhua L.). Comp. Biochem. Phys. A 2003, 136, 641–653. [Google Scholar] [CrossRef] [PubMed]
  23. Morais, R.; Crespo, D.; Nobrega, R.H.; Lemos, M.S.; van de Kant, H.J.G.; de Franca, L.R.; Male, R.; Bogerd, J.; Schulz, R.W. Antagonistic regulation of spermatogonial differentiation in zebrafish (Danio rerio) by Igf3 and Amh. Mol. Cell. Endocrinol. 2017, 454, 112–124. [Google Scholar] [CrossRef]
  24. Yang, G.; Liang, X.; Xu, S.; Cai, H.; Ma, L.; Chang, X.; Zhang, Y.; Yang, L.; Meng, X. Molecular identification of Igf3 and its roles in grass carp (Ctenopharyngodon idella). Aquaculture 2022, 548, 737581. [Google Scholar] [CrossRef]
  25. Nobrega, R.H.; Morais, R.D.; Crespo, D.; de Waal, P.P.; de Franca, L.R.; Schulz, R.W.; Bogerd, J. Fsh Stimulates Spermatogonial Proliferation and Differentiation in Zebrafish via Igf3. Endocrinology 2015, 156, 3804–3817. [Google Scholar] [CrossRef] [PubMed]
  26. Jiao, F.; Fu, B.; Yang, Y.; Xue, H.; Wu, Y.; Zhao, H.; Wang, Q.; Yang, H. The Expression Pattern of Insulin-Like Growth Factor Subtype 3 (igf3) in the Orange-Spotted Grouper (Epinephelus coioides) and Its Function on Ovary Maturation. Int. J. Mol. Sci. 2023, 24, 2868. [Google Scholar] [CrossRef]
  27. Yan, R.; Ding, J.; Yang, Q.; Zhang, X.; Han, J.; Jin, T.; An, Y. Lead acetate induces cartilage defects and bone loss in zebrafish embryos by disrupting the GH/IGF-1 axis. Ecotoxicol. Environ. Saf. 2023, 253, 114666. [Google Scholar] [CrossRef]
  28. Si, Y.; He, F.; Wen, H.; Li, S.; He, H. Effects of low salinity on epigenetic changes of growth hormone and growth hormone receptor in half smooth tongue sole (Cynoglossus semilaevis). Reprod. Breed. 2021, 1, 11–21. [Google Scholar] [CrossRef]
  29. Shu, T.; Zhai, G.; Pradhan, A.; Olsson, P.E.; Yin, Z. Zebrafish cyp17a1 knockout reveals that androgen-mediated signaling is important for male brain sex differentiation. Gen. Comp. Endocrinol. 2020, 295, 113–490. [Google Scholar] [CrossRef]
  30. Gao, Y.; Lu, S.; Wu, M.; Yao, W.; Jin, Z.; Wu, X. Effects of dietary protein levels on growth, feed utilization and expression of growth-related genes of juvenile giant grouper (Epinephelus lanceolatus). Aquaculture 2019, 504, 369–374. [Google Scholar] [CrossRef]
  31. Pellissier, T.; Al Nafea, H.; Good, S.V. Divergence of insulin superfamily ligands, receptors and Igf binding proteins in marine versus freshwater stickleback: Evidence of selection in known and novel genes. Comp. Biochem. Physiol. Part D Genom. Proteom. 2018, 25, 53–61. [Google Scholar] [CrossRef] [PubMed]
  32. Zhang, Y.; Shen, W.; Cao, M.; Li, J.; Zheng, B.; Lou, Z.; Qian, B.; Xue, L. Dynamic alterations in methylation of global DNA and growth-related genes in large yellow croaker (Larimichthys crocea) in response to starvation stress. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2019, 227, 98–105. [Google Scholar] [CrossRef] [PubMed]
  33. Yusuf, A.; Huang, X.; Chen, N.; Li, S.; Apraku, A.; Wang, W.; David, M.A. Growth and metabolic responses of juvenile largemouth bass (Micropterus salmoides) to dietary vitamin c supplementation levels. Aquaculture 2021, 534, 736243. [Google Scholar] [CrossRef]
  34. Yuan, B.; Chen, K.; Zhu, Y.; Yuan, Y.; Li, M. Medaka igf1 identifies somatic cells and meiotic germ cells of both sexes. Gene 2018, 642, 423–429. [Google Scholar] [CrossRef] [PubMed]
  35. Albornoz-Abud, N.A.; Canul-Marin, G.F.; Chan-Cua, I.; Hernandez-Nunez, E.; Canizares-Martinez, M.A.; Valdes-Lozano, D.; Rodriguez-Canul, R.; Albores-Medina, A.; Colli-Dula, R.C. Gene expression analysis on growth, development and toxicity pathways of male Nile tilapia (Oreochromis niloticus), after acute and sub-chronic benzo (α) pyrene exposures. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 250, 109160. [Google Scholar] [CrossRef]
  36. Lynn, S.G.; Wallat, G.K.; Malison, J.A.; Shepherd, B.S. Developmental expression and estrogen responses of endocrine genes in juvenile yellow perch (Perca flavescens). Gen. Comp. Endocrinol. 2011, 171, 151–159. [Google Scholar] [CrossRef]
  37. Tran, T.T.H.; Nguyen, H.T.; Le, B.T.N.; Tran, P.H.; Van Nguyen, S.; Kim, O.T.P. Characterization of single nucleotide polymorphism in IGF1 and IGF1R genes associated with growth traits in striped catfish (Pangasianodon hypophthalmus Sauvage, 1878). Aquaculture 2021, 538, 736542. [Google Scholar] [CrossRef]
  38. Khoa, T.N.D.; Waqalevu, V.; Honda, A.; Shiozaki, K.; Kotani, T. An integrative description of the digestive system morphology and function of Japanese flounder (Paralichthys olivaceus) during early ontogenetic development. Aquaculture 2021, 531, 735855. [Google Scholar] [CrossRef]
  39. Swirplies, F.; Wuertz, S.; Baßmann, B.; Orban, A.; Schäfer, N.; Brunner, R.M.; Hadlich, F.; Goldammer, T.; Rebl, A. Identification of molecular stress indicators in pikeperch Sander lucioperca correlating with rising water temperatures. Aquaculture 2019, 501, 260–271. [Google Scholar] [CrossRef]
  40. Wei, Y.; Liang, M.; Xu, H. Fish protein hydrolysate affected amino acid absorption and related gene expressions of IGF-1/AKT pathways in turbot (Scophthalmus maximus). Aquacult. Nutr. 2019, 26, 145–155. [Google Scholar] [CrossRef]
  41. Vikeså, V.; Nankervis, L.; Remø, S.C.; Waagbø, R.; Hevrøy, E.M. Pre and postprandial regulation of ghrelin, amino acids and IGF1 in Atlantic salmon (Salmo salar L.) at optimal and elevated seawater temperatures. Aquaculture 2015, 438, 159–169. [Google Scholar] [CrossRef]
  42. Carnevali, O.; Maradonna, F.; Gioacchini, G. Integrated control of fish metabolism, wellbeing and reproduction: The role of probiotic. Aquaculture 2017, 472, 144–155. [Google Scholar] [CrossRef]
  43. Tenugu, S.; Pranoty, A.; Mamta, S.-K.; Senthilkumaran, B. Development and organisation of gonadal steroidogenesis in bony fishes—A review. Aquac. Fish. 2021, 6, 223–246. [Google Scholar] [CrossRef]
  44. Lubzens, E.; Bobe, J.; Young, G.; Sullivan, C.V. Maternal investment in fish oocytes and eggs: The molecular cargo and its contributions to fertility and early development. Aquaculture 2017, 472, 107–143. [Google Scholar] [CrossRef]
  45. Middleton, M.A.; Larsen, D.A.; Dickey, J.T.; Swanson, P. Evaluation of endocrine and transcriptomic markers of male maturation in winter-run Steelhead Trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 2019, 81, 30–40. [Google Scholar] [CrossRef] [PubMed]
  46. Wu, L.; Yang, P.; Luo, F.; Wang, D.; Zhou, L. R-spondin1 signaling pathway is required for both the ovarian and testicular development in a teleosts, Nile tilapia (Oreochromis niloticus). Gen. Comp. Endocrinol. 2016, 230–231, 177–185. [Google Scholar] [CrossRef]
  47. Melo, M.C.; van Dijk, P.; Andersson, E.; Nilsen, T.O.; Fjelldal, P.G.; Male, R.; Nijenhuis, W.; Bogerd, J.; de Franca, L.R.; Taranger, G.L.; et al. Androgens directly stimulate spermatogonial differentiation in juvenile Atlantic salmon (Salmo salar). Gen. Comp. Endocrinol. 2015, 211, 52–61. [Google Scholar] [CrossRef] [PubMed]
Fishes 08 00240 g001 550
Figure 1. (A–E) Gonadal morphology of different developmental stages of turbot in females. (F–J) Gonadal morphology of different developmental stages of turbot in males. (K) GSI of the turbot during different gonadal developmental stages. (L) LSI of the turbot during different gonadal developmental stages. LP, late perinucleolus; LV, late vitellogenic oocyte; PG, primary growth oocyte; PN previtellogenic oocyte; PS, primary spermatocyte; PV, post-vitellogenic oocyte. SG, spermatogonium; SP, spermatozoon; SS, secondary spermatocyte; ST, spermatid; SV, seminal vesicle. Scale bar, (A–E,G,H,J), 100 μm; (F,I), 100 μm. The results are expressed as the mean ± SEM. The different uppercase letters represent statistical significance (p < 0.05) between two stages in females. The different lowercase letters represent statistical significance (p < 0.05) between two stages in males.
Figure 1. (A–E) Gonadal morphology of different developmental stages of turbot in females. (F–J) Gonadal morphology of different developmental stages of turbot in males. (K) GSI of the turbot during different gonadal developmental stages. (L) LSI of the turbot during different gonadal developmental stages. LP, late perinucleolus; LV, late vitellogenic oocyte; PG, primary growth oocyte; PN previtellogenic oocyte; PS, primary spermatocyte; PV, post-vitellogenic oocyte. SG, spermatogonium; SP, spermatozoon; SS, secondary spermatocyte; ST, spermatid; SV, seminal vesicle. Scale bar, (A–E,G,H,J), 100 μm; (F,I), 100 μm. The results are expressed as the mean ± SEM. The different uppercase letters represent statistical significance (p < 0.05) between two stages in females. The different lowercase letters represent statistical significance (p < 0.05) between two stages in males.
Fishes 08 00240 g001
Fishes 08 00240 g002 550
Figure 2. (A) Full sequence and structural domain of turbot igf3. The signal peptide and B, C, A, D, E domains are underlined. The six cysteine residue sites are marked with white letters on a black background. (B) Comparison of IGF3 domains of turbot and other teleost fish.
Figure 2. (A) Full sequence and structural domain of turbot igf3. The signal peptide and B, C, A, D, E domains are underlined. The six cysteine residue sites are marked with white letters on a black background. (B) Comparison of IGF3 domains of turbot and other teleost fish.
Fishes 08 00240 g002
Fishes 08 00240 g003 550
Figure 3. The amino acid alignments (A), structural domain (B), and three-dimensional structure (C) of IGF1, IGF2, and IGF3 of turbot.
Figure 3. The amino acid alignments (A), structural domain (B), and three-dimensional structure (C) of IGF1, IGF2, and IGF3 of turbot.
Fishes 08 00240 g003
Fishes 08 00240 g004 550
Figure 4. Phylogenetic analysis of IGFs from different teleosts. Turbot IGF1 (XP_035474357.1), Japanese flounder IGF1 (XP_019960503.1), Tongue sole IGF1 (NP_001281127.1), Channel catfish IGF1 (NP_001187224.1), Zebrafish IGF1 (NP_571900.1), Large yellow croaker IGF1 (NP_001290263.1), Atlantic cod IGF1 (XP_030209089.1), Torafugu IGF1 (NP_001177291.1), Chicken IGF1 (NP_001004384.1), Nile tilapia IGF1 (NP_001266432.1), Cattle IGF1 (NP_001071296.1), Japanese medaka IGF1 (XP_023808207.1), Human IGF1 (NP_000609.1), Mouse IGF1 (NP_001104744.1), Common carp IGF1 (XP_018948511.1), Striped catfish IGF1 (XP_034169273.1), Turbot IGF2 (XP_035498746.1), Japanese flounder IGF2 (XP_019957746.1), Half-smooth tongue sole IGF2 (NP_001281148.1), Channel catfish IGF2 (NP_001187875.1), Channel catfish IGF2 (NP_001187128.1), Zebrafish IGF2 (NP_571508.1), Zebrafish IGF2 (NP_001001815.1), Large yellow croaker IGF2 (XP_019124122.1), Atlantic cod IGF2 (XP_030221784.1), Torafugu IGF2 (XP_003967407.1), Chicken IGF2 (NP_001025513.1), Nile tilapia IGF2 (NP_001266572.1), Cattle IGF2 (NP_001354556.1), Japanese medaka IGF2 (XP_023811944.1), Human IGF2 (NP_000603.1), Mouse IGF2 (NP_001116208.1), Common carp IGF2 (XP_018955405.1), Striped catfish IGF2 (XP_026793492.1), Striped catfish IGF2 (XP_026775548.1), Turbot IGF3 (XP_035500204.1), Channel catfish IGF3 (XP_017323682.1), Zebrafish IGF3 (NP_001108522.1), Large yellow croaker IGF3 (XP_010749392.1), Rainbow trout IGF3 (XP_021471565.1), Giant grouper IGF3 (XP_033486016.1), Japanese medaka IGF3 (XP_011476003.1), Yellow perch IGF3 (XP_028439487.1), Striped sea-bass IGF3 (XP_035513051.1), Atlantic salmon IGF3 (XP_014001555.1), Pikeperch IGF3 (XP_031167391.1), Striped catfish IGF3 (XP_026784148.2).
Figure 4. Phylogenetic analysis of IGFs from different teleosts. Turbot IGF1 (XP_035474357.1), Japanese flounder IGF1 (XP_019960503.1), Tongue sole IGF1 (NP_001281127.1), Channel catfish IGF1 (NP_001187224.1), Zebrafish IGF1 (NP_571900.1), Large yellow croaker IGF1 (NP_001290263.1), Atlantic cod IGF1 (XP_030209089.1), Torafugu IGF1 (NP_001177291.1), Chicken IGF1 (NP_001004384.1), Nile tilapia IGF1 (NP_001266432.1), Cattle IGF1 (NP_001071296.1), Japanese medaka IGF1 (XP_023808207.1), Human IGF1 (NP_000609.1), Mouse IGF1 (NP_001104744.1), Common carp IGF1 (XP_018948511.1), Striped catfish IGF1 (XP_034169273.1), Turbot IGF2 (XP_035498746.1), Japanese flounder IGF2 (XP_019957746.1), Half-smooth tongue sole IGF2 (NP_001281148.1), Channel catfish IGF2 (NP_001187875.1), Channel catfish IGF2 (NP_001187128.1), Zebrafish IGF2 (NP_571508.1), Zebrafish IGF2 (NP_001001815.1), Large yellow croaker IGF2 (XP_019124122.1), Atlantic cod IGF2 (XP_030221784.1), Torafugu IGF2 (XP_003967407.1), Chicken IGF2 (NP_001025513.1), Nile tilapia IGF2 (NP_001266572.1), Cattle IGF2 (NP_001354556.1), Japanese medaka IGF2 (XP_023811944.1), Human IGF2 (NP_000603.1), Mouse IGF2 (NP_001116208.1), Common carp IGF2 (XP_018955405.1), Striped catfish IGF2 (XP_026793492.1), Striped catfish IGF2 (XP_026775548.1), Turbot IGF3 (XP_035500204.1), Channel catfish IGF3 (XP_017323682.1), Zebrafish IGF3 (NP_001108522.1), Large yellow croaker IGF3 (XP_010749392.1), Rainbow trout IGF3 (XP_021471565.1), Giant grouper IGF3 (XP_033486016.1), Japanese medaka IGF3 (XP_011476003.1), Yellow perch IGF3 (XP_028439487.1), Striped sea-bass IGF3 (XP_035513051.1), Atlantic salmon IGF3 (XP_014001555.1), Pikeperch IGF3 (XP_031167391.1), Striped catfish IGF3 (XP_026784148.2).
Fishes 08 00240 g004
Fishes 08 00240 g005 550
Figure 5. Syntenic analysis of igf1 (A), igf2 (B), igf3 (C) in turbot and other species. The igfs are shown in green. The other genes are shown in different colors.
Figure 5. Syntenic analysis of igf1 (A), igf2 (B), igf3 (C) in turbot and other species. The igfs are shown in green. The other genes are shown in different colors.
Fishes 08 00240 g005
Fishes 08 00240 g006 550
Figure 6. Tissue expression pattern of igf3 in female and male turbot. Tissues abbreviation: brain (Br), pituitary (Pi), kidney (Ki), liver (Li), gill (Gi), heart (He), spleen (Sp), stomach (St), skin (Sk), intestine (In), eye(eye), muscle (Mu), gonad (Go). The results are expressed as the mean ± SEM.
Figure 6. Tissue expression pattern of igf3 in female and male turbot. Tissues abbreviation: brain (Br), pituitary (Pi), kidney (Ki), liver (Li), gill (Gi), heart (He), spleen (Sp), stomach (St), skin (Sk), intestine (In), eye(eye), muscle (Mu), gonad (Go). The results are expressed as the mean ± SEM.
Fishes 08 00240 g006
Fishes 08 00240 g007 550
Figure 7. Expression pattern of igf3 in the brain structures of male turbot. Abbreviation: cerebellum (ce), hypothalamus (hy), pituitary gland (pi), telencephalon (te) and diencephalon (di). The results are expressed as the mean ± SEM. Statistical significance between two different brain structures (p < 0.05) marked with different letters.
Figure 7. Expression pattern of igf3 in the brain structures of male turbot. Abbreviation: cerebellum (ce), hypothalamus (hy), pituitary gland (pi), telencephalon (te) and diencephalon (di). The results are expressed as the mean ± SEM. Statistical significance between two different brain structures (p < 0.05) marked with different letters.
Fishes 08 00240 g007
Fishes 08 00240 g008 550
Figure 8. The expression of igfs mRNAs in gonad and liver during gonadal development of turbot. (A,E,I) The expression of igfs mRNAs in female gonad; (B,F,J) The expression of igfs mRNAs in male gonad; (C,G,K) The expression of igfs mRNAs in female liver; (D,H,L) The expression of igfs mRNAs in male liver. The results are expressed as the mean ± SEM. Statistical significance between two development stages (p < 0.05) marked with different letters.
Figure 8. The expression of igfs mRNAs in gonad and liver during gonadal development of turbot. (A,E,I) The expression of igfs mRNAs in female gonad; (B,F,J) The expression of igfs mRNAs in male gonad; (C,G,K) The expression of igfs mRNAs in female liver; (D,H,L) The expression of igfs mRNAs in male liver. The results are expressed as the mean ± SEM. Statistical significance between two development stages (p < 0.05) marked with different letters.
Fishes 08 00240 g008
Table
Table 1. Primers used for gene cloning and expression analysis.
Table 1. Primers used for gene cloning and expression analysis.
AimPrimerPrimer Sequence (5′–3′)Length
Partial cloningigf3-1FCTGTGCCAAACCAAAGAGCC504 bp
igf3-1RCAAACTGCTGTGCCGTGTC
igf3-2FCGGAGTGTGAGGAGTGTGTG411 bp
igf3-2RGGTGGTTTTCTGTGGGCTCT
Cloning 5′-end (RACE)igf3-GSP5-1AGGAGGAATGGTGGTTTTCTGTG
igf3-GSP5-nestedGGTGGTTTTCTGTGGGCTCT
Cloning 3′-end (RACE)igf3-GSP3-1GAGAAATACTGTGCCAAACCAAAGAG
igf3-GSP3-nestedCACAGAAAACCACCATTCCTCCT
expression analysisigf1-FCTGCTGAGGTTAAAGTGCGA165 bp
igf1-RAAGCCTCTCTCTCCACACAC
igf2-FGAGACGCTGTGCGGAGGAGA196 bp
igf2-RTTTCAGACTTGGCGGGTTT
igf3-3FGTACGGATCTCCTCAGCGAC180 bp
igf3-3RGGCTCTTTGGTTTGGCACAG
β-actin-FATCGTGGGGCGCCCCAGGCACC543 bp
β-actin-RCTCCTTAATGTCACGCACGATTTC
Table
Table 2. Identification of igf genes in teleost.
Table 2. Identification of igf genes in teleost.
SuperorderSpeciesCommon Nameigf1igf2 (igf2a/igf2b)igf3
Numbers
PercomorphaS.maximusTurbot111
P.olivaceusJapanese flounder11-
C.semilaevisHalf-smooth tongue sole11-
M.salmoidesLargemouth bass11-
S.luciopercaPikeperch121
M.saxatilisStriped sea-bass111
P.flavescensYellow perch111
E.lanceolatusGiant grouper111
O.niloticusNile tilapia111
L.croceaLarge yellow croaker111
AtherinomorphaO. latipesJapanese medaka111
X. maculatusSouthern platyfish111
ProtacanthopterygiiS. salarAtlantic salmon121
O.mykissRainbow trout111
ParacanthopterygiiG. morhuaAtlantic cod11-
OstariophysiD. rerioZebrafish121
P.hypophthalmusStriped catfish121
ClupeomorphaC. harengusAtlantic herring111
OsteoglossomorphaS. formosusAsian arowana1-1
Table
Table 3. Studies on IGF system in teleost.
Table 3. Studies on IGF system in teleost.
GenesNumber of SpeciesFunctionReferences
igf116Ovary: follicular cell proliferation follicle growth, oocyte maturation.
Testis: stimulation of spermatogenesis.		C. semilaevis [29]; D. rerio [30]; E.lanceolatus [31]; G.aculeatus [32]; L.crocea [33]; M.salmoides [34]; O.latipes [35]; O.mykiss [28]; O.niloticus [36]; P.flavescens [37]; P.hypophthalmus [38]; P.olivaceus [39]; S.lucioperca [40]; S.maximus [41];
S. salar [42];
X. maculatus [43];
igf2 (igf2a/igf2b)11Ovary: oocyte maturational competence, oocyte maturation.
Testis: DNA synthesis of spermatogonia and spermatocytes.		C. semilaevis [29]; D. rerio [30]; E.lanceolatus [21]; G.aculeatus [32]; L.crocea [33]; M.salmoides [34]; O.mykiss [28]; O.niloticus [36]; P.flavescens [44]; P.hypophthalmus [38]; S.maximus [15]; X. maculatus [43].
igf39Ovary: follicular cell survival, follicular cell development and ovulation.
Testis: proliferation and division of type A spermatogonia and proliferation of Sertoli cells during spermatogenesis.		D. rerio [23]; E.lanceolatus [45]; M.salmoides [34]; O.latipes [18]; O.mykiss [45]; O.niloticus [46]; P.flavescens [44]; P.hypophthalmus [38]; S.salar [47].
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhao, C.; Zheng, S.; Dang, Y.; Wang, M.; Ren, Y. Identification of a New Insulin-like Growth Factor 3 (igf3) in Turbot (Scophthalmus maximus): Comparison and Expression Analysis of IGF System Genes during Gonadal Development. Fishes 2023, 8, 240. https://doi.org/10.3390/fishes8050240

AMA Style

Zhao C, Zheng S, Dang Y, Wang M, Ren Y. Identification of a New Insulin-like Growth Factor 3 (igf3) in Turbot (Scophthalmus maximus): Comparison and Expression Analysis of IGF System Genes during Gonadal Development. Fishes. 2023; 8(5):240. https://doi.org/10.3390/fishes8050240

Chicago/Turabian Style

Zhao, Chunyan, Sujie Zheng, Yongji Dang, Mengshu Wang, and Yichao Ren. 2023. "Identification of a New Insulin-like Growth Factor 3 (igf3) in Turbot (Scophthalmus maximus): Comparison and Expression Analysis of IGF System Genes during Gonadal Development" Fishes 8, no. 5: 240. https://doi.org/10.3390/fishes8050240

APA Style

Zhao, C., Zheng, S., Dang, Y., Wang, M., & Ren, Y. (2023). Identification of a New Insulin-like Growth Factor 3 (igf3) in Turbot (Scophthalmus maximus): Comparison and Expression Analysis of IGF System Genes during Gonadal Development. Fishes, 8(5), 240. https://doi.org/10.3390/fishes8050240

Article Metrics

Back to TopTop