Next Article in Journal
Predicting Sex-Related Transcripts in the Chinese Giant Salamander (Andrias davidianus): A Transcriptomics Study, Selection Gender for Preservation, Breeding and Reintroduction
Next Article in Special Issue
Application of a Lipopolysaccharide (LPS)-Stimulated Mitogenesis Assay in Smallmouth Bass (Micropterus dolomieu) to Augment Wild Fish Health Studies
Previous Article in Journal
Aqua-Ento-Ponics: Effect of Insect Meal on the Development of Sea Bass, Dicentrarchus labrax, in Co-Culture with Lettuce
Previous Article in Special Issue
Development of an Immunoassay Detection System for Koi Herpesvirus Using Recombinant Single-Chain Variable Fragments
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 7
Issue 6
10.3390/fishes7060398
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Efficacy of Different Routes of Formalin-Killed Vaccine Administration on Immunity and Disease Resistance of Nile Tilapia (Oreochromis niloticus) Challenged with Streptococcus agalactiae

by
Nguyen Vu Linh
1,2,†,
Le Thanh Dien
3,†,
Ha Thanh Dong
4,
Nuttapon Khongdee
2,5,
Seyed Hossein Hoseinifar
6,
Mohamed Saiyad Musthafa
7,
Mahmoud A. O. Dawood
8,9 and
Hien Van Doan
1,*
1
Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
2
Center of Excellence in Materials Science and Technology, Chiang Mai University, 239 Huay Kaew Road, Chiang Mai 50200, Thailand
3
Faculty of Applied Technology, Van Lang School of Technology, Van Lang University, Ho Chi Minh City 71415, Vietnam
4
Department of Food, Agriculture and Bioresources, School of Environment, Resources and Development, Asian Institute of Technology, Pathum Thani 12120, Thailand
5
Department of Highland Agriculture and Natural Resources, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
6
Department of Fisheries, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan 49189-43464, Iran
7
P.G. & Research Department of Zoology, Unit of Research in Radiation Biology & Environmental Radioactivity (URRBER), The New College (Autonomous), Affiliated to University of Madras, Chennai 600-014, India
8
The Center for Applied Research on the Environment and Sustainability, The American University in Cairo, Cairo 11835, Egypt
9
Department of Animal Production, Faculty of Agriculture, Kafrelsheikh University, Kafrelsheikh 33516, Egypt
*
Author to whom correspondence should be addressed.
†
The authors contributed equally to this work.
Fishes 2022, 7(6), 398; https://doi.org/10.3390/fishes7060398
Submission received: 13 November 2022 / Revised: 10 December 2022 / Accepted: 10 December 2022 / Published: 19 December 2022
(This article belongs to the Special Issue Study in Immune System and Disease of Fishes)
Browse Figures
Versions Notes

Abstract

:
Vaccines prepared from formalin-killed Streptococcus agalactiae were administered to Nile tilapia (Oreochromis niloticus) via three different routes: immersion in a water-based vaccine, injection with an oil-based vaccine, and as a water-based oral vaccine. All vaccination treatments increased lysozyme and peroxidase activity in skin mucus of Nile tilapia by 1.2- to 1.5-fold compared to their activities in unvaccinated control fish. Likewise, alternative complement, phagocytosis, and respiratory burst activities in the blood serum of the vaccinated fish were 1.2- to 1.5-times higher than in the unvaccinated fish. In addition, the expression transcripts of interleukin-1 (IL-1), interleukin-8 (IL-8), and lipopolysaccharide-binding protein (LBP) were 2.3- to 2.9-fold higher in the vaccinated fish compared to those in the unvaccinated control. The unvaccinated fish challenged with Streptococcus agalactiae had a survival rate of 25% compared to a survival rate of 78–85% for the vaccinated fish. The differences between the unvaccinated and vaccinated fish were all statistically significant, but there was no significant difference in any of the indicators of immunity between the three vaccinated groups. Collectively, these results confirm that vaccination with formalin-killed Streptococcus agalactiae significantly improved the resistance of Nile tilapia to infection by the pathogen. Overall, the efficacy of oral administration of the vaccine was comparable to that of vaccine administered via injection, indicating that oral vaccination is a viable cost-effective alternative to administering vaccines by injection.

1. Introduction

Nile tilapia is an increasingly popular species for aquaculture due to its adaptability to a wide range of environmental conditions, and it now ranks second after the carp in terms of global fish production from aquaculture [1]. In many countries, Nile tilapia are reared in intensive cages in rivers and canals that are often polluted with drainage water [2,3]. In such conditions, fish are likely to suffer from low water quality and infectious pathogens [4], and farmed fish are frequently infected by pathogenic bacteria, such as Streptococcus spp., Flavobacterium, Edwardsiella spp., Francisella spp., and Aeromonas spp., causing high mortality rates and substantial economic impacts [5,6,7,8,9,10,11,12]. Antibiotics and traditional chemotherapies are usually applied to control infection and reduce mortality during disease outbreaks [4,13]. However, the use of antibiotics impairs the natural immune response of fish and promotes the development of strains of pathogenic bacteria that are resistant to antibiotics, encouraging their use in even larger quantities [14,15]. This in turn leads to the accumulation of high levels of antibiotics in the body of fish, reducing food safety and indirectly affecting human health [16,17,18]. The use of antibiotics to control infectious diseases also poses a serious risk to the living environment of fish [19,20]. Hence, there is a need to find alternative strategies to combat the risk of bacterial infections in fish cultures [21,22,23]. Vaccines can provide long-lasting protection against pathogenic bacteria and viruses [24,25,26] and are now widely used to control infectious diseases in many aquatic organisms [4,27]. A wide range of vaccines have been developed to protect Nile tilapia against infectious diseases; these include live attenuated vaccines against Streptococcus agalactiae [15,28], polyvalent vaccines against streptococcosis or lactococcosis [29], novel chimeric multiepitope for streptococcosis [30], and vaccines based on formalin-killed bacteria [31]. Vaccines can be administered in different ways, but the most common is by immersion, orally as a feed additive, and direct injection. The method of administration depends on fish size and stage of development as well as the nature of the pathogen being vaccinated against [7,32,33]. Historically, vaccines have been administered via injection, but this is time-consuming and difficult to deliver to young fish [32,34]. On the other hand, while oral and immersion vaccines are simple to administer with minimum stress to the fish, they often result in limited immune responses [7,24,33,34,35]. Improving immersion vaccines would go a long way to reducing the incidence and severity of infectious diseases on fish farms [36,37]. In this study, we compare the efficacy of vaccines prepared from formalin-killed S. agalactiae that were administered via immersion, injection, and oral routes on skin mucus and serum immune response, relative immune gene expression, and the resistance of Nile tilapia to infection by S. agalactiae.

2. Materials and Methods

2.1. Vaccine Preparation

Streptococcus agalactiae strain 2809 used for this research was isolated from a disease outbreak at a tilapia farm [38]. The isolate was recovered from the stock and purified by culturing on tryptic soy agar (TSA, Becton, Dickinson, ND, USA) for 48 h at 28 °C. The pure colony was then cultured in 15 mL of tryptic soy broth (TSB, Becton, Dickinson, ND, USA) for 24 h at 28 °C and 150 rpm. One percent of S. agalactiae was added to fresh TSB and cultured for 24 h at 28 °C and 150 rpm. The bacterial suspensions were then inactivated with 3% formalin and incubated at 4 °C overnight. To verify the inactivation of the bacteria, a volume of 0.1 mL of killed-bacterial suspension was plated on TSA and S. agalactiae selective agar bases (HiMedia, India) and incubated for three days at 28 °C. The inactivated bacterial suspension was washed with sterile 1× phosphate-buffered saline (PBS) three times followed by centrifuging at 4500 rpm for 5 min at 4 °C. The pellet was then resuspended in sterile 1× PBS for further use [33,39,40]. Following centrifugation, the bacterial pellets were resuspended in PBS buffer and adjusted to OD600nm = 1.3 (equivalent to 109 CFU mL−1) to provide the bacterial antigens for the vaccine formulation. This suspension of formalin-killed bacteria in PBS (bacterial antigen) was used for the water-based oral vaccine. For the oil-based injectable vaccine, the bacterial antigen was mixed with MontanideTM ISA 763A VG, a commercially available non-mineral oil adjuvant (Seppic), at a ratio of 3:7 (v/v) and homogenized at 15,600 rpm for 3 min using an IKA T25 digital ULTRA TURRAX homogenizer to form an oil-in-water vaccine with a final concentration of ~1.7 × 107 CFU mL−1. For the immersion vaccine, the bacterial antigen was mixed with MontanideTM ISA 1312 VG (Seppic) adjuvant at a ratio of 1:1 (v/v) and agitated at 250 rpm for 10 min using a low-shear mixer with a 4-blade impeller (Onilab OS20-Pro). The control was PBS without bacterial antigen. The formulated vaccines were stored at 4 °C until use.

2.2. Diet Preparation and Experimental Design

The approximate components and formulation of the experimental diets for the fish in the current study are presented in Table 1. The experimental diet consisted of the basal diet sprayed with PBS at a rate of 100 mL per kg feed; for the oral vaccine treatment, 100 mL of water-based oral vaccine was sprayed onto 1 kg of basal diet. All diets were coated with fish oil, dried for 15 min at 24 °C, and then stored at 4 °C until used.

2.3. Experimental Procedure

Healthy Nile tilapia were purchased from a commercial hatchery in Chiang Mai, Thailand. The fish were fed commercial pellets (CP, 9950) for 60 days and then fed the basal diet for 15 days. Prior to the experimental trial, 10 experimental fish were randomly selected and tested for the presence of S. agalactiae. After confirming that the fish were free of S. agalactiae, 320 fish (9.85 ± 0.35 g) were distributed into 16 glass aquaria containing 100 L of water at a stocking density of 20 fish per tank. The feeding experiment lasted for 15 days and had four replicates of each treatment arranged in a completely randomized design. There were four experimental treatments: an unvaccinated control (Treatment T1), fish given the immersion vaccine (Treatment T2), fish injected with the oil-based vaccine (Treatment T3), and fish given the oral vaccine (Treatment T4). The fish in the unvaccinated control group (T1) were injected with 0.1 mL of PBS without vaccine. The fish receiving the immersion vaccine (Treatment T2) were transferred to an identical tank with 100 L of aerated water at the same temperature (28 °C) into which 2 L of vaccine (approx. 109 CFU mL−1) was added to give a final concentration of approximately 107 CFU mL−1. After 30 min of exposure to the immersion vaccine, the fish were returned to their vaccine-free culture tank. Each fish in the injectable vaccine group (Treatment T3) received an intraperitoneal injection of 0.1 mL of vaccine (approx. 1.7 × 107 CFU mL−1). For Treatment T4, the water-based oral vaccine was administered to the fish as follows: days 1–5, feeding with oral vaccine; days 6–10, feeding without vaccine; days 11–15, feeding with oral vaccine [41]. The oral vaccine treatments were given to the fish at 8:30 a.m. and 4:30 p.m. At each feeding time, a visual examination was conducted to confirm that all feed were eaten and nothing remained in the tanks. Water temperature, pH, and dissolved oxygen were maintained at 28 ± 0.23 °C, 7.91 ± 0.31, and 5.32 ± 0.11 mg L−1, respectively.

2.4. Serum, Leukocytes, and Mucus Preparation

A composite sample of fish blood from 4 fish per replicate was kept without anticoagulant in 1.5 mL microtubes for 1 h at 24 °C and then at 4 °C for 4 h. The serum was then extracted by centrifugation at 1500× g for 5 min and frozen at −80 °C for further analysis.
Leukocytes were isolated from the fish blood according to protocols reported previously [42] and modified according to Van Doan et al. [43]. Skin mucus was collected from the same fish following the procedures described previously. Briefly, the clove oil-anesthetized fish were gently rubbed for 2 min in a plastic bag supplemented with 10 mL of 50 mM NaCl. The mixture was immediately poured into a 15 mL sterile tube and centrifuged. The supernatant was collected and stored at −80 °C.

2.5. Immunological Assays

The lysozyme activity of the mucus and serum was assayed following the protocols previously described by [44], and the peroxidase activity was measured according to protocols previously reported by [45,46]. The protocol of Yoshida and Kitao [47] was used to assess the phagocytic activity. The blood leukocytes’ respiratory burst activity was determined following the protocol of Secomebs [42], whereas ACH50 was assayed according to Yanno [48].

2.6. Nonspecific Immune-Related Gene Expression Analysis

To investigate the mRNA transcript levels of three target genes, liver tissues (3 fish/tank/treatment) were sampled for quantitative real-time PCR (RT-qPCR) after 15 days of immunization. A total of 40–50 mg of liver tissue was used for total RNA isolation using the TRIzol method. The quality and quantity of total RNA were measured using a NanoDrop One (Thermo Scientific, USA) at an OD ratio of 260:280 nm. One µg of total RNA was used to synthesize the first-strand complementary DNA (cDNA). The primers used for RT-qPCR analysis in this study are presented in Table 2. The RT-qPCR was performed in triplicate using the CFX96™ Real-Time System (Bio-Rad, USA) with 1 µL of cDNA, 10 mM of each primer, and 2 × iTaq Universal SYBR Green (Bio-Rad, USA). The mRNA transcript levels were calculated using the 2−ΔΔCt method [49]. The primers used for qPCR were previously reported by Linh et al. [33].

2.7. Challenge Experiment

S. agalactiae was isolated and thoroughly processed as previously reported [38]. Briefly, 5 mL of the stock solution was transferred into 50 mL of TSB and incubated for 24 h at 28 °C and 150 rpm. The sub-cultures were raised in duplicate with similar conditions for the experiment. The optical density at 560 nm was used to determine growth followed by plate counting in TSA. At 15 days post-feeding, a total of 10 fish from each replicate was intraperitoneally injected with 0.1 mL of S. agalactiae (approx. 107 CFU mL−1). The survival rates were measured daily over a period of 15 days of the experimental challenge, and the relative percentage of survival (RPS) was calculated as follows: RPS = (1 − % mortality in vaccinated/% mortality in control) × 100 [50].

2.8. Statistical Analysis

The Shapiro–Wilk test was used to assess the normality of the data. Statistix v.10.1 (Analytical Software, Tallahassee, FL, USA) was used to perform the statistical analyses. The immunological responses and mRNA transcript levels of the innate immune-related genes were all evaluated using a one-way analysis of variance, and the differences between means were compared using the Least Significant Difference (LSD) test. The Kaplan–Meier estimator was used to determine the cumulative survival in the experimental challenge, and the log-rank test was used to compare statistically significant differences in survival between the different treatments. The data are presented as means ± SEM, and statistical significance was determined at the 95% confidence level (p < 0.05).

3. Results

3.1. Mucosal Immune Response Analysis

Overall, vaccination increased the activity of lysozyme by approximately 1.3-fold and peroxidase by approximately 1.6-fold in skin mucus compared to the unvaccinated control group, and this was statistically significant (p < 0.05) (Figure 1). Skin mucus lysozyme activity was marginally higher in the fish that were vaccinated by injection (1.56 μg mL−1) than those vaccinated orally (1.53 μg mL−1) and a little lower (1.45 μg mL−1) in the fish that were vaccinated by immersion (Figure 1), but the differences between the vaccination routes were not significant (p > 0.05). Skin mucus peroxidase activity was similar (0.13 μg mL−1) in the fish vaccinated by injection and via the oral pathway and a little lower (0.12 μg mL−1) for those receiving the vaccine via immersion (Figure 1). There was no significant difference (p > 0.05) in skin mucus peroxidase activity between any of the vaccination treatments (Figure 1).

3.2. Immune Response Analysis in Serum

The fish in the vaccinated groups (T2, T3, and T4) had substantially greater levels (p < 0.05) of serum lysozyme (ca. 1.3-fold) and peroxidase activity (ca. 1.3-fold), alternative complement activity (ca. 1.4-fold), respiratory burst activity (ca. 1.5-fold), and phagocytosis activity (ca. 1.2-fold) than the unvaccinated fish in T1, the control treatment (Figure 2). Serum lysozyme (5.66 μg mL−1) and peroxidase activity (0.21 μg mL−1), alternative complement activity (237 μg mL−1), and respiratory burst activity (0.13 μg mL−1) were all marginally, but not significantly, higher in the fish vaccinated orally than those vaccinated by immersion or injection (Figure 2). There was no significant difference in any of the measured indices between the different methods of vaccine delivery (p > 0.05).

3.3. Immune Gene Expression Profiling

The relative transcript levels of the three target genes encoding IL-1 (interleukin-1), IL-8 (interleukin-8), and LBP (lipopolysaccharide-binding protein) were 2.5- to 3-fold higher (p < 0.05) in the liver tissues of the vaccinated fish compared to those in the unvaccinated control (Figure 3). The relative transcript level for IL-1 was marginally higher in the fish vaccinated orally than in the fish vaccinated via injection and, conversely, the relative transcript levels of IL-8 and LPB were slightly higher in the fish vaccinated via injection than in those vaccinated orally (Figure 3). For all three genes, the relative transcript levels were lower in the immersion treatment (T2) than in the other two vaccination treatments (T3 and T4). However, the transcript levels for all three genes were not significantly different between the three vaccination treatments (Figure 3).

3.4. Fish Survival Rate after S. agalactiae Challenge

For the unvaccinated fish in the T1 treatment group, mortality occurred on day 4 and continued until day 8, whereas the earliest incidence of fish mortality was recorded on day 5 for the vaccinated fish in the T2, T3, and T4 treatment groups. After 15 days of challenge with S. agalactiae, the relative percent survival (RPS) was 66.67% for the vaccinated fish in the T2 treatment group followed by 80% for the vaccinated fish in the T3 treatment group and 71.67% for the vaccinated fish in the T4 treatment group (Figure 4, Table 3). The fish that perished during the challenge experiment displayed clinical symptoms typical of S. agalactiae.

4. Discussion

Vaccines have been successfully applied in fish aquaculture to protect against bacterial infections [7,37,51,52,53]. Injection is the traditional method of administering these vaccinations, and research has shown that it is more efficient than oral administration [54]. However, injectable vaccines in aquaculture necessitate skilled vaccinator personnel, which adds to the cost of production. Moreover, injection induces handling stress, resulting in a low feed intake and loss of appetite in fish [34,37]. Following the injection of a vaccine, many fish are killed, and the remaining fish may lose some of their immunity and become more susceptible to diseases [55,56]. Therefore, for many fish, injectable vaccinations are not advised [54]. Nile tilapia is one of the species that holds the most promise for vaccine development. Given the recent extremely intensive method utilized in Nile tilapia farming, giving vaccinations orally is better than giving them via injection [7,27,34,37]. Fish oral vaccines have been thoroughly explored in recent years as an alternative to injectable immunizations, including Nile tilapia [57,58,59]. Even though oral vaccination seems to be the optimal way of administration, there are major limiting factors, such as larger volumes of vaccine, temperature and pressure tolerance conditions, vaccine doses, or booster vaccination for short durations of immunization [60,61]. Continuous research might greatly resolve these issues, resulting in the commercialization of effective oral vaccines for pathogenic diseases in aquaculture. Therefore, the present trial aimed at assessing injection, immersion, and oral vaccination methods in Nile tilapia. The metabolic indicators we used to assess immunological responses have all been used widely in previous studies. The immunological properties of skin mucus and blood serum provide a useful insight into the natural innate capacity of fish to resist infection [62,63]. Lysozyme is a bacteriolytic enzyme generated in the lysosome of phagocytic cells, and lysozyme activity is a crucial component of the non-specific immunological response of fish. In this investigation, vaccination through any of the three routes, immersion, injection, or oral administration, led to increased levels of the enzyme lysozyme and the antioxidant peroxidase in blood serum and skin mucus. Previously, on 7, 49 days post-vaccination and post-infection with A. hydrophila, lysozyme activity was considerably greater in fish inoculated with the BF vaccine (mixed S. iniae and A. hydrophila) compared to those vaccinated with the MA vaccine (monovalent S. iniae) [64]. Consequently, prior results indicated that, three weeks after vaccination, the lysozyme activity of vaccinated tilapia was much greater than that of unvaccinated tilapia [65]. Additionally, elevated phagocytosis, complement pathway, and respiratory burst activities implied an enhanced ability of lymphocytes and leukocytes to attack invading bacteria and increase fish survival in this study. The increase in leukocytes has a favorable effect on the generation of antibodies, resulting in a body resistance response against the foreign substance [66]. Likewise, a greater leukocyte count was closely associated with an increase in lysozyme [67]. These results suggest that the rising immunological response in vaccinated tilapia may be associated with a rise in lysozyme activity.
Interleukins 1 and 8 (IL-1 and IL-8) are key pro-inflammatory cytokines associated with the immune response in fish, especially against harmful pathogens [68,69,70]. The results of this study display relatively high mRNA levels of IL-1 and IL-8 in the liver of Nile tilapia after S. agalactiae vaccination compared to the non-vaccinated group. IL-1 and IL-8 in the liver of fish vaccinated through oral, injection, and immersion routes have similar mRNA levels without significant differences. The results are in line with Jun et al. [71], who reported upregulation of pro-inflammatory genes in Japanese eel (Anguilla japonica) treated with a S. agalactiae vaccine. The results are probably attributed to the potent immunostimulant action by the S. agalactiae vaccine, which enhances Nile tilapia’s ability to resist infection. Besides, the lipopolysaccharide-binding protein (LBP) gene is another key protein involved in acute-phase immunity [68,72]. The precursor of LBP is also associated with immune resistance during infection with bacterial infections [73,74]. In this study, the more than two-fold higher levels of IL-1 and IL-8, and almost three-fold rise in relative LBP transcript level in the vaccinated fish compared to the unvaccinated fish may have improved the survival of fish in this experiment. Taken together, the significant enhancement of pro-inflammatory gene expression in Nile tilapia is a result of vaccination, which has also been observed in Japanese eel (Anguilla japonica) treated with the S. agalactiae vaccine.
Our results showed that vaccination with formalin-killed S. agalactiae via immersion, injection, or orally stimulated a range of immune responses that enhanced the resistance of Nile tilapia to this pathogen and increased the survival rate in exposed populations. Whereas starch hydrogel-based oral vaccines produced a greater immune response than injection and immersion vaccination methods [75], our results for vaccination of Nile tilapia with antigen from formalin-killed S. agalactiae indicated that the immune response from water-based oral vaccination was very similar to that from the injectable vaccine. Similar benefits were investigated in Nile tilapia fed a live attenuated S. agalactiae vaccine [76]; polyvalent inactivated vaccine containing S. agalactiae, S. iniae, L. garvieae, and Enterococcus faecalis [29]; novel chimeric multiepitope vaccine for S. agalactiae [30]; naturally attenuated S. agalactiae live vaccine [28]; and inactivated S. agalactiae and S. iniae vaccines [31]. Nonetheless, the delivery of oral antigens has been reported to increase resistance in fish intestines and suppress immunity. The results of this study indicated that water-based oral vaccines can be used without reducing the pro-inflammatory immune response in Nile tilapia during infections caused by S. agalactiae.
In addition, the destruction of antigens by stomach acid and proteolytic enzymes in the digestive system is one of the most significant barriers to oral vaccines, which needs to be tackled to improve vaccine efficacy [59]. Several techniques are being used to protect antigens from the intestinal atmosphere for their immunogenic effects in an effort to address this challenge. Among them, encapsulation techniques by poly-biodegradable nanomaterials, such as chitosan and poly D,L-lactic-co-glycolic acid (PLGA), have demonstrated potential. The antigen is encapsulated by nanomaterials that can sustain the right epitope until it reaches the immunological site and is released in the intestine, considerably improving the immune response [77]. Vaccines, on the other hand, switch on the immune system to aid in disease resistance, and the use of these strategies to control infectious diseases is gaining relevance. Perfecting the use of adjuvants, delivery methods, and innovative technologies is needed to fulfill the demand of vaccines and ensure the safe supply of healthy fish products. It is vital for the future of the fish farming industry that vaccines can be an efficient tool for lowering the use of antibiotics in animals, therefore assisting the fight against antimicrobial resistance. In our point of view, although the formalin-killed S. agalactiae water-based oral vaccine shows potential in this study to improve the survival rate and activate the immune system of experimental fish, oral nano-encapsulated vaccines are promising and practical implications for aquaculture that can offer more benefits in terms of protective efficacy, time, labor, simplicity, and cost efficiency.

5. Conclusions

This study suggests that the oral vaccination of Nile tilapia with formalin-killed S. agalactiae stimulated the serum and skin mucus immunity and is just as effective as an injectable vaccine. By using this kind of vaccine, farmers can save time, cut down on the demand for highly skilled labor, and eliminate the stress and attendant mortality associated with direct injection. However, a larger sample size, more replicates, and an analysis of a wider range of target genes should be the focus of further studies.

Author Contributions

Writing—original draft preparation, investigation, methodology, data curation, N.V.L.; writing—review and editing, L.T.D.; writing—review and editing, validation, methodology, H.T.D.; software, data analysis, N.K.; supervision, S.H.H.; supervision, M.S.M.; supervision, M.A.O.D.; conceptualization, project administration, funding acquisition, H.V.D. The published version of the work has been reviewed and approved by all authors. All authors have read and agreed to the published version of the manuscript.

Funding

The research project was supported by the National Research Council of Thailand. This research was partially supported by Chiang Mai University.

Institutional Review Board Statement

All animal experiments comply with AAALAC guidelines approved by the Chiang Mai University Committee (No. AQ006/2562[02/2562-09-16]).

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Acknowledgments

The authors would like to thank Christopher Secombes for his support regarding the oral vaccine preparation technique.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Shourbela, R.M.; Khatab, S.A.; Hassan, M.M.; Van Doan, H.; Dawood, M.A. The effect of stocking density and carbon sources on the oxidative status, and nonspecific immunity of Nile tilapia (Oreochromis niloticus) reared under biofloc conditions. Animals 2021, 11, 184. [Google Scholar] [CrossRef] [PubMed]
  2. El-Sayed, A.-F.M. Tilapia Culture; CABI Publishing: Wallingford, UK, 2006. [Google Scholar]
  3. Subasinghe, R. World aquaculture 2015: A brief overview. In FAO Fisheries and Aquaculture Report; Food and Agriculture Organization of the United Nations: Rome, Italy, 2017. [Google Scholar]
  4. Rico, A.; Oliveira, R.; McDonough, S.; Matser, A.; Khatikarn, J.; Satapornvanit, K.; Nogueira, A.J.; Soares, A.M.; Domingues, I.; Van den Brink, P.J. Use, fate and ecological risks of antibiotics applied in tilapia cage farming in Thailand. Environ. Pollut. 2014, 191, 8–16. [Google Scholar] [CrossRef]
  5. Sirimanapong, W.; Thompson, K.D.; Shinn, A.P.; Adams, A.; Withyachumnarnkul, B. Streptococcus agalactiae infection kills red tilapia with chronic Francisella noatunensis infection more rapidly than the fish without the infection. Fish Shellfish. Immunol. 2018, 81, 221–232. [Google Scholar] [CrossRef] [PubMed]
  6. Wamala, S.P.; Mugimba, K.K.; Mutoloki, S.; Evensen, Ø.; Mdegela, R.; Byarugaba, D.K.; Sørum, H. Occurrence and antibiotic susceptibility of fish bacteria isolated from Oreochromis niloticus (Nile tilapia) and Clarias gariepinus (African catfish) in Uganda. Fish. Aquat. Sci. 2018, 21, 1–10. [Google Scholar] [CrossRef] [Green Version]
  7. Bøgwald, J.; Dalmo, R.A. Review on immersion vaccines for fish: An update 2019. Microorganisms 2019, 7, 627. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  8. Shahin, K.; Shinn, A.P.; Metselaar, M.; Ramirez-Paredes, J.G.; Monaghan, S.J.; Thompson, K.D.; Hoare, R.; Adams, A. Efficacy of an inactivated whole-cell injection vaccine for nile tilapia, Oreochromis niloticus (L.), against multiple isolates of Francisella noatunensis subsp. orientalis from diverse geographical regions. Fish Shellfish. Immunol. 2019, 89, 217–227. [Google Scholar] [CrossRef] [PubMed]
  9. Suphoronski, S.; Chideroli, R.; Facimoto, C.; Mainardi, R.; Souza, F.; Lopera-Barrero, N.; Jesus, G.; Martins, M.; Di Santis, G.; De Oliveira, A. Effects of a phytogenic, alone and associated with potassium diformate, on tilapia growth, immunity, gut microbiome and resistance against francisellosis. Sci. Rep. 2019, 9, 6045. [Google Scholar] [CrossRef] [Green Version]
  10. Yun, S.; Giri, S.S.; Kim, H.J.; Kim, S.G.; Kim, S.W.; Kang, J.W.; Han, S.J.; Kwon, J.; Oh, W.T.; Chi, C. Enhanced bath immersion vaccination through microbubble treatment in the cyprinid loach. Fish Shellfish. Immunol. 2019, 91, 12–18. [Google Scholar] [CrossRef]
  11. Basri, L.; Nor, R.M.; Salleh, A.; Md. Yasin, I.S.; Saad, M.Z.; Abd. Rahaman, N.Y.; Barkham, T.; Amal, M.N.A. Co-infections of tilapia lake virus, Aeromonas hydrophila and Streptococcus agalactiae in farmed red hybrid tilapia. Animals 2020, 10, 2141. [Google Scholar] [CrossRef]
  12. Oh, W.T.; Jun, J.W.; Kim, H.J.; Giri, S.S.; Yun, S.; Kim, S.G.; Kim, S.W.; Kang, J.W.; Han, S.J.; Kwon, J. Characterization and pathological analysis of a virulent Edwardsiella anguillarum strain isolated from Nile tilapia (Oreochromis niloticus) in Korea. Front. Vet. Sci. 2020, 7, 14. [Google Scholar] [CrossRef]
  13. Rico, A.; Phu, T.M.; Satapornvanit, K.; Min, J.; Shahabuddin, A.; Henriksson, P.J.; Murray, F.J.; Little, D.C.; Dalsgaard, A.; Van den Brink, P.J. Use of veterinary medicines, feed additives and probiotics in four major internationally traded aquaculture species farmed in Asia. Aquaculture 2013, 412, 231–243. [Google Scholar] [CrossRef] [Green Version]
  14. Kumar, S.B.; Arnipalli, S.R.; Ziouzenkova, O. Antibiotics in food chain: The consequences for antibiotic resistance. Antibiotics 2020, 9, 688. [Google Scholar] [CrossRef] [PubMed]
  15. Yang, C.; Song, G.; Lim, W. A review of the toxicity in fish exposed to antibiotics. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2020, 237, 108840. [Google Scholar] [CrossRef] [PubMed]
  16. Sapkota, A.; Sapkota, A.R.; Kucharski, M.; Burke, J.; McKenzie, S.; Walker, P.; Lawrence, R. Aquaculture practices and potential human health risks: Current knowledge and future priorities. Environ. Int. 2008, 34, 1215–1226. [Google Scholar] [CrossRef] [PubMed]
  17. Heuer, O.E.; Kruse, H.; Grave, K.; Collignon, P.; Karunasagar, I.; Angulo, F.J. Human health consequences of use of antimicrobial agents in aquaculture. Clin. Infect. Dis. 2009, 49, 1248–1253. [Google Scholar] [CrossRef]
  18. Henriksson, P.J.; Rico, A.; Troell, M.; Klinger, D.H.; Buschmann, A.H.; Saksida, S.; Chadag, M.V.; Zhang, W. Unpacking factors influencing antimicrobial use in global aquaculture and their implication for management: A review from a systems perspective. Sustain. Sci. 2018, 13, 1105–1120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Miranda, C.D.; Godoy, F.A.; Lee, M.R. Current status of the use of antibiotics and the antimicrobial resistance in the Chilean salmon farms. Front. Microbiol. 2018, 9, 1284. [Google Scholar] [CrossRef]
  20. Lulijwa, R.; Rupia, E.J.; Alfaro, A.C. Antibiotic use in aquaculture, policies and regulation, health and environmental risks: A review of the top 15 major producers. Rev. Aquac. 2020, 12, 640–663. [Google Scholar] [CrossRef]
  21. Gabriel, N.N.; Qiang, J.; He, J.; Ma, X.Y.; Kpundeh, M.D.; Xu, P. Dietary Aloe vera supplementation on growth performance, some haemato-biochemical parameters and disease resistance against Streptococcus iniae in tilapia (GIFT). Fish Shellfish. Immunol. 2015, 44, 504–514. [Google Scholar] [CrossRef]
  22. Dávila, M.S.; Latimer, M.F.; Dixon, B. Enhancing immune function and fish health in aquaculture. In Fish Physiology; Elsevier: Amsterdam, The Netherlands, 2020; Volume 38, pp. 123–161. [Google Scholar]
  23. Paray, B.A.; El-Basuini, M.F.; Alagawany, M.; Albeshr, M.F.; Farah, M.A.; Dawood, M.A. Yucca schidigera usage for healthy aquatic animals: Potential roles for sustainability. Animals 2021, 11, 93. [Google Scholar] [CrossRef]
  24. Brandi, P.; Conejero, L.; Cueto, F.J.; Martínez-Cano, S.; Dunphy, G.; Gómez, M.J.; Relaño, C.; Saz-Leal, P.; Enamorado, M.; Quintas, A. Trained immunity induction by the inactivated mucosal vaccine MV130 protects against experimental viral respiratory infections. Cell Rep. 2022, 38, 110184. [Google Scholar] [CrossRef] [PubMed]
  25. Lynn, D.J.; Benson, S.C.; Lynn, M.A.; Pulendran, B. Modulation of immune responses to vaccination by the microbiota: Implications and potential mechanisms. Nat. Rev. Immunol. 2022, 22, 33–46. [Google Scholar] [CrossRef] [PubMed]
  26. Ziogas, A.; Netea, M.G. Trained immunity-related vaccines: Innate immune memory and heterologous protection against infections. Trends Mol. Med. 2022, 28, 497–512. [Google Scholar] [CrossRef] [PubMed]
  27. Montuori, E.; de Pascale, D.; Lauritano, C. Recent Discoveries on Marine Organism Immunomodulatory Activities. Mar. Drugs 2022, 20, 422. [Google Scholar] [CrossRef]
  28. Mo, X.-B.; Wang, J.; Guo, S.; Li, A.-X. Potential of naturally attenuated Streptococcus agalactiae as a live vaccine in Nile tilapia (Oreochromis niloticus). Aquaculture 2020, 518, 734774. [Google Scholar] [CrossRef]
  29. Abu-Elala, N.M.; Samir, A.; Wasfy, M.; Elsayed, M. Efficacy of injectable and immersion polyvalent vaccine against streptococcal infections in broodstock and offspring of Nile tilapia (Oreochromis niloticus). Fish Shellfish. Immunol. 2019, 88, 293–300. [Google Scholar] [CrossRef]
  30. Pumchan, A.; Krobthong, S.; Roytrakul, S.; Sawatdichaikul, O.; Kondo, H.; Hirono, I.; Areechon, N.; Unajak, S. Novel chimeric multiepitope vaccine for streptococcosis disease in Nile tilapia (Oreochromis niloticus Linn.). Sci. Rep. 2020, 10, 603. [Google Scholar] [CrossRef] [Green Version]
  31. Wang, Q.; Fu, T.; Li, X.; Luo, Q.; Huang, J.; Sun, Y.; Wang, X. Cross-immunity in Nile tilapia vaccinated with Streptococcus agalactiae and Streptococcus iniae vaccines. Fish Shellfish. Immunol. 2020, 97, 382–389. [Google Scholar] [CrossRef]
  32. Dien, L.T.; Ngo, T.P.H.; Nguyen, T.V.; Kayansamruaj, P.; Salin, K.R.; Mohan, C.V.; Rodkhum, C.; Dong, H.T. Non-antibiotic approaches to combat motile Aeromonas infections in aquaculture: Current state of knowledge and future perspectives. Rev. Aquac. 2023, 15, 333–366. [Google Scholar] [CrossRef]
  33. Linh, N.V.; Dien, L.T.; Sangpo, P.; Senapin, S.; Thapinta, A.; Panphut, W.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Pre-treatment of Nile tilapia (Oreochromis niloticus) with ozone nanobubbles improve efficacy of heat-killed Streptococcus agalactiae immersion vaccine. Fish Shellfish. Immunol. 2022, 123, 229–237. [Google Scholar] [CrossRef]
  34. Bedekar, M.K.; Kole, S. Fundamentals of fish vaccination. In Vaccine Design; Springer: New York, NY, USA, 2022; pp. 147–173. [Google Scholar]
  35. Dien, L.T.; Linh, N.V.; Mai, T.T.; Senapin, S.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Impacts of oxygen and ozone nanobubbles on bacteriophage in aquaculture system. Aquaculture 2022, 551, 737894. [Google Scholar] [CrossRef]
  36. Novoa, B.; Pereiro, P. Editorial of Special Issue “The 2nd Edition: Vaccines for Aquaculture”. Vaccines 2022, 10, 1242. [Google Scholar] [CrossRef] [PubMed]
  37. Vinay, T.; Jung, M.-H.; Patil, P.K.; Panigrahi, A.; Kallappa, G.S. Vaccines to Prevent Diseases in Aquaculture. Biotechnol. Adv. Aquac. Health Manag. 2022, 313, 313–323. [Google Scholar]
  38. Linh, N.V.; Panphut, W.; Thapinta, A.; Senapin, S.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Ozone nanobubble modulates the innate defense system of Nile tilapia (Oreochromis niloticus) against Streptococcus agalactiae. Fish Shellfish. Immunol. 2021, 112, 64–73. [Google Scholar] [CrossRef]
  39. Thanh Dien, L.; Linh, N.V.; Sangpo, P.; Senapin, S.; St-Hilaire, S.; Rodkhum, C.; Dong, H.T. Ozone nanobubble treatments improve survivability of Nile tilapia (Oreochromis niloticus) challenged with a pathogenic multi-drug-resistant Aeromonas hydrophila. J. Fish Dis. 2021, 44, 1435–1447. [Google Scholar] [CrossRef]
  40. Thu Lan, N.G.; Salin, K.R.; Longyant, S.; Senapin, S.; Dong, H.T. Systemic and mucosal antibody response of freshwater cultured Asian seabass (Lates calcarifer) to monovalent and bivalent vaccines against Streptococcus agalactiae and Streptococcus iniae. Fish Shellfish. Immunol. 2021, 108, 7–13. [Google Scholar] [CrossRef]
  41. Attaya, A.; Veenstra, K.; Welsh, M.D.; Ahmed, M.; Torabi-Pour, N.; Saffie-Siebert, S.; Yoon, S.; Secombes, C.J. In vitro evaluation of novel (nanoparticle) oral delivery systems allow selection of gut immunomodulatory formulations. Fish Shellfish. Immunol. 2021, 113, 125–138. [Google Scholar] [CrossRef]
  42. Chung, S.; Secombes, C.J. Analysis of events occurring within teleost macrophages during the respiratory burst. Comp. Biochem. Physiol. Part B Comp. Biochem. 1988, 89, 539–544. [Google Scholar] [CrossRef]
  43. Van Doan, H.; Hoseinifar, S.H.; Hung, T.Q.; Lumsangkul, C.; Jaturasitha, S.; Ehab, E.-H.; Paolucci, M. Dietary inclusion of chestnut (Castanea sativa) polyphenols to Nile tilapia reared in biofloc technology: Impacts on growth, immunity, and disease resistance against Streptococcus agalactiae. Fish Shellfish. Immunol. 2020, 105, 319–326. [Google Scholar] [CrossRef]
  44. Parry Jr, R.M.; Chandan, R.C.; Shahani, K.M. A rapid and sensitive assay of muramidase. Proc. Soc. Exp. Biol. Med. 1965, 119, 384–386. [Google Scholar] [CrossRef]
  45. Quade, M.J.; Roth, J.A. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol. Immunopathol. 1997, 58, 239–248. [Google Scholar] [CrossRef] [PubMed]
  46. Cordero, H.; Cuesta, A.; Meseguer, J.; Esteban, M.Á. Changes in the levels of humoral immune activities after storage of gilthead seabream (Sparus aurata) skin mucus. Fish Shellfish. Immunol. 2016, 58, 500–507. [Google Scholar] [CrossRef] [PubMed]
  47. Yoshida, T.; Kitao, T. The Opsonic Effect of Specific Immune Serum on the Phagocytic and Chemiluminescent Response in Rainbow Trout, Oncorhynchus mykiss Phagocytes. Fish Pathol. 1991, 26, 29–33. [Google Scholar] [CrossRef]
  48. Yano, T. Assays of hemolytic complement activity. Tech. Fish Immunol. 1992, 131–141. [Google Scholar]
  49. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  50. Amend, D.F. Potency testing of fish vaccines. Fish Biol. Serodiagn. Vaccines 1981, 447–454. [Google Scholar]
  51. Sommerset, I.; Krossøy, B.; Biering, E.; Frost, P. Vaccines for fish in aquaculture. Expert Rev. Vaccines 2005, 4, 89–101. [Google Scholar] [CrossRef]
  52. Plant, K.P.; LaPatra, S.E. Advances in fish vaccine delivery. Dev. Comp. Immunol. 2011, 35, 1256–1262. [Google Scholar] [CrossRef]
  53. Dhar, A.; Manna, S.; Thomas Allnutt, F. Viral vaccines for farmed finfish. Virus Dis. 2014, 25, 1e17. [Google Scholar] [CrossRef] [Green Version]
  54. Ma, J.; Bruce, T.J.; Jones, E.M.; Cain, K.D. A Review of Fish Vaccine Development Strategies: Conventional Methods and Modern Biotechnological Approaches. Microorganisms 2019, 7, 569. [Google Scholar] [CrossRef] [Green Version]
  55. Li, B.; Chen, J.; Huang, P.; Weng, T.; Wen, Y.; Yang, H.; Liu, Y.; Xia, L. Induction of attenuated Nocardia seriolae and their use as live vaccine trials against fish nocardiosis. Fish Shellfish. Immunol. 2022, 131, 10–20. [Google Scholar] [CrossRef] [PubMed]
  56. Mondal, H.; Thomas, J. A review on the recent advances and application of vaccines against fish pathogens in aquaculture. Aquac. Int. 2022, 30, 1971–2000. [Google Scholar] [CrossRef] [PubMed]
  57. Hoare, R.; Leigh, W.; Limakom, T.; Wongwaradechkul, R.; Metselaar, M.; Shinn, A.P.; Ngo, T.P.H.; Thompson, K.D.; Adams, A. Oral vaccination of Nile tilapia (Oreochromis niloticus) against francisellosis elevates specific antibody titres in serum and mucus. Fish Shellfish. Immunol. 2021, 113, 86–88. [Google Scholar] [CrossRef] [PubMed]
  58. Thangsunan, P.; Kitiyodom, S.; Srisapoome, P.; Pirarat, N.; Yata, T.; Thangsunan, P.; Boonrungsiman, S.; Bunnoy, A.; Rodkhum, C. Novel development of cationic surfactant-based mucoadhesive nanovaccine for direct immersion vaccination against Francisella noatunensis subsp. orientalis in red tilapia (Oreochromis sp.). Fish Shellfish. Immunol. 2022, 127, 1051–1060. [Google Scholar] [CrossRef] [PubMed]
  59. Radhakrishnan, A.; Vaseeharan, B.; Ramasamy, P.; Jeyachandran, S. Oral vaccination for sustainable disease prevention in aquaculture—An encapsulation approach. Aquac. Int. 2022, 1–25. [Google Scholar] [CrossRef] [PubMed]
  60. Embregts, C.W.E.; Forlenza, M. Oral vaccination of fish: Lessons from humans and veterinary species. Dev. Comp. Immunol. 2016, 64, 118–137. [Google Scholar] [CrossRef] [Green Version]
  61. Sudheesh, P.S.; Cain, K.D. Prospects and challenges of developing and commercializing immersion vaccines for aquaculture. Int. Biol. Rev. 2017, 1, 1–20. [Google Scholar]
  62. Yu, Y.; Wang, Q.; Huang, Z.; Ding, L.; Xu, Z. Immunoglobulins, mucosal immunity and vaccination in teleost fish. Front. Immunol. 2020, 11, 2597. [Google Scholar] [CrossRef]
  63. El Basuini, M.F.; Teiba, I.I.; Shahin, S.A.; Mourad, M.M.; Zaki, M.A.; Labib, E.M.; Azra, M.N.; Sewilam, H.; El-Dakroury, M.; Dawood, M.A. Dietary Guduchi (Tinospora cordifolia) enhanced the growth performance, antioxidative capacity, immune response and ameliorated stress-related markers induced by hypoxia stress in Nile tilapia (Oreochromis niloticus). Fish Shellfish. Immunol. 2022, 120, 337–344. [Google Scholar] [CrossRef]
  64. Monir, M.S.; Yusoff, S.b.M.; Mohamad, A.; Ngoo, M.S.b.M.H.; Ina-Salwany, M.Y. Haemato-immunological responses and effectiveness of feed-based bivalent vaccine against Streptococcus iniae and Aeromonas hydrophila infections in hybrid red tilapia (Oreochromis mossambicus× O. niloticus). BMC Vet. Res. 2020, 16, 226. [Google Scholar] [CrossRef]
  65. Sirimanapong, W.; Thompson, K.D.; Kledmanee, K.; Thaijongrak, P.; Collet, B.; Ooi, E.L.; Adams, A. Optimisation and standardisation of functional immune assays for striped catfish (Pangasianodon hypophthalmus) to compare their immune response to live and heat killed Aeromonas hydrophila as models of infection and vaccination. Fish Shellfish. Immunol. 2014, 40, 374–383. [Google Scholar] [CrossRef] [PubMed]
  66. Ashfaq, H.; Soliman, H.; Saleh, M.; El-Matbouli, M. CD4: A vital player in the teleost fish immune system. Vet. Res. 2019, 50, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Silva, B.C.; Martins, M.L.; Jatobá, A.; Buglione Neto, C.C.; Vieira, F.N.; Pereira, G.V.; Jerônimo, G.T.; Seiffert, W.Q.; Mouriño, J.L.P. Hematological and immunological responses of Nile tilapia after polyvalent vaccine administration by different routes. Pesqui. Veterinária Bras. 2009, 29, 874–880. [Google Scholar] [CrossRef]
  68. Engelsma, M.Y.; Huising, M.O.; Van Muiswinkel, W.B.; Flik, G.; Kwang, J.; Savelkoul, H.F.; Verburg-van Kemenade, B.L. Neuroendocrine–immune interactions in fish: A role for interleukin-1. Vet. Immunol. Immunopathol. 2002, 87, 467–479. [Google Scholar] [CrossRef] [PubMed]
  69. Zou, J.; Secombes, C.J. The function of fish cytokines. Biology 2016, 5, 23. [Google Scholar] [CrossRef]
  70. Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in inflammatory disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef] [Green Version]
  71. Jun, J.W.; Kang, J.W.; Giri, S.S.; Yun, S.; Kim, H.J.; Kim, S.G.; Kim, S.W.; Han, S.J.; Kwon, J.; Oh, W.T. Immunostimulation by starch hydrogel-based oral vaccine using formalin-killed cells against edwardsiellosis in Japanese eel, Anguilla japonica. Vaccine 2020, 38, 3847–3853. [Google Scholar] [CrossRef]
  72. Weiss, J. Bactericidal/permeability-increasing protein (BPI) and lipopolysaccharide-binding protein (LBP): Structure, function and regulation in host defence against Gram-negative bacteria. Biochem. Soc. Trans. 2003, 31, 785–790. [Google Scholar] [CrossRef] [Green Version]
  73. Watson, J.; Riblet, R. Genetic Control of Responses to Bacterial Lipopolysaccharides in Mice: I. Evidence for a Single Gene that Influences Mitogenic and Immunogenic Respones to Lipopolysaccharides. J. Exp. Med. 1974, 140, 1147–1161. [Google Scholar] [CrossRef] [Green Version]
  74. Baba, T.; Imamura, J.; Izawa, K.; Ikeda, K. Immune protection in carp, Cyprinus carpio L., after immunization with Aeromonas hydrophila crude lipopolysaccharide. J. Fish Dis. 1988, 11, 237–244. [Google Scholar] [CrossRef]
  75. Zhang, D.; Gao, Y.; Li, Q.; Ke, X.; Liu, Z.; Lu, M.; Shi, C. An effective live attenuated vaccine against Streptococcus agalactiae infection in farmed Nile tilapia (Oreochromis niloticus). Fish Shellfish. Immunol. 2020, 98, 853–859. [Google Scholar] [CrossRef] [PubMed]
  76. Kim, D.; Beck, B.R.; Lee, S.M.; Jeon, J.; Lee, D.W.; Lee, J.I.; Song, S.K. Pellet feed adsorbed with the recombinant Lactococcus lactis BFE920 expressing SiMA antigen induced strong recall vaccine effects against Streptococcus iniae infection in olive flounder (Paralichthys olivaceus). Fish Shellfish. Immunol. 2016, 55, 374–383. [Google Scholar] [CrossRef] [PubMed]
  77. Kole, S.; Qadiri, S.S.N.; Shin, S.-M.; Kim, W.-S.; Lee, J.; Jung, S.-J. Nanoencapsulation of inactivated-viral vaccine using chitosan nanoparticles: Evaluation of its protective efficacy and immune modulatory effects in olive flounder (Paralichthys olivaceus) against viral haemorrhagic septicaemia virus (VHSV) infection. Fish Shellfish. Immunol. 2019, 91, 136–147. [Google Scholar] [CrossRef] [PubMed]
Fishes 07 00398 g001 550
Figure 1. The activity (µg mL−1) of lysozyme and peroxidase in skin mucus of Nile tilapia 15 d post-vaccination. Treatment 1 (T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion vaccine, Treatment 3 (T3)—formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4 (T4)—formalin-killed S. agalactiae water-based oral vaccine. The presence of different letters in each group indicates a significant difference (p < 0.05). SMLA, skin mucus lysozyme activity; SMPA, skin mucus peroxidase activity.
Figure 1. The activity (µg mL−1) of lysozyme and peroxidase in skin mucus of Nile tilapia 15 d post-vaccination. Treatment 1 (T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion vaccine, Treatment 3 (T3)—formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4 (T4)—formalin-killed S. agalactiae water-based oral vaccine. The presence of different letters in each group indicates a significant difference (p < 0.05). SMLA, skin mucus lysozyme activity; SMPA, skin mucus peroxidase activity.
Fishes 07 00398 g001
Fishes 07 00398 g002 550
Figure 2. Serum immunity parameters of Nile tilapia post-vaccination (µg mL−1). Treatment 1 (T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion vaccine, Treatment 3 (T3)—formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4 (T4)—formalin-killed S. agalactiae water-based oral vaccine. The presence of different letters in each group indicates a significant difference (p < 0.05). SL, serum lysozyme activity; SP, serum peroxidase activity; ACH50, alternative complement activity; RB, respiratory burst activity; PI, phagocytosis activity.
Figure 2. Serum immunity parameters of Nile tilapia post-vaccination (µg mL−1). Treatment 1 (T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion vaccine, Treatment 3 (T3)—formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4 (T4)—formalin-killed S. agalactiae water-based oral vaccine. The presence of different letters in each group indicates a significant difference (p < 0.05). SL, serum lysozyme activity; SP, serum peroxidase activity; ACH50, alternative complement activity; RB, respiratory burst activity; PI, phagocytosis activity.
Fishes 07 00398 g002
Fishes 07 00398 g003 550
Figure 3. Comparative mRNA transcript levels of three immune-related genes (IL-1, IL-8, and LBP) in the livers of the vaccinated and control fish post-immunization. The 18S rRNA was used as an internal control gene. Significant differences between the treatment groups are denoted by different letters (p < 0.05).
Figure 3. Comparative mRNA transcript levels of three immune-related genes (IL-1, IL-8, and LBP) in the livers of the vaccinated and control fish post-immunization. The 18S rRNA was used as an internal control gene. Significant differences between the treatment groups are denoted by different letters (p < 0.05).
Fishes 07 00398 g003
Fishes 07 00398 g004 550
Figure 4. Kaplan–Meier analysis of O. niloticus (n = 10) challenged with S. agalactiae after 15 days of immunization. Treatment 1 (T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion vaccine, Treatment 3 (T3)—formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4 (T4)—formalin-killed S. agalactiae water-based oral vaccine.
Figure 4. Kaplan–Meier analysis of O. niloticus (n = 10) challenged with S. agalactiae after 15 days of immunization. Treatment 1 (T1)—control, Treatment 2 (T2)—formalin-killed S. agalactiae immersion vaccine, Treatment 3 (T3)—formalin-killed S. agalactiae injectable oil-based vaccine, Treatment 4 (T4)—formalin-killed S. agalactiae water-based oral vaccine.
Fishes 07 00398 g004
Table
Table 1. Approximate composition and formulation of the experimental diets (g kg−1).
Table 1. Approximate composition and formulation of the experimental diets (g kg−1).
ConstituentsBasal Diet
Soybean meal390
Corn meal200
Fish meal150
Rice bran150
Wheat flour70
Cellulose 20
Premix10
Vitamin C 98%5
Soybean oil5
Approximate component of dietary treatment (g kg−1 dry matter basis)
Gross energy (Cal/g)3892
Dry matter991.83
Crude protein322.28
Ash84.90
Fiber43.47
Crude lipid38.56
Table
Table 2. Primers used for RT-qPCR analysis.
Table 2. Primers used for RT-qPCR analysis.
PrimersOligo Sequence (5′-3′)GenesTm (°C)Size (bp)
18S rRNAF: GTGCATGGCCGTTCTTAGTT
R: CTCAATCTCGTGTGGCTGAA		18S RNA60150
IL-1F: GTCTGTCAAGGATAAGCGCTG
R: ACTCTGGAGCTGGATGTTGA		IL-159200
IL-8F: CTGTGAAGGCATGGGTGTG
R: GATCACTTTCTTCACCCAGGG		IL-859196
LBPF: ACCAGAAACTGCGAGAAGGA
R: GATTGGTGGTCGGAGGTTTG		LBP59200
F: forward, R: reverse, bp: base pair.
Table
Table 3. Statistical significance among dietary treatment groups using a log-rank test.
Table 3. Statistical significance among dietary treatment groups using a log-rank test.
Treatment GroupsStatistical Analysis
T1T2T3
T20.000 *
T30.000 *0.120 ns
T40.000 *0.624 ns0.290 ns
“*” indicates a statistical significance (p < 0.05) and “ns” denotes no statistically significant differences.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Linh, N.V.; Dien, L.T.; Dong, H.T.; Khongdee, N.; Hoseinifar, S.H.; Musthafa, M.S.; Dawood, M.A.O.; Van Doan, H. Efficacy of Different Routes of Formalin-Killed Vaccine Administration on Immunity and Disease Resistance of Nile Tilapia (Oreochromis niloticus) Challenged with Streptococcus agalactiae. Fishes 2022, 7, 398. https://doi.org/10.3390/fishes7060398

AMA Style

Linh NV, Dien LT, Dong HT, Khongdee N, Hoseinifar SH, Musthafa MS, Dawood MAO, Van Doan H. Efficacy of Different Routes of Formalin-Killed Vaccine Administration on Immunity and Disease Resistance of Nile Tilapia (Oreochromis niloticus) Challenged with Streptococcus agalactiae. Fishes. 2022; 7(6):398. https://doi.org/10.3390/fishes7060398

Chicago/Turabian Style

Linh, Nguyen Vu, Le Thanh Dien, Ha Thanh Dong, Nuttapon Khongdee, Seyed Hossein Hoseinifar, Mohamed Saiyad Musthafa, Mahmoud A. O. Dawood, and Hien Van Doan. 2022. "Efficacy of Different Routes of Formalin-Killed Vaccine Administration on Immunity and Disease Resistance of Nile Tilapia (Oreochromis niloticus) Challenged with Streptococcus agalactiae" Fishes 7, no. 6: 398. https://doi.org/10.3390/fishes7060398

APA Style

Linh, N. V., Dien, L. T., Dong, H. T., Khongdee, N., Hoseinifar, S. H., Musthafa, M. S., Dawood, M. A. O., & Van Doan, H. (2022). Efficacy of Different Routes of Formalin-Killed Vaccine Administration on Immunity and Disease Resistance of Nile Tilapia (Oreochromis niloticus) Challenged with Streptococcus agalactiae. Fishes, 7(6), 398. https://doi.org/10.3390/fishes7060398

Article Metrics

Back to TopTop