Next Article in Journal
Length-Weight Relationships and Other Morphological Traits of Fishes in the Mangrove of Hainan, China
Next Article in Special Issue
Nutritional Value of Dry Fish in Bangladesh and Its Potential Contribution to Addressing Malnutrition: A Narrative Review
Previous Article in Journal
Development and Validation of a Quantitative Polymerase Chain Reaction Assay for the Detection of Red Sea Bream Iridovirus
Previous Article in Special Issue
Passionfruit (Passiflora edulis) Peel Powder Stimulates the Immune and Antioxidant Defense System in Nile Tilapia, Oreochromis niloticus, Cultivated in a Biofloc System
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 7
Issue 5
10.3390/fishes7050237
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Improving Growth, Digestive and Antioxidant Enzymes and Immune Response of Juvenile Grass Carp (Ctenopharyngodon idella) by Using Dietary Spirulina platensis

by
Mehwish Faheem
1,*,
Rafia Jamal
1,
Nadia Nazeer
1,
Saba Khaliq
2,
Seyed Hossein Hoseinifar
3,*,
Hien Van Doan
4,5 and
Marina Paolucci
6
1
Department of Zoology, Government College University, Lahore 54000, Pakistan
2
Department of Physiology and Cell Biology, University of Health Sciences, Lahore 54600, Pakistan
3
Department of Fisheries, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan 49189-43464, Iran
4
Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
5
Science and Technology Research Institute, Chiang Mai University, 239 Huay Keaw Rd., Suthep, Muang, Chiang Mai 50200, Thailand
6
Department of Science and Technology, University of Sannio, Via Port’Arsa 11, 82100 Benevento, Italy
*
Authors to whom correspondence should be addressed.
Fishes 2022, 7(5), 237; https://doi.org/10.3390/fishes7050237
Submission received: 16 July 2022 / Revised: 22 August 2022 / Accepted: 25 August 2022 / Published: 5 September 2022
(This article belongs to the Special Issue Fish Nutrition and Feed Technology)
Browse Figures
Versions Notes

Abstract

:
The present study was designed to investigate the effect of Spirulina platensis (SP) supplemented diets on the growth performance, digestive enzymes, hepatic antioxidants and innate immunity biomarkers in juvenile grass carp (Ctenopharyngodon idella). Two hundred and forty grass carp juveniles (average weight 4.81 ± 0.13 g) were divided into four treatment groups in triplicates (20 fish/replicate) and fed with diets containing 0, 1, 5, and 10% Spirulina for 90 days. A significant increase in growth (p < 0.05) was observed in fish fed with diets having 1 and 5% Spirulina. Intestinal protease and lipase activities increased significantly (p < 0.01) in fish fed with a diet having 5% Spirulina while intestinal amylase activity increased significantly (p < 0.01) in fish fed with diets having 1, 5, and 10% Spirulina. Hepatic lipid peroxidation decreased significantly (p < 0.05) in fish fed with a 1 and 5% Spirulina supplemented diet. The activity of catalase, glutathione-S-transferase, and glutathione levels increased significantly (p < 0.05) in the livers of fish fed with 1% Spirulina supplemented diets while no significant difference (p > 0.05) was observed for hepatic superoxide dismutase levels when compared to the control. Significant increases in the skin mucus protease (p < 0.05), antiprotease (p < 0.01), lysozyme (p < 0.001), and peroxidase (p < 0.05) activities were observed in fish fed with 5% Spirulina-supplemented diets. Gene expression analysis of head kidney showed that fish fed with a 1% Spirulina diet had significantly (p < 0.01) higher expression of tnf-α, il-8, and inf-γ. In conclusion, the present study suggested that the inclusion of 5% Spirulina platensis in the diet of grass carp has positive effects on growth, digestive enzymes, antioxidants, and innate immunity.

1. Introduction

The world population is increasing at a tremendous rate and is expected to hit 10 billion people by 2050 [1]. Food supply, especially animal-based protein, will be crucial in the coming decades. The global demand for animal-derived protein will be doubled by 2050 which is expected to intensify pressure on the need to produce more animal-based protein [2]. Fish and shellfish are the primary sources of protein for approximately 950 million people worldwide [3]. Aquaculture is expanding faster than any other food-producing sector, and intensive aquaculture has the potential to provide animal-based protein to an exponentially growing human population [4,5]. As stocking density is high in an intensive culture system, this may lead to crowding stress. Crowding stress along with poor water quality results in the emergence of disease outbreaks that inflict significant financial losses [6].
Infectious diseases have always been a great threat in intensive animal production systems [7,8,9,10,11]. Antibiotics are used to treat diseases and reduce pathogens and disease incidences [12] but antibiotic resistance has become a global issue in humans as well as poultry, livestock, and aquaculture [13,14,15]. Many researchers are now trying to discover sustainable alternatives to antibiotics [16,17,18,19,20,21]. The use of medicinal plants, macro and microalgae, herbs, and probiotics as oral immunostimulants has gained a great deal of interest throughout the globe [22,23]. Phenol, polyphenol, quinone, alkaloid, terpenoid, polypeptide compounds and lectin are present in algae, certain medicinal plants, and their by-products which promote growth, enhance the antioxidant status, and stimulate the immune system, thus providing a sustainable alternative to vaccines and antibiotics [24,25].
Algae and other plant-based feed additives are able to promote the growth of fish [26,27,28,29], protect against diseases [29,30], strengthen the immune system [22,26,31,32,33], stimulate hunger and enhance feed consumption [34,35], reduce stress [36,37,38] and improve digestion by increasing secretion of different digestive enzymes [39,40,41]. They also have antimicrobial and antiviral properties [39,42,43,44]. Algae and other plants are cheaper, eco-friendly, have minimum side effects, and are frequently used as substitutes to the costly antibiotics in fish health management. The World Health Organization (WHO) encourages the use of supplementary diets combined with algae and medicinal herbs or plants, which minimize the application of chemicals in fish diet [45].
Spirulina is a filamentous blue-green algae, which has the potential to be used in aquafeed as a growth promoter and immunostimulant [46,47,48,49,50]. Dried Spirulina powder has high protein content (up to 55–70% of dry weight). It also contains a high amount of gamma-linolenic acid (GLA), polysaccharides, phycobiliproteins, carotenoids, vitamins (especially B12), pigments such as carotenoids, and minerals. Some studies also reported the immune-stimulating effect of Spirulina in several fish species [5,47,51,52,53,54], but to the best of our knowledge, no study has been performed using Ctenopharyngodon idella, commonly known as grass carp. We hypothesized that grass carp, a herbivorous cyprinid, can show better digestive and physiological status after feeding with algal-based feed. Therefore, this study was performed to evaluate the effect of feeding Spirulina-based diets on the growth, physiology, and immunity of grass carp.

2. Materials and Methods

2.1. Fish Culture and Diet Preparation

A three-month feeding trial was carried out at the Animal House fish rearing facility, Department of Zoology, Government College University Lahore Campus. Fish were provided by the Himalaya Fish Hatchery, Muridke. For acclimation purposes, fish were kept in laboratory conditions for two weeks and treated with potassium permanganate to avoid any infections. During this time, fish were fed with a basal (control) diet twice a day at a rate of 3% of body weight. Temperature (20 °C), pH (7.8), electrical conductivity (618 µS/cm), and dissolved oxygen (5.7 mg/L) were measured with the help of digital meters during the experiment.
Feed was prepared by using ingredients bought from the local market. Dried Spirulina powder (Naturya Organic Superfoods) was purchased from a local organic store. Dried Spirulina was added to the fish feed and four diets were prepared with 0%, 1%, 5%, and 10% Spirulina supplementation. The inclusion of Spirulina in the diet was selected based on previously published literature [53,54]. Ingredients were ground into a fine powder and mixed together. After mixing, pellets were formed manually using a mincer. Pellets were shade dried for 48 h and were preserved in zipper bags for further use.
The diet samples were homogenized using a pestle and mortar and were analyzed by standard methods of AOAC [55]. Moisture was determined by oven-drying at 105 °C for 12 h. Crude protein (N × 6.25) was estimated by micro Kjeldahl’s apparatus. Ash was determined by ignition samples at 650 °C for 12 h (Eyela-TMF 3100) to constant weight. Crude fat was determined by the petroleum ether extraction method through the Soxtec HT2 1045 system. The carbohydrate content of the feed was measured by subtracting the % values of nutrients (moisture, protein, fat, ash) from 100. The composition and proximate analysis of Spirulina powder and feed are given in Table 1.

2.2. Experimental Setup

After the acclimatization of two weeks, fish were anesthetized using clove oil and weighed individually. Fish with almost equal weight (initial weight 4.81 g ± 0.13) were stocked in a glass aquarium (20 fingerlings/group) filled with 60 L of water. Experiments were performed in triplicates; therefore, 12 aquariums were set with 20 fish in each aquarium. All aquariums were supplied with air stones to maintain dissolved oxygen. The feeding trial was started 24 h post stocking in the aquarium. Fish were fed twice a day (8–9 am and 3–4 pm) at a rate of 3% of body weight. The feeding ration was adjusted fortnightly according to the weight of the fish. The control was fed with a basal diet having 0% Spirulina powder, while groups II, III, and IV were fed with a diet containing 1, 5, and 10% Spirulina, respectively.
The feeding regime was continued for 90 days. The aquaria were siphoned every other day to remove the uneaten feed particles.

2.3. Analysis of Growth

At the end of 90 days of the feeding trial, fish from each aquarium were anesthetized using clove oil [56], and weight and length were recorded again to calculate growth. Growth parameters were recorded using the following formulas:
Weight gain (g) = W2 − W1
where W2 is the final weight and W1 is the initial weight;
Specific growth rate (SGR; %g/day) = 100 (Ln W2(g) − Ln W1(g))/T
where W2 is the final weight (g), W1 is the initial weight (g), and T is the experimental period (day); Thermal growth coefficient = 100 (final body weight1/3 − initial body weight1/3/experimental days × mean daily temperature); Condition factor (K) = 100 × (body weight; g)/(body length; cm3); Fish survival (%) = 100 (Number of fish at the end of trial/number of fish at the start of trial).

2.4. Analysis of Mucus Immunity

Mucus samples were collected at the end of the feeding trial for the determination of the innate immune response. To collect mucus samples, individual fish were added to a polythene bag having 10 mL of sterile saline solution. Fish were rubbed gently and all liquid was transferred to 50 mL falcon tubes and centrifuged. The supernatant was collected and used for the analysis of lysozyme, protease, antiprotease, and peroxidase activity as described in our previous work [57]. Briefly, lysozyme activity was measured using Micrococcus luteus. Change in turbulence was recorded using a spectrophotometer at 450 nm. Lysozyme activity was expressed as units/mL. For protease activity, mucus samples were incubated with azocasein, ammonium bicarbonate, and trichloroacetic acid. The reaction was stopped using NaOH. Optical density was recorded at 450 nm. Antiprotease activity was measured using trypsin as a substrate and optical density was recorded at 450 nm. For peroxidase activity, mucus samples were incubated with 3,3′,5,5′-tetramethylbenzidine (TMB) and Hank’s Balanced Salt Solution (without Ca2+ or Mg2+). Sulphuric acid was used to stop the reaction and optical density was recorded at 450 nm.
After the collection of mucus samples, fish were dissected and the intestine, liver, and kidneys were harvested and stored in pre-labelled Eppendorf’s at −80 °C. The intestine was used for the estimation of digestive enzymes; liver tissue was used for antioxidant analysis, while kidney tissue was used for the expression of immune-related genes.

2.5. Oxidative Stress and Antioxidant Defense Markers Assessment

The liver was used for the assessment of antioxidative enzymes. Tissue samples were weighed and homogenized in 0.1M phosphate buffer (pH 7.4) to make 10% homogenate. A portion of the homogenate (500 µL) was used to estimate lipid peroxidation while the remaining homogenate was centrifuged at 13,000 rpm at 4 °C for 30 min. The supernatant was collected and stored in clean Eppendorf’s and used for the estimation of glutathione, catalase, glutathione-S-transferase, and superoxide dismutase [56,58,59]. Protein content in the supernatant was measured using Bradford reagent.

2.6. Analysis of Digestive Enzymes

The whole intestine of ten fish from each aquarium/replicate (n = 30 for each treatment group) was extracted and kept in prelabeled, sterile falcon tubes and weighed. The entire procedure was performed on ice. A double amount of saline solution (0.86%) was added to each sample, homogenized, and centrifuged at a maximum speed of 4 °C. The supernatant was removed and stored at −80 until analysis of digestive enzymes [41].
Protease activity was measured according to [60], and the reaction mixture of 0.2 mL of supernatant and 0.2 mL of freshly prepared azocasein was taken in an Eppendorf. The sample was incubated in a water bath for 30 min at 30 °C. TCA (1.2 mL) was added and incubated for 30 min at room temperature. The reaction mixture (1.5 mL) was then centrifuged at a maximum speed for 10 min. The supernatant (1 mL) was taken in a cuvette and an equal volume of NaOH was added. Absorbance was recorded at 450 nm.
For amylase activity, 1.8 mL of 0.1M sodium phosphate buffer, 0.1 mL of 1% starch solution (substrate), and 0.1 mL of enzyme source were taken in an Eppendorf. The reaction mixture was incubated for 30 min at 37 °C. The reaction was stopped by adding 2 mL of dinitro salicylic acid (DNS). The sample was then heated in a boiling water bath for 5 min and cooled. A volume of 10 mL of water was added to the sample; a brown color appeared. Absorbance was recorded at 540 nm [61].
Lipase activity was measured according to Dar et al. [61]. Briefly, the reaction mixture consists of homogenate (1 mL), phosphate buffer (0.5 mL), and olive oil emulsion (2 mL). The mixture was shaken well and incubated at 37 °C for 24 h. The mixture was titrated using NaOH (0.0.5N) using phenolphthalein as an indicator. The milliliter equivalent of alkali consumed was taken as a measure of the activity of lipase.

2.7. Expression Analysis of Immune-Related Genes

Head kidney (100 mg) from 5 fish per replicate (n = 15 per treatment group) was used to extract RNA with Trizol reagent. Quality and quantity of RNA were checked on nanodrop (Thermo Fisher Scientific). First-strand complementary DNA was synthesized using a commercially available RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific). Resultant cDNA was diluted 10 times and used to study relative gene expression. Primer sequence, accession number, and annealing temperature of genes are listed in Table 2. Primers were validated using conventional PCR. Real-time PCR was used to analyze mRNA levels of selected immune-related genes and housekeeping genes. The reaction mixture (20 µL) contained syber green master mix (10 µL), cDNA (1 µL), and 1 µL forward and reverse primers. The expression of tumor necrosis factor-α, interleukin-8, and interferon-γ was estimated by the 2−ΔΔct method [62]. Actin-β was used as a reference control. Each sample was analyzed in triplicate.

2.8. Statistical Analysis

All the data of growth and biochemical parameters are represented as mean ± S.E.M. ANOVA followed by Tukey’s test was used to report statistical differences among groups. Statistical difference p < 0.05 is represented with a single asterisk (*), while double (**) and triple (***) asterisks represent statistical differences of p < 0.01 and p < 0.001, respectively. All the data were analyzed using GraphPad Prism.

3. Results

3.1. Growth Performance

A significant increase in weight gain was recorded in fish fed with 1 and 5% Spirulina powder. However, fish fed with a diet supplemented with 10% Spirulina did not differ statistically from the control. Percentage weight gain was highest in the fish fed with a diet supplemented with 5% Spirulina powder; the polynomial regression equation is y = −2.8202x2 + 32.476x + 54.179; R2 = 0.9259. The survival rate was 100% in all the treatment groups throughout the study period (Table 3). Polynomial regression analysis of dietary inclusion of Spirulina and specific growth rate is y = −0.0102x2 + 0.1117x + 0.3354; R2 = 0.8693 while the polynomial regression equation for feed conversion is y = −0.0061x2 + 0.0658x + 0.1781; R2 = 0.8677.

3.2. Mucus Immunity

After 90 days of feeding a Spirulina-supplemented diet, lysozyme, and anti-protease activity increased significantly in groups fed with 5 and 10% Spirulina. Mucus protease and peroxidase activity increased significantly only in the group fed with 5% Spirulina (Table 4).

3.3. Digestive Enzyme Activity

The activity of digestive enzymes viz protease, lipase, and amylase are shown in Figure 1a–c. A significant increase was reported for intestinal protease activity in fish fed with 5% (p < 0.001) and 10% (p < 0.05) Spirulina powder. Amylase activity increased significantly (p < 0.001) in all treatment groups compared to the control. Intestinal lipase activity increased only in fish fed with 1% (p < 0.05) and 5% (p < 0.001) Spirulina powder (Figure 1c).

3.4. Hepatic Anti-Oxidants

Hepatic lipid peroxidation decreased significantly in all groups, and a significant decrease was recorded in fish fed with 1 and 5% Spirulina powder (Figure 2a). Hepatic superoxide dismutase increased in all groups fed with Spirulina, however, a significant increase was only observed in fish fed with 10% Spirulina powder (Figure 2b). The activity of reduced glutathione increased significantly in the liver of fish fed with 1 and 10% Spirulina powder (Figure 2c). A significant increase in glutathione-S-transferase activity was recorded in fish fed with 1 and 5% Spirulina powder (Figure 2d). Catalase activity was increased only in groups fed with the lowest level of Spirulina (2e) while a non-significant decrease was observed in the liver of fish fed with 5 and 10% Spirulina powder for 90 days.

3.5. Gene Expression

Expression of immune-related genes was recorded in kidney tissue of grass carp after 90 days of feeding with different levels of Spirulina. The mRNA expression of tumor necrosis factor-α increased significantly in the group fed with 1 and 10% Spirulina powder (Figure 3a). A decrease in the mRNA level of interleukin-8 was recorded in the head kidney of fish fed with 1% Spirulina, while no significant difference was observed in groups fed with 5% Spirulina powder, however, the inclusion of 10% Spirulina resulted in a significant increase in mRNA expression of il-8 (Figure 3b). Expression of interferon-γ increased significantly in the head kidney of fish fed with 1 and 5% Spirulina powder (Figure 3c).

4. Discussion

Many algal species, plants, and plant extracts (aqueous, methanolic, ethanolic) are now being successfully used in the aquaculture industry and had a positive effect on fish growth, antioxidant status, immunity, and resistance against water-borne pathogens [26,27,57,63,64,65,66,67,68].
Evaluation of growth performance is one of the important parameters to assess the efficacy of feed additives [36]. In the present work, weight gain, %WG, SGR, and TCR was highest in fish fed with a 1 and 5% S. platensis supplement diet for 90 days. A similar growth-promoting effect was observed in other fish species [49,53,62] fed with Spirulina-supplemented diets (2.5–10%). Food components are also assessed by their ability to be digested and absorbed in the gut, thus promoting growth [69]. The degradation of food in the digestive tract is performed with the assistance of enzymes. Assessment of intestinal enzymes (proteases, lipases, amylases, trypsin, and chymotrypsins) provides information about the physiological status of the gut [70]. The intestinal enzyme activity of grass carp was enhanced after the inclusion of Spirulina in the diet. Previous studies also reported that the inclusion of Spirulina in the diet of aquatic organisms significantly enhanced the digestion and absorption process [47]. An increase in digestive enzymes leads to better nutrient absorption that can explain the growth-promoting effect of Spirulina [47,71] as observed in the present study.
Unfavorable water quality parameters, high stocking density, and other environmental factors can induce oxidative stress in fish. Several antioxidant compounds (glutathione) and enzymes (catalase, superoxide dismutase, glutathione peroxidase, glutathione reductase, etc.) make up the body’s anti-oxidant defense system that detoxifies reactive oxygen and nitrogen species through a series of reaction cascades. Recently, a great deal of research focused on supplementing the fish diet with additives that can enhance the natural anti-oxidant level and alleviate oxidative stress. In the present study, fish were not challenged with any stress but it is generally accepted that an enhanced and better anti-oxidant system will provide better resistance against oxidative stress. In the present study, the level of lipid peroxidation decreased in the fish fed with 1 and 5% Spirulina diets. The activity of catalase, glutathione-S-transferase, and glutathione levels increased significantly (p < 0.05) in fish livers fed with 1% Spirulina-supplemented diets. Spirulina is a rich source of bioactive compounds such as catechins, phycobiliproteins, allophycocyanin, and phycocyanins [72]. Catechins have the ability to chelate metal ions, scavenge reactive oxygen species, and produce antioxidant enzymes [73]. Similarly, phycocyanin and allophycocyanin have the properties of antioxidants [74]. The presence of these bioactive components in Spirulina may be responsible for the improved antioxidant status of grass carp.
The innate immune response provides protection against pathogens. Fish skin mucus is the first line of defense against pathogens. Feeding fish with a diet containing various additives that can enhance the immunity of a mucosal surface [1,5,24,27,33,67,71] has become an active area of research in the last decade. Innate immune enzymes and molecules present in fish skin mucus are lysozymes, esterases, proteases, antiproteases, anti-microbial peptides, and complement proteins [75]. These mucosal enzymes and molecules have strong anti-microbial activity against both Gram-positive and -negative bacteria, thus, improved status of these molecules in mucus may protect the fish against water-borne pathogens.
The grass carp fingerlings fed with 5% Spirulina diets had significantly increased mucosal lysozyme, protease, antiprotease, and peroxidase activities. A similar increase in skin mucosal innate immune biomarkers was reported in other fish species when fed with diets containing Spirulina and our results are consistent with previous studies on other fish species [47,52,76,77]. Many plants and algae are rich in antimicrobial peptides, essential oils, polysaccharides, saponins, and phenolic compounds that are effective against infections. These secondary metabolites modulate the active sites of enzymes and also modulate the receptor sites hence, enhancing immunity [78].
Our gene expression analysis revealed that fish fed with a diet containing 1 and 5% Spirulina powder had higher expression of tnf-α and inf-γ. Tumor necrosis factor-α is a pro-inflammatory cytokine and is used as a biomarker of innate immune status in fish. Tnf-α actively recruits lymphocytes to fight infection and stimulate the cellular and humoral immune response [79]. Similar up-regulation of tnf-α was reported in Nile tilapia, common carp, and rainbow trout when fed with diets supplemented with Spirulina [5,47,51,79,80]. Mast cells are considered an important source for the synthesis and release of cytokines, such as tnf-α [81]. Active compounds such as C-phycocyanin present in Spirulina [82] can influence mast cells which may be responsible for increased expression of tnf-α as observed in the present study. Tumor necrosis factor-α along with interferon-γ and interleukin-8 activate natural killer cells, macrophages, and cytotoxic-T tells and also augment phagocytosis that leads to the inactivation of viruses and eradication of pathogens [23]. An in vitro study revealed that Spirulina induced the secretion of interferon-gamma in the peripheral blood mononuclear cells [83]. Polysaccharides found in many microalgae can increase the expression of pro-inflammatory cytokines, thus acting as immunostimulating agents in aquaculture [84].
In conclusion, the results of the study displayed that the inclusion of Spirulina (up to 5%) is effective for improvement in growth performance, antioxidant, digestive enzymes, and innate immune biomarkers in grass carp.

Author Contributions

M.F and S.H.H. designed the experiment. R.J. and N.N. performed experiments and collected samples under the supervision of M.F. S.K. supervised gene expression studies. M.F. and S.K. prepared the manuscript. S.H.H.; H.V.D. and M.P. reviewed the final draft. All authors have read and agreed to the published version of the manuscript.

Funding

This research did not receive any funding.

Institutional Review Board Statement

The study was approved by the Board of Studies, Department of Zoology GC University, Lahore.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hoseinifar, S.H.; Sun, Y.-Z.; Zhou, Z.; Van Doan, H.; Davies, S.J.; Harikrishnan, R. Boosting immune function and disease bio-control through environment- friendly and sustainable approaches in finfish aquaculture: Herbal therapy scenarios. Rev. Fish. Sci. Aquac. 2020, 28, 303–321. [Google Scholar] [CrossRef]
  2. Henchion, M.; Hayes, M.; Mullen, A.M.; Fenelon, M.; Tiwari, B. Future protein supply and demand: Strategies and factors influencing a sustainable equilibrium. Foods 2017, 6, 53. [Google Scholar]
  3. Pradeepkiran, J.A. Aquaculture role in global food security with nutritional value: A review. Transl. Anim. Sci. 2019, 3, 903–910. [Google Scholar] [PubMed]
  4. FAO—Food and Agricultural Organization. The State of World Fisheries and Aquaculture 2018-Meeting the Sustainable Development Goals; FAO: Rome, Italy, 2018. [Google Scholar]
  5. Al-Deriny, S.H.; Dawood, M.A.O.; Abou Zaid, A.; El-Trasa, W.F.; Paray, B.A.; Van Doan, H.; Mohamed, R.A. The synergistic effects of Spirulina platensis and Bacillus amyloliquefaciens on the growth performance, intestinal histomorphology, and immune response of Nile tilapia (Oreochromis niloticus). Aquac. Rep. 2020, 17, 100390. [Google Scholar]
  6. Holmes, A.H.; Moore, L.S.; Sundsfjord, A.; Steinbakk, M.; Regmi, S.; Karkey, A.; Piddock, L.J. Understanding the mechanisms and drivers of antimicrobial resistance. Lancet 2016, 387, 176–187. [Google Scholar] [PubMed]
  7. Bosila, M.A.; Mekky, H.M.; Fedawy, H.S.; Elbayomi, K.M.; Amer, M.M. Histopathological lesion of arthritis in Mycoplasma synoviae naturally infected breeder chicken in Egypt. Int. J. Vet. Sci 2021, 10, 72–74. [Google Scholar]
  8. Saeed, N.M. Sequence analysis and comparison of infectious bursal disease virus affecting indigenous Kurdish breed and broiler chickens in Sulaymaniyah, Kurdistan Region of Iraq. Pak. Vet. J. 2021, 41, 249–253. [Google Scholar]
  9. Tahir, A.; Khan, M.A.; Bibi, K.; Bibi, S.; Rauf, F.; Ayaz, F. Prevalence of Colibacillosis in Young Broiler Chicks and Antibiogram of Escherichia coli in Different Areas of Hazara Region. Adv. Life Sci. 2021, 8, 238–240. [Google Scholar]
  10. Abu, S.M.; Monira, N.; Asmaul, H.; E-Elahi ATM Mahbub, A.T.M.; Mustafa, K.A.H.; Masudur, R.M. Seroprevalence of Newcastle disease in layer chickens and pathology in clinically affected chickens at Gazipur, Bangladesh. Cont. Vet. J. 2022, 2, 35–41. [Google Scholar]
  11. Ul-Rahman, A.; Shabbir, M.A.B.; Mehmood, A.; Shabbir, M.Z. Genotypic and subgenotypic diversity of avian paramyxoviruses 2, 4 and 6. Pak. Vet. J. 2021, 41, 156–159. [Google Scholar]
  12. Elazab, S.T.; Elshater, N.S.; Hashem, Y.H.; Abdelaziz, A.S. Pharmacokinetics of tildipirosin in healthy and Mycoplasma gallisepticum infected chickens. Int. J. Vet. Sci. 2021, 10, 119–123. [Google Scholar]
  13. Iraqi, M.; Nasef, S.A.; El-Enbaawy, M. Phenotypic and genotypic characteristics of antimicrobial and disinfectant resistance gram-negative bacteria involved in early broiler chick mortality. Int. J. Vet. Sci. 2021, 10, 129–134. [Google Scholar]
  14. Sharif, M.; Tunio, S.A.; Bano, S. Synergistic effects of Zinc oxide nanoparticles and conventional antibiotics against methicillin resistant Staphylococcus aureus. Adv. Life Sci. 2021, 8, 167–171. [Google Scholar]
  15. Betelhem, T.; Shubisa, A.L.; Bari, F.D. Isolation, identification and antimicrobial resistance of Staphylococcus aureus isolates from mastitis cases of lactating dairy cows found in Sululta and Holleta Towns, Oromia, Ethiopia. Agrobiol. Rec. 2022, 8, 27–34. [Google Scholar]
  16. Al-Sarraj, F.M.B. A Review on the impacts of Azadirachta indica on Multi-drug Resistant Extended Spectrum Beta Lactamase positive of Escherichia coli and Klebsiella pneumonia. Adv. Life Sci. 2021, 8, 228–232. [Google Scholar]
  17. Mohamed, H.F.; Atta, A.H.; Darwish, A.S.; Atef, M. Effect of probiotics on the pharmacokinetic aspects and tissue residues of difloxacin in broiler chickens. Pak. Vet. J. 2021, 41, 269–273. [Google Scholar]
  18. Mohsin, M.; Li, L.; Huang, X.; Aleem, M.T.; Habib, Y.J.; Shehata, A.I.; Afzal, M.Z.; Abbas, R.Z.; Abbas, A.; Yin, G. Immunogenicity and protective efficacy of probiotics with EtIMP1C against Eimeria tenella challenge. Pak. Vet. J. 2021, 41, 274–278. [Google Scholar]
  19. Rafay, M.; Ghaffar, M.U.; Abid, M.; Malik, Z.; Madnee, M. Phytochemicals analysis and antimicrobial activities of chinops echinatus from Cholistan desert, Pakistan. Agrobiol. Rec. 2021, 5, 21–27. [Google Scholar]
  20. Rani, Z.; Abbas, R.Z.; Abbas, A.; Saeed, Z.; Rehman, T.; Mehmood, K.; Rehman, A.; Hussain, K. In vitro and in vivo anticoccidial effects of butyric acid and its impact on blood and serum chemistry of broiler chickens. Kafkas. Univ. Vet. Fak. Derg. 2021, 27, 583–588. [Google Scholar]
  21. Rehman, K.; Hamayun, M.; Khan, S.S.; Ahmad, W.S. Efficiency of virgin’s mantle (Fagonia cretica L.) as an antibacterial and antifungal agent. Adv. Life Sci. 2021, 8, 233–237. [Google Scholar]
  22. Ma, K.; Bao, Q.; Wu, Y.; Chen, S.; Zhao, S.; Wu, H.; Fan, J. Evaluation of Microalgae as Immunostimulants and Recombinant Vaccines for Diseases Prevention and Control in Aquaculture. Front. Bioeng. Biotechnol. 2020, 8, 590431. [Google Scholar] [PubMed]
  23. Ahmadifar, E.; Fallah, H.P.; Yousefi, M.; Dawood, M.A.O.; Hoseinifar, S.H.; Adineh, H.; Yilmaz, S.; Paolucci, M.; Van Doan, V. The gene regulatory roles of herbal extracts on the growth, immune system, and reproduction of fish. Animals 2021, 11, 2167. [Google Scholar]
  24. Harikrishnan, R.; Balasundaram, C.; Heo, M.S. Impact of plant products on innate and adaptive immune system of cultured finfish and shellfish. Aquaculture 2011, 317, 1–15. [Google Scholar]
  25. Harikrishnan, R.; Kim, J.S.; Kim, M.C.; Balasundaram, C.; Heo, M.S. Lactuca indica extract as feed additive enhances immunological parameters and disease resistance in Epinephelus bruneus to Streptococcus iniae. Aquaculture 2011, 318, 43–47. [Google Scholar]
  26. Van Doan, H.; Hoseinifar, S.H.; Chitmanat, C.; Jaturasitha, S.; Paolucci, M.; Ashouri, G.; Dawood, M.A.O.; Esteban, M.A. The effects of Thai ginseng, Boesenbergia rotunda powder on mucosal and serum immunity, disease resistance, and growth performance of Nile tilapia (Oreochromis niloticus) fingerlings. Aquaculture 2019, 513, 734388. [Google Scholar]
  27. Van Doan, H.; Lumsangkul, C.; Hoseinifar, S.H.; Hung, T.Q.; Stejskal, V.; Ringø, E.; Dawood, M.A.O.; Esteban, M.A. Administration of watermelon rind powder to Nile tilapia (Oreochromis niloticus) culture under biofloc system: Effect on growth performance, innate immune response, and disease resistance. Aquaculture 2020, 528, 735574. [Google Scholar]
  28. Mohammadi, G.; Rafiee, G.; El Basuini, M.F.; Van Doan, H.; Ahmed, H.A.; Dawood, M.A.O.; Abdel-Latif, H.M.R. Oregano (Origanum vulgare), St John’s-wort (Hypericum perforatum), and lemon balm (Melissa officinalis) extracts improved the growth rate, antioxidative, and immunological responses in Nile tilapia (Oreochromis niloticus) infected with Aeromonas hydrophila. Aquac. Rep. 2020, 18, 100445. [Google Scholar]
  29. Abdel-Tawwab, M.; El-Araby, D.A. Immune and antioxidative effects of dietary licorice (Glycyrrhiza glabra L.) on performance of Nile tilapia, Oreochromis niloticus (L.) and its susceptibility to Aeromonas hydrophila infection. Aquaculture 2021, 530, 735828. [Google Scholar]
  30. Stratev, D.; Zhelyazkov, G.; Noundou, X.S.; Krause, R.W.M. Beneficial effects of medicinal plants in fish diseases. Aquac. Int. 2018, 26, 289–308. [Google Scholar]
  31. Bilen, S.; Altunoglu, Y.C.; Ulu, F.; Biswas, G. Innate immune and growth promoting responses to caper (Capparis spinosa) extract in rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2016, 57, 206–212. [Google Scholar]
  32. Van Doan, H.; Hoseinifar, S.H.; Naraballobh, W.; Jaturasitha, S.; Tongsiri, S.; Chitmanat, C.; Ringø, E. Dietary inclusion of orange peels derived pectin and Lactobacillus plantarum for Nile tilapia (Oreochromis niloticus) cultured under indoor biofloc systems. Aquaculture 2019, 508, 98–105. [Google Scholar]
  33. Srichaiyo, N.; Tongsiri, S.; Hoseinifar, S.H.; Dawood, M.A.O.; Jaturasitha, S.; Esteban, M.A.; Ringø, E.; Van Doan, H. The effects gotu kola (Centella asiatica) powder on growth performance, skin mucus, and serum immunity of Nile tilapia (Oreochromis niloticus) fingerlings. Aquac. Rep. 2020, 16, 100239. [Google Scholar]
  34. Gabriel, N.N.; Qiang, J.; Ma, X.Y.; He, J.; Xu, P.; Liu, K. Dietary Aloe vera improves plasma lipid profile, antioxidant, and hepatoprotective enzyme activities in GIFT-tilapia (Oreochromis niloticus) after Streptococcus iniae challenge. Fish Physiol. Biochem. 2015, 41, 1321–1332. [Google Scholar] [PubMed]
  35. Kuebutornye, F.K.; Abarike, E.D. The contribution of medicinal plants to tilapia aquaculture: A review. Aquac. Int. 2020, 28, 965–983. [Google Scholar]
  36. Sonmez, A.Y.; Bilen, S.; Alak, G.; Hisar, O.; Yanık, T.; Biswas, G. Growth performance and antioxidant enzyme activities in rainbow trout (Oncorhynchus mykiss) juveniles fed diets supplemented with sage, mint and thyme oils. Fish Physiol. Biochem. 2015, 41, 165–175. [Google Scholar] [PubMed]
  37. Awed, E.M.; Sadek, K.M.; Soliman, M.K.; Khalil, R.H.; Younis, E.M.; Abdel-Warith, A.A.-W.; Van Doan, H.; Dawood, M.A.O.; Abdel-Latif, H.M.R. Spirulina platensis Malleviated the oxidative damage in the gills, liver, and kidney organs of Nile tilapia intoxicated with sodium sulphate. Animals 2020, 10, 2423. [Google Scholar]
  38. Yousefi, M.; Abtahi, B.; Adineh, H.; Hoseinifar, S.H.; Mirghaed, A.T.; Paolucci, M.; Van Doan, H. Effects of dietary arginine supplementation on cytokine- and antioxidant-related gene expressions in common carp (Cyprinus carpio) fingerling during ammonia toxicity. Aquac. Res. 2021, 52, 2751–2758. [Google Scholar]
  39. Citarasu, T. Herbal biomedicines: A new opportunity for aquaculture industry. Aquac. Int. 2010, 18, 403–414. [Google Scholar]
  40. Lee, J.Y.; Gao, Y. Review of the application of garlic, Allium sativum, in aquaculture. J. World Aquac. Soc. 2012, 43, 447–458. [Google Scholar]
  41. Xu, A.; Shang-Guan, J.; Li, Z.; Gao, Z.; Huang, Y.C.; Chen, Q. Effects of dietary Chinese herbal medicines mixture on feeding attraction activity, growth performance, nonspecific immunity and digestive enzyme activity of Japanese seabass (Lateolabrax japonicus). Aquac. Rep. 2020, 17, 100304. [Google Scholar]
  42. Kiron, V. Fish immune system and its nutritional modulation for preventive health care. Anim. Feed Sci. Technol. 2012, 173, 111–133. [Google Scholar]
  43. Egamberdieva, D.; Wirth, S.; Behrendt, U.; Ahmad, P.; Berg, G. Antimicrobial activity of medicinal plants correlates with the proportion of antagonistic endophytes. Front. Microbiol. 2017, 8, 199. [Google Scholar] [CrossRef] [PubMed]
  44. Khan, M.F.; Tang, H.; Lyles, J.T.; Pineau, R.; Mashwani, Z.-U.-R.; Quave, C.L. Antibacterial properties of medicinal plants from Pakistan against multidrug-resistant ESKAPE pathogens. Front. Pharmacol. 2018, 9, 815. [Google Scholar] [CrossRef] [PubMed]
  45. Dada, A.A. Improvement of tilapia (Oreochromis niloticus Linnaeus, 1758) growth performance fed three commercial feed additives in diets. J. Aquac. Res. Dev. 2015, 6, 2. [Google Scholar]
  46. Radhakrishnan, S.; Bhavan, P.S.; Seenivasan, C.; Shanthi, R.; Muralisankar, T. Replacement of fishmeal with Spirulina platensis, Chlorella vulgaris and Azolla pinnata on non-enzymatic and enzymatic antioxidant activities of Macrobrachium rosenbergii. J. Basic Appl. Zool. 2014, 67, 25–33. [Google Scholar]
  47. Sheikhzadeh, N.; Mousavi, S.; Oushani, A.K.; Firouzamandi, M.; Mardani, K. Spirulina platensis in rainbow trout (Oncorhynchus mykiss) feed: Effects on growth, fillet composition, and tissue antioxidant mechanisms. Aquac. Int. 2019, 27, 1613–1623. [Google Scholar]
  48. Raji, A.A.; Jimoh, W.A.; Abu Bakar, N.H.; Mohd Taufek, N.H.; Muin, H.; Alias, Z.; Milow, P.; Abdul Razak, S. Dietary use of Spirulina (Arthrospira) and Chlorella instead of fish meal on growth and digestibility of nutrients, amino acids and fatty acids by African catfish. J. Appl. Phycol. 2020, 32, 1763–1770. [Google Scholar]
  49. Xia, Y.; Liu, C.; Fei, S.; Liu, H.; Han, D.; Jin, J.; Yang, Y.; Zhu, X.; Xie, S. Arthrospira platensis additive enhances the growth performance and antioxidant response in hybrid yellow catfish (Pelteobagrus fulvidraco♀ × Pelteobagrus vachelli♂). Aquac. Rep. 2021, 20, 100721. [Google Scholar]
  50. Ragap, H.M.; Khalil, R.H.; Mutawie, H. Immunostimulant effects of dietary Spirulina platensis on tilapia Oreochromis niloticus. J. App. Pharm. Sci. 2012, 2, 26–31. [Google Scholar]
  51. Watanuki, H.; Ota, K.; Tassakka, A.C.M.A.; Kato, T.; Sakai, M. Immunostimulant effects of dietary Spirulina platensis on carp, Cyprinus carpio. Aquaculture 2006, 258, 157–163. [Google Scholar]
  52. Adel, M.; Yeganeh, S.; Dadar, M.; Sakai, M.; Dawood, M.A.O. Effects of dietary Spirulina platensis on growth performance, humoral and mucosal immune responses and disease resistance in juvenile great sturgeon (Huso huso Linnaeus, 1754). Fish Shellfish Immuno. 2016, 56, 436–444. [Google Scholar]
  53. Teimouri, M.; Yeganeh, S.; Mianji, G.R.; Najafi, M.; Mahjoub, S. The effect of Spirulina platensis meal on antioxidant gene expression, total antioxidant capacity, and lipid peroxidation of rainbow trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 2019, 45, 977–986. [Google Scholar] [CrossRef]
  54. Yu, W.; Wen, G.; Lin, H.; Yang, Y.; Huang, X.; Zhou, C.; Zhang, Z.; Duan, Y.; Huang, Z.; Li, T. Effects of dietary Spirulina platensis on growth performance, hematological and serum biochemical parameters, hepatic antioxidant status, immune responses and disease resistance of Coral trout Plectropomus leopardus (Lacepede, 1802). Fish Shellfish Immunol. 2018, 74, 649–655. [Google Scholar] [PubMed]
  55. Association of Official Analytical Chemists. Official Methods of Analysis, 16th ed.; Association of Official Analytical Chemists: Washington, DC, USA, 1995. [Google Scholar]
  56. Latif, M.; Faheem, M.; Asmatullah. Study of oxidative stress and histo-biochemical biomarkers of diethyl phthalate induced toxicity in a culturable fish, Labeo rohita. Pak. Vet. J. 2020, 40, 202–208. [Google Scholar] [CrossRef]
  57. Faheem, M.; Khaliq, S.; Mustafa, N.; Rani, S.; Lone, K.P. Dietary Moringa oleferia leaf meal induce growth, innate immunity and cytokine expression in grass carp, Ctenopharyngodon Idella. Aquac. Nut. 2020, 26, 1164–1172. [Google Scholar]
  58. Faheem, M.; Lone., K.P. Oxidative stress and histopathologic biomarkers of exposure to bisphenol-A in the freshwater fish, Ctenopharyngodon idella. Braz. J. Pharm. Sci. 2017, 53, e17003. [Google Scholar]
  59. Faheem, M.; Zahid, Z.; Ferreira, N.G.C. Toxicity assessment of dibutyl phthalate in grass carp: An integrated biomarker approach. Pak. Vet. J. 2021, 41, 365–371. [Google Scholar]
  60. Allameh, S.K.; Ringø, E.; Yusoff, F.M.; Daud, H.M.; Ideris, A. Dietary supplement of Enterococcus faecalis on digestive enzyme activities, short-chain fatty acid production, immune system response and disease resistance of Javanese carp (Puntius gonionotus, Bleeker 1850). Aquac. Nutr. 2017, 23, 331–338. [Google Scholar]
  61. Dar, S.A.; Srivastava, P.P.; Nazir, M.I.; Jahan, I.; Varghese, T.; Hajam, I.A.; Gupta, S. Modulations of digestive and metabolic enzymes profiles during restriction feeding in Labeo rohita (Hamilton, 1822) fingerlings. N. Am. J. Aquac. 2021, 83, 58–66. [Google Scholar]
  62. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  63. Hoseinifar, S.H.; Yousefi, S.; Capillo, G.; Paknejad, H.; Khalil, M.; Tabarraei, A.; Van Doan, V.H.; Span, N.; Faggio, C. Mucosal immune parameters, immune and antioxidant defence related genes expression and growth performance of zebrafish (Danio rerio) fed on Gracilaria gracilis powder. Fish Shellfish Immunol. 2018, 83, 232–237. [Google Scholar] [PubMed]
  64. Van Doan, H.; Hoseinifar, S.H.; Sringarm, K.; Jaturasitha, S.; Khamlor, T.; Dawood, M.A.O.; Esteban, M.A.; Soltani, M.; Mustha, M.S. Effects of elephant’s foot (Elephantopus scaber) extract on growth performance, immune response, and disease resistance of Nile tilapia (Oreochromis niloticus) fingerlings. Fish Shellfish Immunol. 2019, 93, 328–335. [Google Scholar]
  65. Harikrishnan, R.; Devi, G.; Van Doan, H.V.; Balasundaram, C.; Thamizharasan, S.; Hoseinifar, S.H.; Abdel-Tawwab, M. Effect of diet enriched with Agaricus bisporus polysaccharides (ABPs) on antioxidant property, innate-adaptive immune response and pro-anti inflammatory genes expression in Ctenopharyngodon idella against Aeromonas hydrophila. Fish Shellfish Immunol. 2021, 114, 238–252. [Google Scholar] [PubMed]
  66. Ghafarifarsani, H.; Rashidian, G.; Sheikhlar, A.; Farsani, M.N.; Hoseinifar, S.H.; Van Doan, H.V. The use of dietary oak acorn extract to improve haematological parameters, mucosal and serum immunity, skin mucus bactericidal activity, and disease resistance in rainbow trout (Oncorhynchus mykiss). Aquac. Res. 2021, 52, 2518–2527. [Google Scholar]
  67. Rufchaei, R.; Nedaei, S.; Hoseinifar, S.H.; Hassanpour, S.; Golshan, M.; Bourani, M.S. Improved growth performance, serum and mucosal immunity, haematology and antioxidant capacity in pikeperch (Sander lucioperca) using dietary water hyacinth (Eichhornia crassipes) leaf powder. Aquac. Res. 2021, 52, 2194–2204. [Google Scholar]
  68. Latif, M.; Faheem, M.; Asmatullah; Hoseinifar, S.H.; Van Doan, H. Protective efficacy of Nigella sativa seeds against diethyl phthalate induced growth retardation, oxidative stress and histo-biochemical damages in Labeo rohita. Aquaculture 2021, 533, 736065. [Google Scholar]
  69. Akintunde, E.A. Digestive enzymes in the digestive enzymes in the gut of Sarotherodon galilaeus (syn. Tilapia galilaea, family cichlidae) of the Lake Kainji, Nigeria. Niger. J. Sci. 1985, 18, 22–25. [Google Scholar]
  70. Guzman, C.; Gaxiola, G.; Rosa, C.; Torre-Blanco, A. The effect of dietary protein and total energy content on digestive enzyme activities, growth and survival of Litopenaeus setiferus post larvae. Aquac. Nut. 2005, 7, 113–122. [Google Scholar]
  71. Hoseinifar, S.H.; Dadar, M.; Khalil, M.; Cerezuela, R.; Esteban, M.Á. Effect of dietary supplementation of palm fruit extracts on the transcriptomes of growth, antioxidant enzyme and immune-related genes in common carp (Cyprinus carpio) fingerlings. Aquac. Res. 2017, 48, 3684–3692. [Google Scholar]
  72. Takeuchi, T.; Lu, J.; Yoshizaki, G.; Satoh, S. Effect on the growth and body composition of juvenile tilapia Oreochromis niloticus fed raw Spirulina. Fish Sci. 2002, 68, 34–40. [Google Scholar]
  73. Bernatoniene, J.; Kopustinskiene, D.M. The Role of Catechins in Cellular Responses to Oxidative Stress. Molecules 2018, 23, 965. [Google Scholar]
  74. Esteban, M.A. An overview of the immunological defenses in fish skin. ISRN Immunol. 2012, 2012, 853470. [Google Scholar] [CrossRef]
  75. Renugadevi, K.; Valli Nachiyar, C.; Sowmiya, P.; Sunkar, S. Antioxidant activity of phycocyanin pigment extracted from marine filamentous cyanobacteria Geitlerinema sp TRV57. Biocatal. Agric. Biotechnol. 2018, 16, 237–242. [Google Scholar]
  76. Promya, J.; Chitmanat, C. The effects of Spirulina platensis and Cladophora algae on the growth performance, meat quality and immunity stimulating capacity of the African sharptooth catfish (Clarias gariepinus). Int. J. Agric. Biol. 2011, 13, 77–82. [Google Scholar]
  77. Mahmoud, M.M.; El-Lamie, M.M.; Kilany, O.E.; Dessouki, A.A. Spirulina (Arthrospira platensis) supplementation improves growth performance, feed utilization, immune response, and relieves oxidative stress in Nile tilapia (Oreochromis niloticus) challenged with Pseudomonas fluorescens. Fish Shellfish Immunol. 2018, 72, 291–300. [Google Scholar] [PubMed]
  78. Wink, M. Evolution of toxins and antinutritional factors in plants with special emphasis on Leguminosae. In Poisonous Plants and Related Toxins; CABI Publishing: Oxford, UK, 2004; pp. 1–25. [Google Scholar]
  79. Galindo-Villegas, J.; Mulero, I.; García-Alcazar, A.; Muñoz, I.; Peñalver-Mellado, M.; Streitenberger, S.; Scapigliati, G.; Meseguer, J.; Mulero, V. Recombinant TNFα as oral vaccine adjuvant protects European sea bass against vibriosis: Insights into the role of the CCL25/CCR9 axis. Fish Shellfish Immunol. 2013, 35, 1260–1271. [Google Scholar]
  80. Abdellatief, S.A.; Abdel Rahman, A.N.; Abdallah, F.D. Evaluation of Immunostimulant Activity of Spirulina platensis (Arthrospira platensis) and Sage (Salvia officinalis) in Nile Tilapia (Oreochromis niloticus). Zagazig Vet. J. 2018, 46, 25–36. [Google Scholar]
  81. Shih, C.M.; Cheng, S.N.; Wong, C.S.; Kuo, Y.L.; Chou, T.C. Antiinflammatory and antihyperalgesic activity of C-phycocyanin. Anesth. Analg. 2009, 108, 1303–1310. [Google Scholar]
  82. Liu, Q.; Huang, Y.; Zhang, R.; Cai, T.; Cai, Y. Medical Application of Spirulina platensis Derived C-Phycocyanin. Evid. Based Complement. Alternat. Med. 2016, 7803846. [Google Scholar]
  83. Mao, T.K.; Van De Water, J.; Gershwin, M.E. Effect of Spirulina on the secretion of cytokines from peripheral blood mononuclear cells. J. Med. Food. 2000, 3, 135–140. [Google Scholar]
  84. Mohan, k.; Ravichandran, S.; Muralisankar, T.; Uthayakumar, V.; Chandirasekar, R.; Seedevi, P.; Rajan, D.K. Potential uses of fungal polysaccharides as immunostimulants in fish and shrimp aquaculture: A review. Aquaculture 2019, 500, 250–263. [Google Scholar]
Fishes 07 00237 g001 550
Figure 1. Activity of protease (a), lipase (b) and amylase (c) in the intestine of grass carp fed with various levels of Spirulina supplemented diet for 90 days. Statistical difference p < 0.05 is represented with a single asterisk (*), while triple (***) asterisks represent statistical difference of p < 0.001, (****) represent statisticall difference of p < 0.0001.
Figure 1. Activity of protease (a), lipase (b) and amylase (c) in the intestine of grass carp fed with various levels of Spirulina supplemented diet for 90 days. Statistical difference p < 0.05 is represented with a single asterisk (*), while triple (***) asterisks represent statistical difference of p < 0.001, (****) represent statisticall difference of p < 0.0001.
Fishes 07 00237 g001
Fishes 07 00237 g002 550
Figure 2. Hepatic antioxidant activity of grass carp fed with 0,1,5 and 10% Spirulina for 90 days. Data expressed as mean ± S.E.M *—represent significant difference p < 0.05. **—represent statistical differences of p < 0.01. (a) Lipid peroxidation is expressed as nmol of thiobarbituric acid reactive substance (TBARS) formed. (b) Superoxide dismutase activity. (c) Reduced glutathione level. (d). Glutathione-S-transferase activity is expressed as nmol of 1-chloro-2,4-dinitrobenzene (CDNB) conjugates formed. (e) Catalase activity.
Figure 2. Hepatic antioxidant activity of grass carp fed with 0,1,5 and 10% Spirulina for 90 days. Data expressed as mean ± S.E.M *—represent significant difference p < 0.05. **—represent statistical differences of p < 0.01. (a) Lipid peroxidation is expressed as nmol of thiobarbituric acid reactive substance (TBARS) formed. (b) Superoxide dismutase activity. (c) Reduced glutathione level. (d). Glutathione-S-transferase activity is expressed as nmol of 1-chloro-2,4-dinitrobenzene (CDNB) conjugates formed. (e) Catalase activity.
Fishes 07 00237 g002
Fishes 07 00237 g003 550
Figure 3. Relative mRNA expression of tnf-α (a), il-8 (b) and ifn-γ (c) in head kidney of grass carp fed with 0, 1, 5 and 10% Spirulina for 90 days. Values are presented as mean ± S.E.M. * = p < 0.05; ** = p < 0.01.
Figure 3. Relative mRNA expression of tnf-α (a), il-8 (b) and ifn-γ (c) in head kidney of grass carp fed with 0, 1, 5 and 10% Spirulina for 90 days. Values are presented as mean ± S.E.M. * = p < 0.05; ** = p < 0.01.
Fishes 07 00237 g003
Table
Table 1. Composition of basal and experimental diet (%).
Table 1. Composition of basal and experimental diet (%).
IngredientsControl 1% Spirulina5% Spirulina10% Spirulina
Fish meal 10101010
Wheat flour 2019.51815
Soybean meal 21.52119.518.5
Cottonseed meal6.56.566
Mustard cake 21.521.52120
Fish oil3333
Soya oil4444
Mineral premix a3333
Vitamin premix b3333
Spirulina01510
cellulose4444
Salt 0.50.50.50.5
Molasses3333
Crude protein (%)282828.529
Fat5.55.65.55.7
Ash20.3720.3420.4520.39
Moisture12.8912.7712.612.79
a Each 1000 g of mineral premix contains copper (Cu) 0.25 g, magnesium (Mg) 25 g, calcium (Ca) 0.023 g, zinc (Zn) 2.17 g, manganese (Mn) 10 g, potassium (K) 0.5 g, selenium (Se) 0.01 g, sodium (Na) 120 g. b Each 1000 g of vitamin premix contains Vit A 0.8 g, Vit D3 0.16 g, Vit E 0.38 g, Vit B1 1 g, Vit B2 1.25 g, Vit B12 0.001 g, Vit B3 6.25 g, Vit B6 4 g, Pantothenic acid 54 g, folic acid 5 g.
Table
Table 2. Primer sequence, annealing temperature, product size, and accession number of selected genes.
Table 2. Primer sequence, annealing temperature, product size, and accession number of selected genes.
GenesPrimer SequenceAnnealing Temperature (°C)Product SizeAccession Number
tnf-αGGTGCATACGACCCTGAAGT
TTTTGCCTCCATAGGAATCG		60244JQ040498.1
il-8ATGAGTCTTAGAGGTCTGGGTG
ACAGTGAGGGCTAGGAGGG		60118JN663841
inf-γTGCATGTAGGCGGATATCAA
GAGGGCGCATAAGTCTGAAG		60192FJ695520.1
actin-βACCCACACTGTGCCCATCTACG
ATTTCCCTCTCGGCTGTGGTGG		60146JQ991014.1
Table
Table 3. Growth performance of grass carp fed with 0, 1, 5, and 10% Spirulina for 90 days.
Table 3. Growth performance of grass carp fed with 0, 1, 5, and 10% Spirulina for 90 days.
ParametersControl1% Spirulina5% Spirulina10% Spirulina
Initial body weight (g)4.9 ± 0.1254.975 ± 0.1824.65 ± 0.1754.75 ± 0.153
Final body weight (g)7.393 ± 0.436210.19 ± 0.7686 *11.11 ± 0.7644 ***7.948 ± 0.4511
%-weight gain43.67 ± 8.31092.43 ± 17.92117.8 ± 16.32 **89.09 ± 13.07
SGR0.2874 ± 0.0360.5035 ± 0.0560.6154 ± 0.0370.4401 ± 0.054
Thermal condition factor0.1498 ± 0.0200.2772 ± 0.034 *0.3397 ± 0.024 ***0.2261 ± 0.028
Survival rate (100%)100100100100
Statistical difference p < 0.05 is represented with a single asterisk (*), while double (**) and triple (***) asterisks represent statistical differences of p < 0.01 and p < 0.001, respectively.
Table
Table 4. Skin mucus enzyme activity of grass carp fed with 0, 1, 5, 10% Spirulina for 90 days.
Table 4. Skin mucus enzyme activity of grass carp fed with 0, 1, 5, 10% Spirulina for 90 days.
ParametersControl1%-Spirulina5%-Spirulina10%-Spirulina
Protease (%)51.91 ± 6.1461.86 ± 6.48080.53 ± 6.57 *63.17 ± 7.26
Antiprotease (%)66.78 ± 14.4120.2 ± 13.84152.2 ± 15.36 **130.6 ± 16.77 *
Lysozyme (U/L)2.056 ± 0.3184.5 ± 0.6067.00 ± 1.069 ***5.33 ± 0.991 *
Peroxidase (U/mL)0.2611 ± 0.0300.2951 ± 0.0280.4390 ± 0.057 *0.248 ± 0.049
Statistical difference p < 0.05 is represented with a single asterisk (*), while double (**) and triple (***) asterisks represent statistical differences of p < 0.01 and p < 0.001, respectively.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Faheem, M.; Jamal, R.; Nazeer, N.; Khaliq, S.; Hoseinifar, S.H.; Van Doan, H.; Paolucci, M. Improving Growth, Digestive and Antioxidant Enzymes and Immune Response of Juvenile Grass Carp (Ctenopharyngodon idella) by Using Dietary Spirulina platensis. Fishes 2022, 7, 237. https://doi.org/10.3390/fishes7050237

AMA Style

Faheem M, Jamal R, Nazeer N, Khaliq S, Hoseinifar SH, Van Doan H, Paolucci M. Improving Growth, Digestive and Antioxidant Enzymes and Immune Response of Juvenile Grass Carp (Ctenopharyngodon idella) by Using Dietary Spirulina platensis. Fishes. 2022; 7(5):237. https://doi.org/10.3390/fishes7050237

Chicago/Turabian Style

Faheem, Mehwish, Rafia Jamal, Nadia Nazeer, Saba Khaliq, Seyed Hossein Hoseinifar, Hien Van Doan, and Marina Paolucci. 2022. "Improving Growth, Digestive and Antioxidant Enzymes and Immune Response of Juvenile Grass Carp (Ctenopharyngodon idella) by Using Dietary Spirulina platensis" Fishes 7, no. 5: 237. https://doi.org/10.3390/fishes7050237

Article Metrics

Back to TopTop