Assessment of Growth-Related Parameters, Immune-Biochemical Profile, and Expression of Selected Genes of Red Tilapia Fed with Roselle Calyces (Hibiscus sabdariffa) Extract

Abstract

The purpose of this research was to determine whether or not supplementing a diet with ethanolic roselle calyces extract (ER) had any effect on the rate of growth, intestinal morphometry, total carotene in skin and muscle, blood profile, immunity status, and the expression response of red tilapia. The ER was added to four experimental diets at 0% (0 g kg⁻¹), 0.5% (5 g kg⁻¹), 1% (10 g kg⁻¹), and 2% (20 g kg⁻¹), which were designated as ER0 (control group), ER0.5, ER1, and ER2, respectively. The results show that ER1 induced higher weights (final weight, weight gain, specific growth rate, and weight gain rate) and all ER groups had considerably (p < 0.05) decreased feed conversion rates (FCR) compared with the control diet. Histomorphometric examination of the intestinal villi absorptive capacity showed fish given ER, specifically ER1, had increased villus length, width, and goblet cells (p < 0.05). The best hematological and biochemical parameters (the antioxidant enzyme activity of superoxide dismutase and catalase, lysozyme activity, and WBCs count) were observed for 5 g kg⁻¹ ER. In addition, diets supplemented with different levels of ER stimulated phagocytic activity (p < 0.05). Additionally, the highest total carotene content in skin and muscle was observed in ER0.5. The 0.5, 1, and 2% roselle extract diets induced upregulation of IGF-1, GHr, SOD, TNF-α, and LPL, whereas MSTN, HSP 70, and FAS were downregulated. In conclusion, dietary ER supplementations are advantageous for red tilapia because they improve immunological and growth-related parameters.

1. Introduction

Aquaculture is the most rapidly expanding food industry, with a significant contribution to supplying the world with high-quality and affordable animal-source protein and making up a substantial proportion (52%) of total fish supply [1]. Fish farming involves certain types of intervention in the growth process to improve production, such as consistent feeding [2], stocking [3], and protection from predators [4]. Unfortunately, there are several problems in the rearing process, one of which is stress, which contributes to various conditions: poor utilization and digestion of food [5,6] and poor quality of fish flesh [7]. Moreover, cultured fish are vulnerable to a wide range of pathogens [8], for instance, viruses, fungi, parasites, and bacteria [9,10], which sometimes cause mortalities [11]. Fish farmers have used antibiotics to prevent and treat stress-related diseases for years, but unregulated antibiotics usage has many negative repercussions, particularly for human health [12,13]. Consequently, many countries have strict rules concerning the use of antibiotics in aquaculture, whereas others seek a full ban [14,15]. Alternative control measures, including immunostimulants, have been implemented to combat disease outbreaks in aquaculture that promote fish resistance to various infections by improving specific and non-specific immune response mechanisms [16].

Roselle (Hibiscus sabdariffa) is a popular flowering plant grown worldwide. Hibiscus sabdariffa extracts have been reported to be an immune-stimulating agent in animals and humans [17]. In addition, Hibiscus sabdariffa has been used as a stress relief agent, anti-inflammatory agent, immune-stimulator, antioxidant, and growth promoter in Rainbow trout [18,19], Nile tilapia [20], and Common carp [21]. Red tilapia is a genetically enhanced strain of tilapia that is much preferred over other tilapia hybrids [22,23] because of its rapid growth rate, attractive color, increased marketability, tolerance of high densities, and good flesh quality [24]. Roselle calyces ethanol extract (ER) was tested for its potential health benefits when incorporated into a regular diet at levels of 0, 0.5, 1, and 2% kg⁻¹ diet. The growth efficiency, morphometric assessment of the intestine, haemato-biochemical profile, immune response, oxidative status, and expression of selected growth, immune, Red tilapia genes involved in oxidative stress were determined.

2. Materials and Methods

2.1. Ethical Validation

This study was authorized by the Institutional Aquatic Animal Care and Use Committee of the Faculty of Aquatic and Fisheries Sciences at Kafr El-Sheikh University in Egypt (approval number: IAACUC-KSU-149-2022).

2.2. Roselle Calyx Collection and Chemical Extraction

Roselle calyx samples were collected from a local market and identified as Hibiscus sabdariffa; they were cleaned with fresh tap water before being dried in the shade. Afterward, a mechanical grinder was employed to extract the beneficial compounds from the dried Roselle. Bioactive compounds of H. sabdariffa were extracted following the method of [25]. Specifically, 500 g of air-dried H. sabdariffa samples were soaked in the solvent (1:5, v/v) for 72 h at room temperature (25 °C–30 °C) while the incubator was shaking at 150 rpm. The resulting extract was filtered through Whatman filter paper (6 µm pore size) and then evaporated in a rotary evaporator at 30 °C in a vacuum to produce ethanol alcohol, which was then chilled to 4 °C [8].

2.3. (GC-MS) Analysis of AME Extract

The powdered AME extract (26 mg) was analyzed at Nawah Scientific, Cairo, Egypt, using the GC-MS system (Thermo Scientific, Austin, TX, USA) with a direct capillary column TG–5MS (30 m × 0.25 mm × 0.25 µm film thickness). We maintained a carrier gas flow rate of 1 mL/min with helium. The auto sampler AS1300 paired with GC/MS in the split mode was used to automatically inject 1 µL diluted samples with a solvent delay of 4 min. At ionization, energies of 70 eV, EI mass spectra were acquired in full scan mode spanning the m/z range of 50–650. A temperature of 200 °C was selected for the ion source. Comparing the mass spectra of the components to those in the WILEY 09 and NIST 14 databases allowed for their identification [26].

2.4. Experiment Design

A batch of 180 healthy hybrid red tilapia fries (O. niloticus × O. mossambicus) were acquired from a private fish hatchery in Kafr El-Sheikh, Egypt (4.83 ± 0.04 g, initial weight ±SE). The fish were transported to the aquaculture department’s laboratory at Kafr El-Sheikh University where they were acclimated to temperatures (28.40 ± 0.54 °C) for two weeks while fed the basal diet, as shown in (

Table 1. Chemical composition of the diets.

	ER Dietary Level (%)
	ER0	ER0.5	ER1	ER2
Feed Ingredients (%)
Fish meal (72% CP)	2.5	2.5	2.5	2.5
Soybean meal	41	41	41	41
Yellow corn	19	19	19	19
Wheat middling	12	12	12	12
Rice bran	10	10	10	10
Gluten 60	5	5	5	5
Linseed meal	3.6	3.6	3.6	3.6
Meat meal	4	4	4	4
Choline chloride	0.1	0.1	0.1	0.1
Soya oil	1	1	1	1
Calcium carbonate	0.6	0.6	0.6	0.6
Sod. Bicarbonate	0.1	0.1	0.1	0.1
Lysine	0.5	0.5	0.5	0.5
Methionine	0.3	0.3	0.3	0.3
Vitam. and min. mix.1	0.1	0.1	0.1	0.1
Anti-mycosis	0.1	0.1	0.1	0.1
Vit. C	0.1	0.1	0.1	0.1
Dietary ER (g/kg)	0	0.5	1	2
Proximate composition
Dry matter (%)	88.84	88.65	88.93	89.02
Crude protein (%)	30.87	30.94	30.64	30.20
Ether extract (%)	6.38	6.81	7.58	7.34
Crude fiber (%)	5.18	6.01	5.90	5.67
Ash (%)	6.16	9.28	8.96	9.18
NFE (%)	51.41	46.96	46.92	47.61
Growth energy2 (kcal/kg)	4516.56	4373.36	4427.49	4409.07

Each kilogram contained the following amounts of vitamins and minerals: vitamin A (4.8 IU), vitamin D2 (0.8 IU), vitamin E (4.0 g), vitamin K (0.8 g), vitamin B (0.49), vitamin B2 (1.6 g), vitamin B6 (0.6 g), vitamin B12 (4 mg), folic acid (400 mg), biotin (20 mg), choline chloride (200 mg), copper (4.0 g), iodine (0.4 g), and iron (12 mg). Manga 2 Protein yielded 5.65 Kcal, fat 9.45 Kcal, and carbohydrates 4.22 Kcal per gram when used in the growth energy equation. Nitrogen free extract (NFE) = 100 − (protein + lipid + ash + fiber) [8].

). After the fish had adapted, they were placed in 12 glass aquariums (80 cm × 40 cm × 95 cm) with 15 fish per aquarium and allocated to 4 treatments with each group receiving either 0 (control), 0.5 (ER0.5), 1 (ER1), or 2 (ER2) g kg⁻¹ ER in their base diet.

The feed materials for the test diets were combined in a manual pelleting machine to create pellets of the appropriate diameter for the fish. Feed with ER addition was sprayed with a sprayer while being mixed and then left in a designated room for a day so that the alcohol could evaporate. The fish were fed at a rate of 3% of body weight twice daily (9 a.m. and 2 p.m.) for the first two weeks of the experiment and then at a rate of 2% of body weight from week three until the end of the trial, with feeding rates varied every two weeks based on the biomass of each aquarium. The photoperiod had 12 h of darkness and 12 h of light. The water quality was monitored throughout the experiment and maintained at levels suitable for red tilapia. Dissolved oxygen (6.40 ± 0.12 mg/L), temperature (28.40 ± 0.54 °C), and pH (8.0 ± 0.05) were all measured with a multiparameter probe meter (HI9829-03042-HANNA^® instruments) and expressed as mean ± SE. A handheld colorimeter estimated total ammonia nitrogen at 0.04 ± 0.003 mg/L (Martini MI 405).

2.5. Growth Parameters

After the end of the experimental period, six fish were randomly sampled from each tank (18 fish per treatment) and then anesthetized using tricaine methane sulfonate (MS222) 25 mg/L (Argent Laboratories, Redmond, WA, USA).

Every fish was individually weighed to determine its final body weight. The following equations were used to derive the growth assessment variables:

Body weight gain (BWG) = final body weight (W1) − initial body weight (W0).

Weight gain rate (WG%) = (W1 − W0)/W0 × 100.

Specific growth rate (SGR % /day) =100 × (lnW1 − lnW0)/t.

Feed conversion ratio (FCR) = feed intake (g)/BWG (g).

The formula used to determine the hepato-somatic index (HSI) was 100 × (liver weight/W1). To assess the visceral-somatic index (VSI), we multiplied the viscera weight by the body weight by a factor of 100.

The spleen-somatic index (SSI) was estimated as 100 × (Spleen weight/W1).

Survival rate (SR%) = 100 [final fish count/starting fish count].

In these calculations, t is the length of the experiment in days, W0 is the starting weight in grams, and W1 is the finished weight in grams.

2.6. Morphometric Assessment of Intestine

The intestinal tissues were taken (9 fish/treatment) and placed in 10% neutral-buffered formalin for three days. Afterward, the samples were dehydrated, washed multiple times in absolute alcohol, and finally embedded in paraffin. We used a Leica RM 2145 rotary microtome (Leica Microsystems, Wetzlar, Germany) to obtain 5 μm longitudinal slices, which were then mounted on glass slides and stained with hematoxylin and eosin (H&E) [27].

A Leica microscope adapted with a Leica camera was used. We took 15 images and measured 20 villi for each image. Image J analysis software was used for the histomorphometric study (National Institutes of Health, Bethesda, MD, USA). Image J analysis software was used to quantify the villus height (from the villus tip to the villus-crypt junction) and villus breadth (from the villus midpoint). The number of goblet cells divided by total area yielded the density of goblet cells (mm²) [28].

2.7. Blood Sampling

Blood was collected from the caudal vein of 6 fish in each tank using EDTA anticoagulant coated syringes (Nipro 27 gauge × 11/2-inch needle). The collected blood serum was centrifuged at 300 rpm for 15 min at 4 °C in plain tubes free of anticoagulants. The serum was stored at −20 °C until needed [29].

2.8. Haemato-Biochemical Analyses

The blood was assessed using an automatic blood cell counter [30]. Total proteins were assessed following [31], and serum albumins following [32] at wavelengths of 540 nm and 550 nm, respectively. Colorimetric analysis at 540 nm measured alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activity, respectively [33]. The calorimetric method was used to quantify creatinine in the serum [34]. In addition, urea estimation was performed following [35]. The GPO-PAP and CHOD-PAP commercial clinical kit methods were used to measure serum triglycerides and total cholesterol, according to the manufacturer’s instructions [36]. Glucose enzymatic PAP kits were purchased from Bio-Merieux, France, and were used to measure glucose concentration following Trinder [33]. Lipase and amylase activity were tested following the protocols outlined in [37].

2.9. Immune and Oxidative Stress Activities

Superoxide dismutase (SOD) and catalase (CAT) activities were measured at 450 nm using an ELISA kit (Inova Biotechnology, China) according to the manufacturer’s procedures [38]. Prepared whole blood smears were examined for phagocytic activity and phagocytic index as specified in [39]. The phagocytic activity (PA) and index (PI) were assessed as PA = macrophages containing yeast/total number of macrophages ×100. PI = the number of cells phagocytized/number of phagocytic cells. Serum lysozyme activity was assessed following [40] utilizing a microplate ELISA reader at 450 nm.

2.10. Total Carotene Measurement

The carotenoids were extracted using Torissen and Naevdal’s techniques [41]. First, 300 mg samples of fish skin and muscle were weighed, added to a test tube, and individually homogenized well. The extraction was performed with acetone and anhydrous sodium sulfate. Equal parts of anhydrous sodium sulfate were added to the homogenized samples. The carotenoids were extracted in 25 mL of acetone at 4 °C for three days in the dark. The samples were homogenized and centrifuged for five minutes at 5000 rpm. The extract absorbance was measured at 480 nm in a UV-VIS Spectrophotometer. The computational formula used to calculate total carotene content (TCC) was: TCC (μg·g⁻¹) = A. λ = 480 × K × V/(E × G), where A λ = 480 nm is the absorbance value at λ = 480 nm, G is the sample mass (g), K is a constant (104), V is the volume of the extracting solution (mL), and E is the coefficient (1900).

2.11. QRT-PCR

Following the manufacturer’s protocol, total RNA was extracted using the TRIzol reagent (Life Technologies, Gaithersburg, MD, USA). cDNA was synthesized immediately with a MultiScribe RT enzyme kit (Applied Biosystems, Foster City, CA, USA). The resultant cDNA was run using real-time PCR in triplicate. Power SYBR Green PCR Master Mix (Applied Biosystems, Life Technologies, CA, USA) was used in a 7500 real-time PCR system for PCR amplification (Applied Biosystems, Foster City, CA, USA). Compared with the control, gene mRNA fold changes were assessed. β-actin, a housekeeping gene, was utilized to standardize gene mRNA fold changes using the 2^−∆∆Ct method [42]. The gene accession numbers and primer sequences are listed in

Table 2. Gene primer used for qRT-PCR amplification.

No.	Gene	Primer Sequence (5’-3’)	Accession Number	Reference
1	β-actin	F: CCACACAGTGCCCATCTACGA R: CCACGCTCTGTCAGGATCTTCA	XM_003455949.2	[43]
2	FAS	F: TGAAACTGAAGCCTTGTGTGCC R: TCCCTGTGAGCGGAGGTGATTA	GU433188	[44]
3	LPL	F: TGCTAATGTGATTGTGGTGGAC R: GCTGATTTTGTGGTTGGTAAGG	FJ623077	[44]
4	MSTN	F: GCATCTGTCTCAGATCGTGCT R: TGCCATCATTACAATTGTCTCCG	XM_003458832	[45]
5	IGF-1	F: TCCTGTAGCCACACCCTCTC R: ACAGCTTTGGAAGCAGCACT	XM_00344805	[46]
6	GHR-1	F: CAGACTTCTACGCTCAGGTC R: CTGGATTCTGAGTTGCTGTC	AY973232.1	[47]
7	SOD	F: CCACGCTCTGTCAGGATCTTCA R: CATGCCTTCGGAGACAACAC	AY491056.1	[48]
8	TNF-α	F: ACCTTCTCGTGGATCACCAT R: GGAAGCAGCTCCACTCTGATGA	JF957373.1	[49]
9	HSP-70	F: CATCGCCTACGGTCTGGACAA R: TGCCGTCTTCAATGGTCAGGAT	FJ207463.1	[49]

FAS, fatty acid synthase. LPL, lipoprotein lipase. MSTN, myostatin. IGF-1, insulin growth factor -1. GHR-1, growth hormone receptor-1. SOD, superoxide dismutase. TNF-α, tumor necrosis factor-alpha. HSP-70, heat shock protein-70.

. (see the Figure S1: RNA transcription levels of candidate reference genes (absolute Cq values) representing the abundance of studied genes in four-time running).

2.12. Statistical Analysis

GraphPad Prism 6.01 was used for statistical analyses after assessing the data for normality and homogeneity. A one-way analysis of variance (ANOVA) was performed followed by Tukey’s post hoc test for significant differences between the tested groups. Total carotene data were also analyzed using a T-test for comparison. When the p-value < 0.05, differences were considered statistically significant. Data are presented as the mean ± SE. p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****) [8,50].

3. Results

3.1. The GCMs Analysis of Roselle Ethyl Extract

Ethanolic roselle extract showed a total of 69 peaks, with approximately ten major phytochemical components identified by molecular formula, peak number, compound name after derivatization, retention time (min), molecular weight (m/z), peak area (%), and chemical structure (

Table 3. GC-MS-MS profile of Roselle ethyl extract.

n.	Post-Derivatization Component Naming	Molecular Formula	Rt (min)	Molecular Weight (m/z)	Peak Area (%)	Prior to Derivatization Compound Name
1	Cyclopentane carboxylic acid, 2-oxo-, ethyl ester	C8H12O3	6.91	156	21.82	Cyclopentane carboxylic acids
2	Hexadecanoic acid, ethyl ester	C18H36O2	21.72	284	18.35	Ethyl palmitate
3	9,12-Octadecadienoic acid (Z,Z)-	C18H32O2	24.35	280	16.51	Linoleic acid
4	9,12-Octadecadienoic acid, ethyl ester	C20H36O2	24.26	308	14.10	Linolelaidic acid
5	Cyclohexane carboxylic acid, 2-ethylcyclohexyl ester	C15H26O2	8.60	238	11.83	Cyclohexane carboxylic acid
6	2-(2,4-difluorophenyl)-1,3-bis(1,2,4-triazol-1-yl)propan-2-ol	C13H12F2N6O	16.84	306	4.93	Fluconazole
7	Butanedioic acid, 3-hydroxy-2,2-dimethyl-, diethyl ester	C10H18O5	16.84	218	4.93	Succinic acid
8	9,12-Octadecadienoyl chloride, (Z,Z)-	C18H31ClO	23.35	298	3.06	Linoleic acid chloride
9	4,6-O-Ethylidene-D-glucopyranose	C8H14O6	17.87	206.19	0.97	Glycopyranoside
10	8-Benzoyloxy quinoline	C16H11NO2	17.87	249	0.97	Benzoxyquinone

). Figure 1 shows a typical chromatogram of ER. The significant compounds included cyclopentane carboxylic acids (21.82%), ethyl palmitate (18.35%), linoleic acid (16.51%), linolelaidic acid (14.1%) and cyclohexane carboxylic acid (11.83%). These compounds belong to many chemical classes, and the majority of them have been documented to have critical biological functions in humans and a variety of animals.

3.2. Growth Parameters

In terms of growth performance (final weight, weight gain, SGR, and weight gain rate), there were no statistically significant differences (p > 0.05) between the experimental groups receiving 0.5 and 1% ER, compared with the control group (

Table 4. Growth parameters and survival of Red tilapia fed various dietary levels of ER.

Parameters	ER Dietary Level (%)				p-Value
	ER0	ER0.5	ER1	ER2
Initial weight (g)	4.850 ± 0.017	4.817 ± 0.049	4.783 ± 0.083	4.883 ± 0.017	0.556
Final weight (g)	33.67 ± 0.333 a	33.67 ± 0.333 a	34.67 ± 0.166 a	31.20 ± 0.057 b	<0.0001
Weight gain (g)	28.82 ± 0.317 a	28.85 ± 0.356 a	29.88 ± 0.249 a	26.32 ± 0.055 b	<0.0001
Weight gain rate (%)	594.1 ± 4.631 a	599.2 ± 11.96 a	625.3 ± 16.35 a	538.9 ± 2.289 b	0.002
SGR (%/day)	3.229 ± 0.011 a	3.241 ± 0.028 a	3.302 ± 0.037 a	3.091 ± 0.005 b	0.001
FCR	1.430 ± 0.022 a	1.286 ± 0.014 b	1.156 ± 0.001 c	1.330 ± 0.002 b	<0.0001
HSI (%)	2.579 ± 0.253 a,b	2.406 ± 0.024 a,b	1.817 ± 0.008 b	2.798 ± 0.244 a	0.022
VSI (%)	2.487 ± 0.2150	2.704 ± 0.02704	2.654 ± 0.02515	2.788 ± 0.1882	0.540
SSI (%)	0.584 ± 0.017	0.484 ± 0.052	0.458 ± 0.077	0.371 ± 0.038	0.100
Survival (%)	95.56 ± 2.222	100.0 ± 0.000	100.0 ± 0.000	100.0 ± 0.000	0.051

Data are presented as mean ± SE. p values of one-way ANOVA followed Tukey’s post hoc test for significant differences. The means that share no superscripts ^(a,b,c) within each row are significantly different at p < 0.05. SGR: specific growth rate, FCR: feed conversion ratio, HSI: hepato-somatic index, VSI: visceral-somatic index, SSI: spleen-somatic index.

), while fish fed 2% ER in the diet showed a significant decrease (p < 0.05) in the final weight, weight gain, SGR, and weight gain rate, compared with the non-enriched control group. However, supplementation of 0.5, 1, and 2% roselle extract to the fish basal diets significantly decreased FCR compared with the non-supplied control. The somatic index parameters (HIS, VSI, and SSI) and survival recorded non-significant differences (p > 0.05) between all Roselle groups matched to the non-enriched control group.

3.3. Whole Intestinal Morphometry

Table 5. Analysis of the intestinal morphology of Red tilapia exposed to varying levels of ER in their diets.

Intestinal Segment	Variable	ER Dietary Level (%)				p Values
		ER0	ER0.5	ER1	ER2
Anterior part	Villi length (μm)	153.2 ± 14.110 b	205.2 ± 17.140 b	531.3 ± 16.550 a	471.4 ± 18.940 a	<0.0001
	Villi width (μm)	92.28 ± 5.640	79.61 ± 5.978	76.64 ± 5.947	80.19 ± 10.110	0.469
	Goblet cell (no/mm2)	20.67 ± 1.453 b	27.67 ± 2.404 a,b	33.00 ± 1.732 a	28.33 ± 0.881 a,b	0.006
Middle part	Villi length (μm)	319.20 ± 11.10 d	464.0 ± 29.860 c	815.9 ± 32.250 a	683.0 ± 14.260 b	<0.0001
	Villi width (μm)	64.22 ± 4.772	69.96 ± 7.694	83.16 ± 6.252	77.69 ± 6.020	0.229
	Goblet cell (no/mm2)	30.00 ± 1.732 c	36.00 ± 1.155 b,c	51.33 ± 4.631 a	48.33 ± 2.028 a,b	0.001
Terminal part	Villi length (μm)	79.63 ± 0.910 c	123.2 ± 4.300 c	380.3 ± 24.180 a	290.3 ± 16.920 b	<0.0001
	Villi width (μm)	120.6 ± 10.520	104.7 ± 6.425	132.6 ± 25.440	123.5 ± 20.880	0.731
	Goblet cell (no/mm2)	8.0 ± 0.577 b	12.33 ± 1.856 b	20.33 ± 1.453 a	23.33 ± 1.453 a	0.0002

Data are presented as mean ± SE. p values of one-way ANOVA followed by Tukey’s post hoc test for significant differences. Means within each row that do not have common superscripts ^(a,b,c) differ significantly at p < 0.05.

and Figure 2 show the intestinal morphometry of red tilapia that were fed experimental diets for 60 days. The length of intestinal villi in all three intestine segments was altered in the extract groups compared with the control group after dietary supplementation with Roselle extract (p < 0.05). The maximum length of intestinal villi was significantly increased (p < 0.05) in 1% ER in the three intestinal regions, compared with ER0. However, when comparing the experimental groups to the non-enriched control group, there was no difference in the diameter of the intestinal villi throughout the various intestinal portions. The number of goblet cells in the anterior and middle intestines of fish fed ER1, and ER2 increased significantly (p < 0.05), compared with the control group. Goblet cell proliferation in the terminal region was most significant in the ER2 group (p < 0.05) relative to the control group. When compared with the control group, ER0.5 did not significantly alter (p > 0.05) any of the measurable characteristics of the intestine (villi length, villi width, or goblet cells) outside of villi length in the middle part, where it was considerably increased (p < 0.05).

3.4. Blood and Biochemical Parameters

Dietary supplementation of red tilapia with roselle extract did not significantly affect any measured blood parameter (p > 0.05;

Table 6. Haemato-biochemical profile of Red tilapia fed different dietary levels of ER.

	ER Dietary Level (%)				p-Value
	ER0	ER0.5	ER1	ER2
PCV (%)	24.05 ± 0.548	25.45 ± 2.916	23.90 ± 1.790	22.20 ± 0.923	0.661
RBCs (×10/mm3)	1.985 ± 0.049	1.975 ± 0.089	1.975 ± 0.089	1.850 ± 0.028	0.500
Hb (g/100 mL)	8.450 ± 0.028	9.550 ± 0.894	8.750 ± 0.375	8.650 ± 0.028	0.445
TP (g/dL)	6.350 ± 0.721 a	7.450 ± 0.548 a	2.900 ± 0.115 b	2.650 ± 0.490 b	0.0003
Albumin (g/dL)	3.650 ± 0.664 a	3.200 ± 0.808 a,b	1.500 ± 0.173 a,b	0.850 ± 0.028 b	0.016
ALT (U/L)	87.50 ± 7.217 a	13.50 ± 0.866 b	29.50 ± 1.443 b	75.00 ± 14.430 a	0.0005
AST (U/L)	283.0 ± 52.540 a,b	73.00 ± 9.815 c	186.0 ± 8.083 b,c	389.0 ± 69.860 a	0.005
Creatinine (mg/dL)	0.320 ± 0.103 b	0.110 ± 0.017 b	0.400 ± 0.057 b	2.150 ± 0.606 a	0.005
Urea (mg/dL)	21.50 ± 0.866 a	9.200 ± 0.173 b	15.40 ± 3.522 a,b	22.85 ± 2.800 a	0.010
Cholesterol (mg/dL)	279.5 ± 86.310 a	53.50 ± 4.907 b	110.0 ± 5.774 a,b	255.0 ± 2.887 a	0.015
Triglycerides (mg/dL)	127.0 ± 9.815	217.0 ± 1.732	259.0 ± 99.880	347.5 ± 153.9	0.443
Glucose (mg/dL)	83.50 ± 26.850	88.00 ± 36.950	44.00 ± 6.928	33.50 ± 2.598	0.307
Amylase (U/L)	41.60 ± 4.850 b	82.05 ± 2.281 a	72.00 ± 4.041 a	24.45 ± 4.705 b	<0.0001
Lipase (U/L)	91.00 ± 2.887 a	118.0 ± 12.120 a	89.00 ± 0.577 a	38.00 ± 4.041 b	0.0002

Data are presented as mean ± SE. p values of one-way ANOVA followed by Tukey’s post hoc test for significant differences. Means within each row without shared superscripts ^(a,b,c) are significantly different at p < 0.05.

). The highest PVC % and Hb level were recorded in ER0.5 compared with the control group. Given various concentrations of an ethanolic roselle extract for 60 days, red tilapia had biochemical indices within normal limits (Table 6). All the evaluated parameters except for triglycerides and glucose were significantly different (p < 0.05) when ER was added to the diet of red tilapia. Fish fed 0.5% ER had the highest TP, albumin, amylase, lipase, and glucose levels and the lowest levels of ALT, AST, cholesterol, creatinine, and urea.

3.5. Immune Assay

Compared with the control group, phagocytic and lysozyme activity were considerably greater (p ˂ 0.05) in ER0.5-fed fish (

Table 7. The immune response of Red tilapia fed different dietary levels of ER.

	ER Dietary Level (%)				p-Value
	ER0	ER0.5	ER1	ER2
Phagocytic activity (μg Ml−1)	5.500 ± 0.692 b	12.05 ± 0.490 a	10.95 ± 0.317 a	10.65 ± 0.721 a	0.0002
Phagocytic index	1.040 ± 0.034	1.315 ± 0.164	1.200 ± 0.000	1.010 ± 0.063	0.131
Lysozyme activity (μg mL−1)	0.985 ± 0.002 b	1.015 ± 0.002 a	0.880 ± 0.005 c	0.550 ± 0.005 d	<0.0001
WBCs (×103/mm3)	43.10 ± 1.042	46.71 ± 6.521	39.40 ± 2.930	35.95 ± 1.299	0.264
Neutrophils (%)	1.800 ± 0.057 a	0.850 ± 0.086 b	1.250 ± 0.202 b	1.000 ± 0.000 b	0.001
Lymphocytes (%)	91.65 ± 0.433 b	93.55 ± 0.144 a	92.95 ± 0.375 a,b	92.70 ± 0.173 a,b	0.014
Monocytes (%)	6.450 ± 0.317	5.600 ± 0.057	5.800 ± 0.173	6.300 ± 0.173	0.053

Data are presented as mean ± SE. p values of one-way ANOVA followed by Tukey’s post hoc test for significant differences. Means within each row without shared superscripts ^(a,b,c) are significantly different at p < 0.05.

). The ER1 and ER2 groups had higher phagocytic activity than ER0, and the difference was statistically significant (p ˂ 0.05). However, there were no statistically significant differences (p > 0.05) between the groups for the phagocytic index and the white blood cell count, with the 0.5% ER group showing the highest activity levels. Both neutrophils and monocytes were reduced in fish given 0.5, 1, and 2% ER compared with the control group. While fish fed 0.5% ER had considerably more lymphocytes than the non-enriched controls, the difference was insignificant (p > 0.05).

3.6. Activity of Antioxidant Enzymes

Figure 3 shows the outcomes of testing the antioxidant enzyme activity of Red tilapia fish serum, which included the enzymes SOD and CAT. Fish fed ER0.5 and ER1 had considerably increased SOD and CAT activity compared with control basal-fed fish (p < 0.05). Fish fed a diet consisting of 1% ER showed the most activity.

3.7. Total Carotene Measurement

Figure 4 shows that considerably higher (p < 0.001) skin total carotene was detected in the fish fed with 0.5% ER compared with the control group. The total carotene levels in the muscles, on the other hand, did not differ significantly across the different treatment groups.

3.8. Time-Series Expression of Studied Genes in Response to Roselle Extract

Roselle extract-enriched diets significantly altered the expression of IGF-1, GHr, and MSTN genes, as shown by the analysis of relative mRNA expression of growth-related genes (Figure 5). Increases in IGF-1 and GHr gene expression in the kidney were shown to be caused by dietary enrichment with ER0.5 (p < 0.01), ER1 (p < 0.001), and ER2 (p < 0.001), with the most significant increase in expression seen in fish consuming a basal diet supplemented with 1% ER. There was a 1.2- and 0.9-fold increase for IGF-1 and GHr genes, respectively, compared with the non-enriched control diets. Interestingly, enrichment with Roselle extract did not upregulate the expression levels of the MSTN gene, compared with the non-enriched control diets, and ER1 induced a significant (p < 0.05) downregulation of expression (0.2-fold decrease).

The analysis of immune and antioxidant-related genes expression revealed a significant up-regulatory effect of enrichment with 1% ER (p < 0.01) and 2% ER (p < 0.05) (a 0.5- and 0.3-fold increase, respectively) on expression levels of the SOD gene in the kidney of red tilapia, as shown in Figure 6. Moreover, supplementation of ER1 to the fish basal diets induced a 0.1-fold rise in the expression levels of the TNF-α gene in comparison with the non-supplied control groups, whereas enrichment with 1 and 2% Roselle extract considerably decreased (p < 0.05) the expression levels of the HSP70 gene (0.4- and 0.3-fold decrease), respectively, compared with the basal diet.

Lipogenesis-related gene (LPL and FAS) relative mRNA expression analysis showed a striking difference in diets supplemented with Roselle extract (Figure 7). With enrichment of the fish basal diets with ER0.5 (p < 0.05), ER1 (p < 0.001), and ER2 (p < 0.01), the expression levels of the LPL gene in the kidney were significantly increased by 0.3-fold, 0.8-fold, and 0.4-fold, respectively, in comparison with the non-supplied control groups. In contrast, enrichment of fish-fed basal diets with ER0.5 (p < 0.01), ER1 (p < 0.001), and ER2 (p < 0.05) significantly down-regulated the expression level of the FAS gene (by 0.2-fold, 0.3-fold, and 0.1-fold, respectively) compared with the non-enriched control groups.

4. Discussion

Using medicinal herbs in aquaculture is one of the most exciting methods [51] because these dietary feed additives, mainly herbal extracts, can potentially enhance growth performance, blood health and immunity in marine and freshwater fish [52]. Several studies have examined how adding plant extracts to farmed fish staple diets affects productivity. Still, the authors of this study were particularly interested to learn more about the response of feeding ethyl extract of roselle calyces to Red tilapia. The growth performance measures and somatic parameters of red tilapia all improved marginally after the ethyl roselle extract dietary inclusion. The ER1 group had an excellent feed conversion ratio, SGR, SGR, and ultimate body weight. Additionally, ER2 generated the highest levels of HSI and VSI, but all ER-enriched meals resulted in lower levels of SSI activity relative to the ER0 control.

The results are consistent with earlier research showing that the inclusion of roselle spp. in the fish feed had no influence on growth rates. The authors of [18] found that nutritional supplementation with 0.5, 1, and 1.5% Roselle calyx (H. sabdariffa) for eight weeks had a non-significant effect on Rainbow trout (O. mykiss) growth performance parameters. Comparable data were recorded in broiler chickens [53]. Moreover, Roselle had no significant effect on somatic index parameters in sharp tooth catfish (C. gariepinus), according to [54], indicating that Roselle did not induce any organ abnormalities in the fish, and our results agree with these findings. The positive findings for growth performance parameters could be attributed to the presence of polyphenolic bioactive substances such as cyclohexane carboxylic acid, fluconazole, glycopyranoside, and benzoxyquinone that were validated by the present study’s GC-MS profile at the measured values of 11.83%, 4.93%, 0.97%, and 0.97% respectively. Fish metabolism has been observed to be improved by these bioactive substances, resulting in improved health and growth [55]. Furthermore [56], reported that fluconazole (C13H12F2N6O) could significantly increase the hepatosomatic index (HSI).

Polyphenols have the opposite effect, dose-dependently reducing body weight and feeding efficiency by inhibiting digestive enzyme secretion, increasing protein secretion, and decreasing protein and amino acid digestibility. This is because polyphenols are probably too hydrophilic to penetrate the gut wall by passive diffusion [57], and our results agree with these findings. Similarly, the anti-nutritional effects of high doses of polyphenol-rich macroalgae extract hampered growth performance and nutrient utilization efficiency [58]. On the other hand, [59] reported significant rises in growth markers (final weight, specific rate, weight gain, and relative growth rate) in C. gariepinus fed Roselle-supplemented diets compared with controls. After an eight-week trial period, goldfish fed Roselle extract significantly improved their growth rate and feed efficiency [60]. These different findings could be attributed to using various sources of Roselle spp. with differing chemical compositions, and other fish species [61].

The fish’s vital digestive organ is the intestine which plays a crucial function in maintaining its health. Digestion and absorption in fish are directly affected by factors such as villi height, villi width, and goblet cell density [62]. In addition, goblet cells produce mucus to shield the mucosal barrier from dehydration, injury, and dangerous bacteria in the gastrointestinal tract [63]. Feed utilization is enhanced by a healthy intestinal morphometric structure, significantly predicting fish health [64]. This study’s histomorphometric assessment of intestinal villi absorptive capacity demonstrated an increase in villi length, width, and goblet cell populations in fish fed 0.5, 1, and 2% ER, with the highest results in fish provided 1% ER. These results matched the fish performance research. Likewise [53], roselle (H. sabdariffa) extract improved broiler chicken intestinal histomorphology (100 mg kg⁻¹). Roselle lowers blood pressure, prevents cancer, and improves digestion [65]. Roselle extract’s polyphenolic content improves gut architecture and nutritional absorption in monogastric animals [66]. Hematological indicators show how nutritional therapies affect the animal’s feed consumption, quality, and availability to meet biochemical, physiological, and metabolic needs [20]. Dietary inclusion of ethyl roselle extract stimulated non-significant improvements in PCV and Hb in fish fed with 5 g kg⁻¹, compared with the control diet, illustrating the capacity of ER to promote health status [67] and the immune response of fish [68].

The results obtained here were comparable with [69], who reported no significant changes in red blood cell indices (mean corpuscular volume, mean corpuscular hemoglobin concentration, and mean corpuscular hemoglobin) of C. gariepinus juveniles fed varying inclusion levels of Roselle (H. sabdariffa) and ginger (z. officinale) as feed additives. Dietary Roselle extract did not influence hematological parameters [53]. Similar findings were recorded in birds [70] and broiler chickens [71]. However, Roselle prompted a significant increase in PCV, RBCs, and Hb in Nile tilapia (O. niloticus) [20], Rainbow trout (O. mykiss) [18,60], and albino rats [72]. Furthermore, the nutritional and health status of fish can be determined by analyzing their blood biochemistry [72]. The measured biochemical parameters (TP, albumin, ALT, AST, cholesterol, triglycerides, urea, and glucose) were around the normal values for Red tilapia [73], especially when the basal fish diet was supplemented with 5 g kg⁻¹ roselle extract.

A diet with Roselle extract had no significant effects on Rainbow trout’s total protein or albumin [18]. According to [74], H. sabdariffa calyx extract did not affect broiler chicken ALT, glucose, or AST. In African sharp tooth catfish (C. gariepinus), a high (4%) dietary Roselle supplementation significantly increased ALT and ALP circulating levels [75]. These results may be due to the presence of Linoleic acid (peak area % = 16.51%) in ER that was reported to influence several enzymatic activities involved in intermediary liver metabolism [76]. Fluconazole (peak area % = 4.93%) may also be responsible for the significant alterations in AST, ALT, and albumin [56].

Roselle extract was found to act against liver disease, atherosclerosis, and other metabolic syndromes based on lipid profile results [77] and lipid metabolism efficiency [78]. According to cholesterol and triglyceride levels studies, Roselle extract has been shown to have anti-liver disease and anti-atherosclerosis effects as well as effects against other metabolic syndromes [53]. These effects could be due to phenolic acids such as cyclopentane carboxylic acids (21.82%) that have been reported to play essential roles in the secretion of bile and the reduction of lipids and cholesterol levels [79]. Additionally, the maintenance of serum urea and creatinine levels demonstrates that the addition of dietary roselle extract, particularly ER0.5, did not have any adverse effects on the kidney of the animals [80,81]. The results for digestive enzymes (amylase and lipase) in ethyl Roselle extract enriched meals, notably, ER0.5, suggest a similar significance for ER in nutrient digestion and the nutritional state of the intestine in aquatic animals [82,83].

These findings demonstrate that similar to litopenaeus vannamei, succinic acid (peak area % = 4.93%) increased amylase and lipase activity in the hepatopancreas of Red tilapia at higher dosages [76]. The hematological and biochemical results indicate that ER had no harmful effects on fish health [20], at the ER0.5 level in particular. Phagocytic activity, phagocytic index, lysozyme activity, and white blood cell (WBC) count are common ways to evaluate a fish’s immune response [84]. Higher lysozyme activity, phagocytic activity, and white blood cell (WBC) count in fish fed 5 g kg⁻¹ ER compared with fish fed a control diet suggested an improvement in fish immune capabilities [85]. Consistent results were also seen by [20]. Bioactive substances may contribute to ER’s potent immunostimulant characteristics. These include phenolics such as cyclopentane carboxylic acids, (peak area % = 21.82%) [86], succinic acid (peak area % = 4.93%) [76], and fluconazole (peak area % = 4.93%) [56], which made up the bulk of the GC-MS experiments here. These findings corroborate the results of [18], who did not detect any discernible shifts in the percentages of white blood cells, lymphocytes, or monocytes in Rainbow trout (O. mykiss). High doses of H. sabdariffa Roselle extract, rich in the antioxidant anthocyanins, considerably increased lysozyme levels in the blood [53]. A combination of yogurt as a probiotic food with 4% Roselle (H. sabdariffa) extract has been shown to enhance the number of phagocytic macrophages in the body [87].

Fish fed ER had more significant increases in SOD and CAT compared with fish that were fed a control diet, suggesting that ER helps maintain high antioxidant levels in the body [8]. Comparable results were observed by [60], who reported that dietary Roselle at 0.5% significantly improved hepatic antioxidant parameters (SOD and CAT enzymes) in Rainbow trout (O. mykiss). It has also been shown that oral Roselle administration mitigates oxidative stress and improves antioxidant capacities in rats and pigs [88,89]. Comparable results were recorded in broiler chickens [53] and Common carp (C. carpio) [60,90]. There is a possibility that the antibacterial and antioxidant properties shown here are due to the presence of polyphenols and soluble polysaccharides [91]. Hemolysis that is induced by oxidative damage to red blood cells is a symptom of an impaired antioxidant defense system [92]. Because of this, the fish’s development and immune power are stunted. Thus, feed additives with antioxidant and anti-stress qualities help enhance fish health and growth.

Protecting cells from oxidative damage, carotenoids are a non-enzymatic part of the antioxidant system [93]. Furthermore, carotenoids may play a role in skin pigmentation and in other tissues [94]. Carotenoids are essential for fish health, but fish cannot make them themselves [95]. In the current study, total carotene levels in the skin of Red tilapia were shown to increase significantly by more than 1.5 μg/g in fish fed with 0.5% ER. Fish fed at a rate of 0.5% ER had a modest increase in total carotene content in their muscles but a decrease was observed in ER2. Total carotenoid was increased by 26.10% when Roselle plants were inoculated with a bio-fertilizer [96].

In terms of total carotene, including -carotene, -cryptoxanthin, -carotene, lycopene, lutein, and zeaxanthin, roselle is rich source [97]. However, higher concentrations of ER (as in ER1 and ER2) have been shown to reduce the bioavailability and absorption of carotenoids, which may explain why some populations have lower total carotene activity [98,99]. Moreover, ref. [100] argued that fat-soluble substances diminish carotenoids’ bioavailability and that interactions between carotenoids may have a similar effect. The expression of specific immunological, antioxidant, and growth-related genes in Red tilapia was characterized and measured using qPCR assays.

Important growth indicators such as growth hormone receptors, insulin-like growth factor-1, and muscle-specific tyrosine kinase n are influenced by fish feeding [8,101]. Supplementing the diet with ER increased GHr and IGF-1 expression while decreasing MSTN expression. Ethyl Roselle extracts generated more significant increases in the expression of GHr and IGF-1 genes at higher dosages (ER1 and ER2) than at lower doses (ER0.5). At the same time, ER1 showed the lowest expression levels of the MSTN gene. These results are consistent with those seen in [8], which demonstrated that feeding Nile tilapia on Ulva fasciata methyl extract for 90 days at 50 mg kg⁻¹, 100 mg kg⁻¹, and 150 mg kg⁻¹ resulted in upregulated expression of GH and IGF-1. The authors of [102] reported lower expression of the MSTN gene. Skeletal muscle telomerase mRNA (MSTN) is a highly conserved, destructive regulator of skeletal muscle growth across vertebrate species. This suggests an essential role for MSTN in regulating growth and muscle development [103,104]. Different possible reasons may be ascribed to these findings. Firstly, linoleic acid (Peak area% = 16.51%) [76] promotes fish growth via increased food consumption [105,106]. Secondly, polyphenols such as cyclohexane carboxylic acid, fluconazole, glycopyranoside, and benzoxyquinone can cause adverse metabolic effects at higher doses, including increased protein secretion, inhibition of digestive enzyme secretion, and decreased protein and amino acid digestibility [107,108]. Finally, the long-chain fatty acids ethyl palmitate (18.35%) and linolelaidic acid (14.1%) are beneficial in many ways, especially to human development and growth [109].

There is a correlation between the levels of TNF-α, HSP70, and SOD gene expression and the health of the immune system [110,111], physiological status [112,113], and oxidative status [114] of fish. Gene expression levels for HSP70 and the proinflammatory cytokine tumor necrosis factor-alpha (TNF-α) were downregulated in the ER groups compared with the control fish group. At the same time, those for superoxide dismutase were upregulated. These findings mirror those of [115]. They found that a meal high in beta-carotene and phycocyanin derived from Spirulina platensis reduced HSP70 gene expression in Nile tilapia (Oreochromis niloticus). These researchers also found remarkably similar outcomes [115]. In addition, there was no difference between 0.5ER, 1ER, and 1.5ER treatments and the control treatment regarding TNF-α gene expression in the liver [18]. In addition, 1% of G. gracilis powder added to feed revealed a moderate rise in SOD gene expression [116]. Roselle’s phenolic compounds, which give the plant its antioxidant, anti-inflammatory, and immune-stimulatory effects, may be to blame [79], and polyphenolic contents can cause oxidative stress and induce inflammation [117]. Furthermore, fluconazole (peak area % = 4.93%) is reportedly more active. It has a decisive modulatory role in fish, especially in the secretion of the inflammatory cytokine TNF-α, as demonstrated by [118]. Moreover, 0.50% (w/w) of succinic acid in the diet was the best dosage for increasing SOD gene expression [76]. The primary component, succinic acid, was reported in our investigation (peak area % = 4.93%).

Inhibiting fatty acid synthase (FAS) decreases lipid accumulation while being an essential enzyme in creating long-chain fatty acids [119,120]. Moreover, lipoprotein lipase (LPL) is the critical enzyme for lipid storage and metabolism [121]. Fatty acid synthase (FAS) expression was lower, and lipoprotein lipase (LPL) expression was higher in the adipose tissue of Roselle-supplemented fish compared with control fish. This suggests that FAS and LPL work together to raise circulating fatty acid levels [122] and that ER acts as an inhibitor of lipogenesis. Enhanced LPL activity also promotes the conversion of circulating triglycerides into free fatty acids, which are then taken up by cells in the liver and skeletal muscle [123].

Furthermore, our results were consistent with [124], who discovered that feeding Nile tilapia (Oreochromis niloticus) clenbuterol resulted in increased lipolysis by upregulating the gene encoding lipoprotein lipase (LPL). Atlantic salmon have shown the same patterns [125], as well as Turbot [126], and Rainbow trout [127]. In addition, our findings were consistent with [123], who noted that elevated GHr expression corresponds to high GH activity, which promotes lipolysis via increased hepatic LPL expression and enhanced triglyceride absorption. Roselle extracts such as ethyl palmitate, linoleic acid, linolenic acid, and linoleic acid chloride were found to alter the levels of n-6 and n-3 polyunsaturated fatty acids in the diets of female silver pomfret (P. argenteus) breeding stock, leading to lower tissue FAS and higher LPL activities and mRNA expression levels [128]. Hepatic FAS activities and mRNA expression levels were significantly attenuated by high dietary n-3 LC-PUFAs levels, whereas LPL activities and mRNA expression levels were dramatically elevated [129]. Upregulation of the FAS gene and downregulation of LPL gene expression have been linked to increased n-6 PUFA levels, which can have detrimental effects on various cellular functions [130,131].

Consequently, this explains why 20 g kg⁻¹ ER exhibited distinct actions. Other researchers also found remarkably similar outcomes [132,133]. Significant elevation of FAS expression was seen in the 100% soybean oil group, suggesting that high dietary n-6 PUFA levels upregulated FAS in Turbot [126]. More research is needed to determine the effect of ER as an immunomodulator in the diet of Red tilapia challenged with bacterial infections. More studies are required to confirm the many roles and significance of ER in Red tilapia.

5. Conclusions and Prospects

In summary, the findings of this work demonstrate that dietary enrichment of ER at 0.5 and 1% concentrations could improve the growth, intestine histomorphology, haemato-biochemical performances, immune-oxidative index, and total carotene content of Red tilapia skin; furthermore, improvements were observed in terms of gene expression. Therefore, ER can be combined with conventional Red tilapia feed to improve fish health, welfare, and color.