Next Article in Journal
Characterization of the Flavor Profile of Bigeye Tuna Slices Treated by Cold Plasma Using E-Nose and GC-IMS
Previous Article in Journal
Multi-Mineral Element Profiles in Genuine and “Bathing” Cultured Chinese Mitten Crabs (Eriocheir sinensis) in Yangcheng Lake, China
Previous Article in Special Issue
Wound-Induced Changes in Antioxidant Enzyme Activities in Skin Mucus and in Gene Expression in the Skin of Gilthead Seabream (Sparus aurata L.)
 
 
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

The Early Immune Response of Lymphoid and Myeloid Head-Kidney Cells of Rainbow Trout (Oncorhynchus mykiss) Stimulated with Aeromonas salmonicida

1
Research Institute for Farm Animal Biology (FBN), Institute of Genome Biology, 18196 Dummerstorf, Germany
2
Friedrich-Loeffler-Institut (FLI), Federal Research Institute for Animal Health, Institute of Immunology, 17493 Greifswald, Germany
3
Faculty of Agriculture and Environmental Sciences, University of Rostock, 18057 Rostock, Germany
*
Authors to whom correspondence should be addressed.
Fishes 2022, 7(1), 12; https://doi.org/10.3390/fishes7010012
Received: 15 November 2021 / Revised: 4 January 2022 / Accepted: 5 January 2022 / Published: 7 January 2022
(This article belongs to the Special Issue New Insights on Fish Immunology)

Abstract

:
The teleost head kidney is a highly relevant immune organ, and myeloid cells play a major role in this organ’s innate and adaptive immune responses. Because of their complexity, the early phases of the innate immune reaction of fish against bacteria are still poorly understood. In this study, naïve rainbow trout were stimulated with inactivated A. salmonicida and sampled at 12 h, 24 h and 7 d poststimulation. Cells from the head kidney were magnetically sorted with a monoclonal antibody mAB21 to obtain one (MAb21-positive) fraction enriched with myeloid cells and one (MAb21-negative) fraction enriched with lymphocytes and thrombocytes. The gene expression pattern of the resulting cell subpopulations was analysed using a panel of 43 immune-related genes. The results show an overall downregulation of the complement pathway and cytokine production at the considered time points. Some of the selected genes may be considered as parameters for diagnosing bacterial furunculosis of rainbow trout.

Graphical Abstract

1. Introduction

Aquaculture is the fastest-growing food production sector, accounting for about half of all food fish consumed globally [1]. Disease outbreaks have been a massive stumbling block to the growth of the aquaculture industry and have severely impacted the industry’s economic expansion in many countries [2]. To prevent pathogenic outbreaks and ensure economic success, fish health management aims for achieving optimum conditions in aquaculture [1]. Although prophylactic methods are currently applied, bacterial, viral and parasitic diseases still occur [3]. Therefore, greater knowledge of the molecular host–pathogen interactions over the course of an infection is critical for developing molecular tools and effective vaccines to prevent and reduce losses because of disease outbreaks.
The fish innate immune system comprises mucosal barriers, several unspecific pathogen-resistance components (pattern recognition receptors, enzymes, complement components, etc.) and cells (monocytes/macrophages, dendritic cells, granulocytes) [4,5]. Upon intraperitoneal (i.p.) stimulation, the innate defence is immediately activated, and myeloid cells, including monocytes/macrophages and granulocytes, are attracted to the peritoneum. Subsequently, lymphoid cells, including B-, T- and NK cells, are activated, which are part of the adaptive immune system. The induction of adaptive immunity involves time-consuming processes, such as cell proliferation, cell differentiation and cell mobilisation [6].
Despite these defence mechanisms, bacteria such as Aeromonas salmonicida ssp. salmonicida, which is the causative agent of furunculosis, can still invade fish. This Gram-negative bacterium causes haemorrhagic and necrotic lesions in the gills, gut and muscle that are highly lethal [7,8]. A closer examination of the virulence factors of A. salmonicida shows a type III secretion system (T3SS). This is a syringe needle–shaped protein complex responsible for the transfer of toxins from the bacterial cytoplasm to the cytoplasm of the host cell. The T3SS effector proteins AexT, AopH, Ati2, AopP, AopO, AopN and ExsE modulate the host’s immune response by interfering with those inflammatory responses initiated by MAP kinases or NF-κB proteins [9,10,11,12] (Figure 1). The ability of macrophages to trigger inflammation and interact with other immune cells is significantly reduced when pathogens block the NF-κB signalling pathways [13].
Certain aspects of the early immune response to A. salmonicida of teleostean cells of myeloid origin remain unclear, for example, their expression profiles and their kinetics during the first 24 h poststimulation (p.s.) with the bacteria. To provide a better understanding of the early immune response to A. salmonicida in rainbow trout (Oncorhynchus mykiss), we investigated two leukocyte fractions from the head kidney at different time points after stimulation with A. salmonicida. To this end, we used a panel of 43 genes representing the most common markers for dendritic cells, macrophages, lymphocytes, thrombocytes, complement components and anti- and proinflammatory factors.

2. Materials and Methods

2.1. Ethics Statement

The experiment was approved by the State Office for Agriculture, Food Safety and Fisheries (approval number LALLF 7221.3-2-042/17), according to the German and European guidelines on animal welfare (Tierschutzgesetz, Tierschutz-Versuchstierverordnung, Directive 2010/63/EU).

2.2. A. Salmonicida for Stimulation Experiments

An aliquot of A. salmonicida ssp. salmonicida (A.s.s.)—the highly virulent strain JF 5505—from stock cryo-preserved batches was cultivated on tryptic soy broth media (TSB, Becton Dickinson, Heidelberg, Germany) at 15 °C for 24 h. Bacterial suspension was inactivated in 1.5% paraformaldehyde (PFA) for 1.5 h at 4 °C, and afterwards, a sample was plated out on TSB agar plates to prove successful inactivation. The inactivated A.s.s. bacteria were washed twice with TSB media by centrifugation at 4000× g for 10 min at 4 °C. The pellet was resuspended in TSB 25% glycerol at a concentration of 1.5 × 108 bacteria/mL. For intraperitoneal immunisation, the bacteria were washed once with phosphate-buffered saline (PBS) and set to a concentration of 1 × 107 bacteria/mL. Injections were prepared under aseptic conditions in sterile 1× PBS.

2.3. Fish

The Born strain of rainbow trout (O. mykiss) weighing 20 g to 100 g was purchased without gender selection from the commercial trout breeding farm Forellenzucht Uthoff GmbH, Neubrandenburg (Germany). The fish were kept in 300 L glass aquaria in a partially recirculating water system at a constant 12 °C and 12 h light:12 h dark period for both the summer and winter experiments. They were fed twice per day with commercial dry food pellets (Aminoforte, Kronen-Fisch, Wesel, Germany). A total of 24 trout were used for the experiments. All manipulations of the fish were done after anaesthesia with benzocaine. The fish received a single i.p. injection containing 100 µL of 1 × 107 bacteria/mL.
The highly virulent strain JF5505 of the inactivated A. salmonicida ssp. salmonicida was diluted in 200 µL PBS, and 5 × 105 CFU were i.p. injected using a 20 G needle. During this stimulation trial, the fish weighed between 30 g and 50 g. The control fish were injected with 200 μL of PBS. At 12 h, 24 h, and 7 d poststimulation, four fish per treatment group were euthanised using an overdose of benzocaine (100 mg/L, Sigma, Steinheim, Germany) (Figure 2) and sampled.

2.4. Sorting of Head Kidney Cells

Pooled suspensions of viable leukocytes from the head kidney of four fish per treatment were prepared, as described previously [13]. Afterwards, 1 × 106 cells were incubated with the monoclonal antibody 21 (MAb21, previously validated as specifically recognising a lineage marker on all cells from myeloid lineage) for 30 min at 4 °C. Then, the cells were washed with 700 µL of MACS Buffer (Miltenyi Biotec, Bergisch Gladbach, Germany) and sedimented by centrifugation for 5 min at 300× g at 4 °C. The cell pellet was resuspended in 200 µL of antimouse IgG magnetic beads (Miltenyi Biotec, Germany) following the manufacturer’s recommendations.
After a final washing step with 700 µL of MACS buffer (as described above), the cells were resuspended in 500 µL of MACS buffer (Miltenyi Biotec, Germany). For magnetic separation in the autoMACS Proseparator (Miltenyi Biotec, Germany), the Possel_S programme was used. The resulting enriched cell fraction (MAb21P, myeloid cells) and depleted cell fraction (MAb21N, lymphocyte and thrombocytes enriched) were centrifuged, and the pellets were resuspended in 350 µL of lysis buffer RLT (Qiagen, Hilden, Germany) for further RNA extraction and gene expression analysis.

2.5. Primer Design and Biomark qPCR Measurements

The qPCR oligonucleotide primers (Table 1) were designed using pyrosequencing assay design software (v.1.0.6; Biotage, Uppsala, Sweden). All the analysed genes were selected based on previous publications on teleosts. Each primer pair was tested prior to RT-qPCR measurements in a standard PCR reaction using the HotStar-Taq (Qiagen, Germany) following a standard protocol. The resulting PCR products were visualised on agarose gels to assess product size and quality. Subsequently, primer pairs were tested in a quantitative PCR analysis using the LightCycler-96 system (Roche, Mannheim, Germany).
The cell pellets were resuspended in 350 μL RLT buffer (Qiagen, Germany) and stored at −70 °C. RNA was isolated from these samples in separate tubes using TRIzol (Invitrogen, Karlsruhe, Germany) and subsequently purified with the ISOLATE II RNA Micro Kit ((Bioline/Meridian Bioscience, Luckenwalde, Germany). The concentrations of the individual RNA aliquots were adjusted at 2 ng/5 µL or 5 ng/5 µL. After cDNA synthesis using the reverse transcription master mix (Fluidigm, South San Francisco, CA, USA), the cDNA aliquots were individually preamplified in 13 (5 ng RNA input) or 15 cycles (2 ng RNA input) using the PreAmp master mix (Fluidigm, CA, USA) and subsequently treated with exonuclease I (New England BioLabs, Ipswich, MA, USA). Multiplex RT-qPCR was conducted using the Biomark HD system and EvaGreen fluorescence dyes (Bio-Rad, Hercules, CA, USA), as previously described [15]. In brief, the 48.48 Fluidigm gene expression biochips were first primed in the MX integrated fluidic circuit (IFC) controller (Fluidigm, South San Francisco, CA, USA) before being loaded with the preamplified cDNA samples and eventually analysed using the Biomark HD instrument (Fluidigm, CA, USA). The raw RT-qPCR results were retrieved with instrument-specific analysis software (v. 3.0.2; Fluidigm, CA, USA). The geometric means of the copy numbers of the reference genes EEF1A1 [16] and RPS5 [17] were used to normalise the expression data.

2.6. Data Analysis

Heatmaps and data visualisation were performed using MacOS GraphPad 9 or Windows, GraphPad Software, San Diego, CA, USA (https://www.graphpad.com, accessed on 1 October 2021).

3. Results

3.1. Basal Expression Profiles of Selected Immune Genes in Two Fractions Enriched in Myeloid Cells or Lymphocytes and Thrombocytes

For the three sampling time points of 12 h, 24 h and 7 d after stimulation with inactivated A. salmonicida, head kidney cells were separated into a MAb21P fraction enriched in myeloid cells and a depleted MAb21N cell fraction comprising mainly lymphocytes and thrombocytes (Figure 3). The purity after magnetic sorting was higher than 95%. Both fractions were used to profile a panel of 43 immune genes using multiplex qPCR.
The basal expression of the selected lineage marker genes validated the successful separation of the myeloid MAb21-positive cell fraction (expressing CD209, LYG and SPI-1) from the MAb21-negative fraction containing thrombocytes (CD36) and B-lymphocytes (CD79b, PAX5) and T-lymphocytes (TCR) (Figure 4).
A comparison of the kinetics of these genes after i.p. injection of PBS indicated that the average basal expression did not change significantly (data not shown).

3.2. Immune Gene Expression Profiling in Two Fractions Enriched in Myeloid Cells or Lymphocytes and Thrombocytes after Stimulation with A. salmonicida

The average expression ratios of the A. salmonicida–treated group compared with the PBS-treated control groups are presented in heatmaps as log2 fold change values (Figure 5 and Figure 6).
Generally, the expression patterns in both the MAb21P and MAb21N fractions did not change strongly after intraperitoneal stimulation.
Compared with the PBS control groups, CD209 was upregulated in the MAb21P fraction at 24 h p.s. (log2 FC = 1.5) and 7 d p.s. (log2 FC = 3.2), while CD80/86 was downregulated at 24 h p.s. (log2 FC = −2). After 7 d p.s., the expression levels of LYG, DC-SIGN and SPIC (log2 FC > 2.6) increased. CD83 underwent a strong downregulation at 7 d p.s. (log2 FC = −5), accompanied by a downregulation of DAA/MHCII at 7 d p.s. (log2 FC = −3) (Figure 5).
In the PBS control groups, we did not detect CFI, IL10 or IL12 at 12 h p.s.; CFH, C3-1, C1r/s, CD59, SERPING1, CFI, A2M or IL12 at 24 h p.s.; and IL10 at 7 d p.s. IL4/13 was not detectable in the controls across all time points.
In the stimulated groups, we did not detect C1r/s, SERPING1 or IL4/13, at 12 h p.s.; CFH, C1r/s, CD59, CFH, C3-1, C1r/s, CD59, SERPING1, CFI or IL4/13 at 24 h p.s.; and CD80/86, C1r/s, CD59, CFI or CXCL8 at 7 d p.s. A2M and IL12 were not detectable in stimulated fish across all time points.

3.3. Expression Profiles of Characteristic Markers in the Cell Fraction Enriched with Lymphocytes and Thrombocytes

The transcript level of TARP was strongly reduced in the MAb21N fraction 24 h p.s. (log2 FC = −3.8), followed by a marked increase 7 d p.s. (log2 FC = 4.5). PAX5 was mildly upregulated in the MAb21N fraction at 24 h p.s. (log2 FC = 0.9), but its expression further increased at 7 d p.s. (log2 FC = 3.5), together with CD18 (log2 FC = 5). CD79B was modestly upregulated across all time points (log2 FC between 0.4 and 1.6). The expression levels of PRF1 increased at 24 h p.s. (log2 FC = 1.3) (Figure 5).
In the PBS control groups, we did not detect PRF1, IL10 or IL12 at 12 h p.s.; CD36, CD94, IL10, CD59, A2M or IL12 at 24 h p.s.; and CD41, CD36, GZMB, PRF1, CD94, CD59, SERPING1, A2M, IL6, CXCL8, IL12 or IL14/13 at 7 d p.s.
In the groups stimulated for 12 h, we did not detect CD94 or SERPING1; both IL10 and IL6 were not detectable at 24 h p.s.; and TARP, CD36, GZMB, CD59, SERPING1, IL6 and IL12 were all not detected at 7 d p.s.

3.4. Expression Patterns of Complement- and Cytokine-encoding Genes in the Two Cell Fractions from the Head Kidney

At 12 h p.s., the levels of CD59 (log2 FC = −2.3) and SOD2 (log2 FC = −1.4) were reduced in the MAb21N fraction. The SERPING1 level was upregulated at 24 h p.s. (log2 FC = 1.1) and strongly downregulated at 7 d p.s. (log2 FC = −4.3). A2M was initially upregulated at 12 h p.s. in the MAb21N (log2 FC = 1.4), followed by a downregulation at 24 h p.s. (log2 FC = −1.7).
The genes encoding cytokines were generally downregulated in both fractions, except for IL1B. This gene was upregulated with a log2 FC of 1.1 (24 h) and 2.8 (7 d) in the MAb21P fraction but simultaneously strongly downregulated (log2 FC of −4.1 at 7 d) in the MAb21N fraction.
In both fractions, CXCL8 and IL4/13 were downregulated after 24 h p.s. (log2 FC < −1.5). IL10 and IL12 were downregulated only at one time point during stimulation in the MAb21N (7 d p.s.) and MAb21P fractions (12 h p.s.), respectively.
RIP2K, SOD2 and RANKL were upregulated (log2 FC ≥ 1.2) in the MAb21P fraction 7 d p.s. NFKBIA levels were downregulated (log2 FC = −2) in the MAb21N fraction but upregulated (log2 FC = 2.5) in the MAb21P fraction at 7 d p.s. SERPINB1 levels were mildly downregulated in both cell fractions (log2 FC < −0.7), followed by a mild upregulation at 7 d p.s. in the MAb21N (log2 FC = 1.5) and MAb21P fractions (log2 FC = 0.7).
The expression of the complement genes in both fractions was generally downregulated, except for CDF, which showed a strong upregulation (log2 FC > 8) at 7 d p.s. in the MAb21P fraction (Figure 6).

4. Discussion

In morphology and function, the head kidney of fish corresponds to the bone marrow of mammals and is one of the most important haematopoietic organs in bony fish. Macrophages and other cells of myeloid origin differentiate in the head kidney. These cells have a core function in innate immunity against a diverse and broad array of pathogens [52] because they are involved in phagocytosis, radical production and cytokine secretion, much like their mammalian counterparts [4].
The aim of the current study was to profile the expression of the specific genes involved in the early immune response of rainbow trout after intraperitoneal stimulation with inactivated A. salmonicida ssp. salmonicida in two fractions of the head kidney: myeloid cells (MAb21P) and lymphocytes/thrombocytes (MAb21N).
Our results show an overall downregulation of the genes characteristic for cells of myeloid origin, except for LYG, SPIC and CD209, which appeared progressively higher expressed at the later time points analysed. CD209 is an important mediator of dendritic cell/T-cell clustering and T-cell activation [53]; SPIC regulates haematopoietic cell differentiation, proliferation and apoptosis [22]; and LYG is involved in the response against bacterial infections [54]. The upregulation of the genes encoding CD209, SPIC and LYG indicates an effective activation of the early immune response, which is supported by the increased expression of the inflammation marker IL1B. The downregulated levels of CD83, CD80/86 and DAA in the cells of myeloid origin may result from restricted NF-κB activation [55] and might indicate the reduced potential of leukocytes to produce cytokines in the head kidney [56,57,58,59]. It is more likely that the observed results indicate that the cells of myeloid origin migrate to the peritoneum to promote the first phase of inflammation at the site of stimulation, thereby leaving only a remaining fraction of unstimulated cells in the head kidney [60].
In the fraction enriched in lymphocytes and thrombocytes, the initially down- and subsequently upregulated level of transcripts coding for T-cell receptor gamma (TARP) could be explained by a process known as ‘state-dependent inactivation’. Following its full downregulation, the T-cell receptor complex adapts to conditions of continuous stimulation [61]. PAX5 and CD79B were progressively upregulated after stimulation. A similar regulation has been previously detected in the Chinese sucker (Myxocyprinus asiaticus) after being stimulated with inactivated Aeromonas hydrophila, suggesting increased levels of signal transduction and B-cell activation [23]. In Nile tilapia challenged with inactivated A. hydrophila [62], integrin β (CD18) was regulated during the early stimulation phase, indicating the recruitment and activation of leukocytes.
The downregulation of CD36 may reflect a specific signalling pathway that activates thrombocytes [63]. Unlike their human counterparts, fish thrombocytes are nucleated cells that can phagocyte and regulate the immune response [64]. Thrombocytes from rainbow trout express genes that encode the proteins involved in activation and aggregation, antigen presentation and immune modulation [65]. CD36 can be downregulated by toll-like receptor (TLR) ligands through TLR-induced cytokines [66], as observed in previous studies [29,67,68].
The early phase of stimulation revealed modulated levels of PRF1 and GZMB in the MAb21N fraction, suggesting the regulation of apoptotic mechanisms by cytotoxic T-lymphocytes and NK cells [31,69].
Complement evasion strategies by pathogenic organisms have previously been reported for different Gram-negative bacteria [35,70]. The expression of complement components in myeloid cells was strongly inhibited in the first 12 h p.s. The strong downregulation of CFH and CFI at each time point analysed might indicate that the inhibition of the complement system by A. salmonicida is not unique to the early stage of an infection. It has been reported that several bacteria, including A. salmonicida, express and modify surface antigens such as outer membrane proteins, capsules and lipopolysaccharide (LPS) to inhibit the complement system [71,72]. Additionally, A. salmonicida may promote the immunosuppressive state of fish [73]. Although we used a highly virulent strain of A. salmonicida, the cells were inactivated. We cannot rule out the possibility that the membrane antigens of A. salmonicida interfered with the proinflammatory response, as reflected by the downregulation of IL6 and a moderately increased IL1B level at the early time points. These proinflammatory cytokines promote the transcription of complement-related genes [74], which were consequently also at low levels. In the myeloid-depleted cell fraction, we did not observe any relevant regulation patterns in the first two time points analysed.
The expression of diverse proinflammatory factors was downregulated in both fractions during the earlier stimulation. The expression of A2M coding for A2-macrotubulin was obviously completely inhibited in the myeloid cell fraction across all phases of stimulation. The acquisition of metal ions by pathogens is vital for their survival. Because A2-macrotubulin binds to iron, zinc and copper, its downregulation may be a further hallmark of the suppressed early immune response by A. salmonicida [41]. All of the above genes maintained essentially the same expression pattern 7 d after stimulation.

5. Conclusions

In conclusion, gene expression profiling in two head kidney cell fractions determined the transcriptional response to inactivated A. salmonicida at different time points. Our results have shown that despite the increased expression levels of myeloid cell markers, the expression of proinflammatory and anti-inflammatory cytokines was lower than in the control groups, which may reflect the migration of activated myeloid cells into the peritoneum. The current study provides valuable information about the immune components that should be targeted when developing and evaluating innovative vaccine formulations to provide effective protection against bacterial pathogens such as A. salmonicida. This will improve the knowledge of the early phase of the immune response to understand the regulation of immune-related genes upon inactivated bacteria stimulations.

Author Contributions

Conceptualisation, F.S., R.M. and A.R.; methodology, F.S., R.M. and S.O.; software, F.S. and A.R.; validation, F.S., B.K. and T.G.; formal analysis, F.S. and S.O.; investigation, F.S., R.M. and S.O.; resources, F.S., A.R., R.M., S.O., B.K. and T.G.; data curation, F.S.; writing—original draft preparation, F.S.; writing—review and editing, R.M., A.R., B.K. and T.G.; visualisation, F.S.; supervision, A.R. and T.G.; project administration, B.K. and T.G.; funding acquisition, B.K. and T.G. All authors have read and agreed to the published version of the manuscript.

Funding

This work of the Campus bioFISCH M—V was financed by the European Maritime and Fisheries Fund (EMFF) and the Ministry of Agriculture and the Environment of Mecklenburg-Western Pomerania, Germany (Grant #: MV-II.1-LM-004). The publication of this article was funded by the Open Access Fund of the Research Institute for Farm Animal Biology (FBN). R.M. was financed by the Scholarship Becas Chile-DAAD: Doctoral scholarship with bilateral agreement abroad CONICYT-DAAD.

Institutional Review Board Statement

All experimental procedures were complied with the relevant European guidelines on animal welfare (Directive 2010/63/EU on the protection of animals used for scientific purposes) and were approved by the Ethics Board of the Friedrich-Loeffler-Institut (FLI) (approval ID: FLI 28/17).

Acknowledgments

We thank B. Schöpel, L. Falkenthal and I. Hennings for their excellent technical assistance.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAO. The State of World Fisheries and Aquaculture 2020; FAO: Rome, Italy, 2020. [Google Scholar]
  2. Scarfe, A.D.; Lee, C.-S.; O’Bryen, P.J. Aquaculture Biosecurity: Prevention, Control, and Eradication of Aquatic Animal Disease; John Wiley & Sons: Hoboken, NJ, USA, 2006. [Google Scholar]
  3. Flores-Kossack, C.; Montero, R.; Köllner, B.; Maisey, K. Chilean Aquaculture and the New Challenges: Pathogens, Immune Response, Vaccination and Fish Diversification. Fish Shellfish Immunol. 2020, 98, 52–67. [Google Scholar] [CrossRef]
  4. Magnadóttir, B. Innate Immunity of Fish (Overview). Fish Shellfish Immunol. 2006, 20, 137–151. [Google Scholar] [CrossRef]
  5. Uribe, C.; Folch, H.; Enriquez, R.; Moran, G. Innate and Adaptive Immunity in Teleost Fish: A Review. Veterinární Med. 2011, 56, 486–503. [Google Scholar] [CrossRef]
  6. Brietzke, A.; Korytář, T.; Jaros, J.; Köllner, B.; Goldammer, T.; Seyfert, H.M.; Rebl, A. Aeromonas salmonicida Infection Only Moderately Regulates Expression of Factors Contributing to Toll-like Receptor Signaling but Massively Activates the Cellular and Humoral Branches of Innate Immunity in Rainbow Trout (Oncorhynchus mykiss). J. Immunol. Res. 2015, 2015, 1–16. [Google Scholar] [CrossRef][Green Version]
  7. Rebl, A.; Korytář, T.; Köbis, J.M.; Verleih, M.; Krasnov, A.; Jaros, J.; Kühn, C.; Köllner, B.; Goldammer, T. Transcriptome Profiling Reveals Insight into Distinct Immune Responses to Aeromonas salmonicida in Gill of Two Rainbow Trout Strains. Mar. Biotechnol. 2014, 16, 333–348. [Google Scholar] [CrossRef]
  8. Janda, J.M.; Abbott, S.L. The Genus Aeromonas: Taxonomy, Pathogenicity, and Infection. Clin. Microbiol. Rev. 2010, 23, 35–73. [Google Scholar] [CrossRef][Green Version]
  9. Galán, J.E.; Lara-Tejero, M.; Marlovits, T.C.; Wagner, S. Bacterial Type III Secretion Systems: Specialized Nanomachines for Protein Delivery into Target Cells. Annu. Rev. Microbiol. 2014, 68, 415–438. [Google Scholar] [CrossRef][Green Version]
  10. Vanden Bergh, P.; Frey, J. Aeromonas salmonicida Subsp. Salmonicida in the Light of Its Type-Three Secretion System. Microb. Biotechnol. 2014, 7, 381–400. [Google Scholar] [CrossRef][Green Version]
  11. Burr, S.E.; Stuber, K.; Wahli, T.; Frey, J. Evidence for a Type III Secretion System in Aeromonas salmonicida Subsp. Salmonicida. J. Bacteriol. 2002, 184, 5966–5970. [Google Scholar] [CrossRef][Green Version]
  12. Frey, J.; Origgi, F.C. Type III Secretion System of Aeromonas salmonicida Undermining the Host’s Immune Response. Front. Mar. Sci. 2016, 3, 130. [Google Scholar] [CrossRef]
  13. Dorrington, M.G.; Fraser, I.D.C. NF-ΚB Signaling in Macrophages: Dynamics, Crosstalk, and Signal Integration. Front. Immunol. 2019, 10, 705. [Google Scholar] [CrossRef]
  14. Abitew, A.M.; Sobti, R.C.; Sharma, V.L.; Wanchu, A. Analysis of Transporter Associated with Antigen Presentation (TAP) Genes Polymorphisms with HIV-1 Infection. Mol. Cell. Biochem. 2020, 464, 65–71. [Google Scholar] [CrossRef][Green Version]
  15. López-Albaitero, A.; Mailliard, R.; Hackman, T.; Filho, P.A.A.; Wang, X.; Gooding, W.; Ferrone, S.; Kalinski, P.; Ferris, R.L. Maturation Pathways of Dendritic Cells Determine TAP1 and TAP2 Levels and Cross-Presenting Function. J. Immunother. 2009, 32, 465–473. [Google Scholar] [CrossRef][Green Version]
  16. Schwenteit, J.M.; Breithaupt, A.; Teifke, J.P.; Koppang, E.O.; Bornscheuer, U.T.; Fischer, U.; Gudmundsdottir, B.K. Innate and Adaptive Immune Responses of Arctic Charr (Salvelinus alpinus L.) during Infection with Aeromonas salmonicida Subsp. Achromogenes and the Effect of the AsaP1 Toxin. Fish Shellfish Immunol. 2013, 35, 866–873. [Google Scholar] [CrossRef]
  17. Schetters, S.T.T.; Kruijssen, L.J.W.; Crommentuijn, M.H.W.; Kalay, H.; Ochando, J.; den Haan, J.M.M.; Garcia-Vallejo, J.J.; van Kooyk, Y. Mouse DC-SIGN/CD209a as Target for Antigen Delivery and Adaptive Immunity. Front. Immunol. 2018, 9, 1. [Google Scholar] [CrossRef]
  18. Buonocore, F.; Randelli, E.; Trisolino, P.; Facchiano, A.; de Pascale, D.; Scapigliati, G. Molecular Characterization, Gene Structure and Antibacterial Activity of a g-Type Lysozyme from the European Sea Bass (Dicentrarchus labrax L.). Mol. Immunol. 2014, 62, 10–18. [Google Scholar] [CrossRef]
  19. Dijkstra, J.M.; Kiryu, I.; Köllner, B.; Yoshiura, Y.; Ototake, M. MHC Class II Invariant Chain Homologues in Rainbow Trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2003, 15, 91–105. [Google Scholar] [CrossRef]
  20. Thomas, E.K.; Ostrowski, M.A.; Yu, Q.; Gu, J.X.; Kovacs, C.; Freedman, J. Cooperation of TNF Family Members CD40 Ligand, Receptor Activator of NF-kappa B Ligand, and TNF-alpha in the Activation of Dendritic Cells and the Expansion of Viral Specific CD8+ T Cell Memory Responses in HIV-1-Infected and HIV-1-Uninfected Individuals. J. Immunol. 2003, 170, 1797–1805. [Google Scholar] [CrossRef][Green Version]
  21. Chistiakov, D.A.; Killingsworth, M.C.; Myasoedova, V.A.; Orekhov, A.N.; Bobryshev, Y.V. CD68/Macrosialin: Not Just a Histochemical Marker. Lab. Investig. 2017, 97, 4–13. [Google Scholar] [CrossRef][Green Version]
  22. Oikawa, T.; Yamada, T.; Kihara-Negishi, F.; Yamamoto, H.; Kondoh, N.; Hitomi, Y.; Hashimoto, Y. The Role of Ets Family Transcription Factor PU.1 in Hematopoietic Cell Differentiation, Proliferation and Apoptosis. Cell Death Differ. 1999, 6, 599–608. [Google Scholar] [CrossRef][Green Version]
  23. Li, H.; Li, Y.; Zhang, X.; Wang, Y.; Zhang, W.; Wu, X.; Wang, Z. Molecular Characterization of the CD79a and CD79b and Its Role against Aeromonas hydrophila Infection in Chinese Sucker (Myxocyprinus asiaticus). Fish Physiol. Biochem. 2017, 43, 1571–1585. [Google Scholar] [CrossRef]
  24. Cobaleda, C.; Schebesta, A.; Delogu, A.; Busslinger, M. Pax5: The Guardian of B Cell Identity and Function. Nat. Immunol. 2007, 8, 463–470. [Google Scholar] [CrossRef]
  25. Szczepański, T.; Langerak, A.W.; Willemse, M.J.; Wolvers-Tettero, I.L.M.; van Wering, E.R.; van Dongen, J.J.M. T Cell Receptor Gamma (TCRG) Gene Rearrangements in T Cell Acute Lymphoblastic Leukemia Reflect “end-Stage” Recombinations: Implications for Minimal Residual Disease Monitoring. Leukemia 2000, 14, 1208–1214. [Google Scholar] [CrossRef][Green Version]
  26. Galván-Peña, S.; Carroll, R.G.; Newman, C.; Hinchy, E.C.; Palsson-McDermott, E.; Robinson, E.K.; Covarrubias, S.; Nadin, A.; James, A.M.; Haneklaus, M.; et al. Malonylation of GAPDH Is an Inflammatory Signal in Macrophages. Nat. Commun. 2019, 10, 1–11. [Google Scholar] [CrossRef][Green Version]
  27. Ji, D.; Yin, J.Y.; Li, D.F.; Zhu, C.T.; Ye, J.P.; Pan, Y.Q. Effects of Inflammatory and Anti-Inflammatory Environments on the Macrophage Mitochondrial Function. Sci. Rep. 2020, 10, 1–13. [Google Scholar] [CrossRef]
  28. Maiguel, D.; Faridi, M.H.; Wei, C.; Kuwano, Y.; Balla, K.M.; Hernandez, D.; Barth, C.J.; Lugo, G.; Donnelly, M.; Nayer, A.; et al. Small Molecule-Mediated Activation of the Integrin CD11b/CD18 Reduces Inflammatory Disease. Sci. Signal. 2011, 4, ra57. [Google Scholar] [CrossRef][Green Version]
  29. Ali, R.A.; Wuescher, L.M.; Worth, R.G. Platelets: Essential Components of the Immune System. Curr. Trends Immunol. 2015, 16, 65. [Google Scholar]
  30. Fink, I.R.; Benard, E.L.; Hermsen, T.; Meijer, A.H.; Forlenza, M.; Wiegertjes, G.F. Molecular and Functional Characterization of the Scavenger Receptor CD36 in Zebrafish and Common Carp. Mol. Immunol. 2015, 63, 381–393. [Google Scholar] [CrossRef]
  31. Voskoboinik, I.; Whisstock, J.C.; Trapani, J.A. Perforin and Granzymes: Function, Dysfunction and Human Pathology. Nat. Rev. Immunol. 2015, 15, 388–400. [Google Scholar] [CrossRef]
  32. Trapani, J.A.; Smyth, M.J. Functional Significance of the Perforin/Granzyme Cell Death Pathway. Nat. Rev. Immunol. 2002, 2, 735–747. [Google Scholar] [CrossRef]
  33. Gunturi, A.; Berg, R.E.; Forman, J. The Role of CD94/NKG2 in Innate and Adaptive Immunity. Immunol. Res. 2004, 30, 29–34. [Google Scholar] [CrossRef]
  34. Köbis, J.M.; Rebl, A.; Kühn, C.; Korytář, T.; Köllner, B.; Goldammer, T. Comprehensive and Comparative Transcription Analyses of the Complement Pathway in Rainbow Trout. Fish Shellfish Immunol. 2015, 42, 98–107. [Google Scholar] [CrossRef]
  35. Almitairi, J.O.M.; Girija, U.V.; Furze, C.M.; Simpson-Gray, X.; Badakshi, F.; Marshall, J.E.; Schwaeble, W.J.; Mitchell, D.A.; Moody, P.C.E.; Wallis, R. Structure of the C1r–C1s Interaction of the C1 Complex of Complement Activation. Proc. Natl. Acad. Sci. USA 2018, 115, 768–773. [Google Scholar] [CrossRef][Green Version]
  36. Tian, B.; Nowak, D.E.; Jamaluddin, M.; Wang, S.; Brasier, A.R. Identification of Direct Genomic Targets Downstream of the NF-Kappa B Transcription Factor Mediating TNF Signaling. J. Biol. Chem. 2005, 280, 17435–17448. [Google Scholar] [CrossRef][Green Version]
  37. Bao, J.; Pan, G.; Poncz, M.; Wei, J.; Ran, M.; Zhou, Z. Serpin Functions in Host-Pathogen Interactions. Peer J. 2018, 6, e4557. [Google Scholar] [CrossRef][Green Version]
  38. Morgan, P. CD59. In The Complement Facts Book: Second Edition; Elsevier: Amsterdam, The Netherlands, 2018; pp. 361–367. ISBN 9780128104200. [Google Scholar]
  39. Carla Piazzon, M.; Lutfall, G.; Forlenzaa, M. IL10, a Tale of an Evolutionarily Conserved Cytokine across Vertebrates. Crit. Rev. Immunol. 2016, 36, 99–129. [Google Scholar] [CrossRef]
  40. Peterman, E.M.; Sullivan, C.; Goody, M.F.; Rodriguez-Nunez, I.; Yoder, J.A.; Kim, C.H. Neutralization of Mitochondrial Superoxide by Superoxide Dismutase 2 Promotes Bacterial Clearance and Regulates Phagocyte Numbers in Zebrafish. Infect. Immun. 2015, 83, 430–440. [Google Scholar] [CrossRef][Green Version]
  41. Ellis, A.E. Inhibition of the Aeromonas salmonicida Extracellular Protease by A2-Macroglobulin in the Serum of Rainbow Trout. Microb. Pathog. 1987, 3, 167–177. [Google Scholar] [CrossRef]
  42. Wu, X.M.; Chen, W.Q.; Hu, Y.W.; Cao, L.; Nie, P.; Chang, M.X. RIP2 Is a Critical Regulator for NLRs Signaling and MHC Antigen Presentation but Not for MAPK and PI3K/Akt Pathways. Front. Immunol. 2018, 9, 726. [Google Scholar] [CrossRef]
  43. Sarais, F.; Rebl, H.; Verleih, M.; Ostermann, S.; Krasnov, A.; Köllner, B.; Goldammer, T.; Rebl, A. Characterisation of the Teleostean ΚB-Ras Family: The Two Members NKIRAS1 and NKIRAS2 from Rainbow Trout Influence the Activity of NF-ΚB in Opposite Ways. Fish Shellfish Immunol. 2020, 106, 1004–1013. [Google Scholar] [CrossRef]
  44. Glenney, G.W.; Wiens, G.D. Early Diversification of the TNF Superfamily in Teleosts: Genomic Characterization and Expression Analysis. J. Immunol. 2007, 178, 7955–7973. [Google Scholar] [CrossRef] [PubMed][Green Version]
  45. Ratthé, C.; Girard, D. Interleukin-15 Enhances Human Neutrophil Phagocytosis by a Syk-Dependent Mechanism: Importance of the IL-15Rα Chain. J. Leukoc. Biol. 2004, 76, 162–168. [Google Scholar] [CrossRef] [PubMed]
  46. Wang, T.; Secombes, C.J. Identification and Expression Analysis of Two Fish-Specific IL-6 Cytokine Family Members, the Ciliary Neurotrophic Factor (CNTF)-like and M17 Genes, in Rainbow Trout Oncorhynchus mykiss. Mol. Immunol. 2009, 46, 2290–2298. [Google Scholar] [CrossRef]
  47. Rebl, A.; Rebl, H.; Korytář, T.; Goldammer, T.; Seyfert, H.M. The Proximal Promoter of a Novel Interleukin-8-Encoding Gene in Rainbow Trout (Oncorhynchus mykiss) Is Strongly Induced by CEBPA, but not NF-κB p65. Dev. Comp. Immunol. 2014, 46, 155–164. [Google Scholar] [CrossRef]
  48. Vignali, D.A.A.; Kuchroo, V.K. IL-12 Family Cytokines: Immunological Playmakers. Nat. Immunol. 2012, 13, 722–728. [Google Scholar] [CrossRef][Green Version]
  49. Li, J.H.; Shao, J.Z.; Xiang, L.X.; Wen, Y. Cloning, Characterization and Expression Analysis of Pufferfish Interleukin-4 CDNA: The First Evidence of Th2-Type Cytokine in Fish. Mol. Immunol. 2007, 44, 2078–2086. [Google Scholar] [CrossRef]
  50. Wang, T.; Hu, Y.; Wangkahart, E.; Liu, F.; Wang, A.; Zahran, E.; Maisey, K.R.; Liu, M.; Xu, Q.; Imarai, M.; et al. Interleukin (IL)-2 Is a Key Regulator of T Helper 1 and T Helper 2 Cytokine Expression in Fish: Functional Characterization of Two Divergent IL2 Paralogs in Salmonids. Front. Immunol. 2018, 9, 1683. [Google Scholar] [CrossRef][Green Version]
  51. Sigh, J.; Lindenstrøm, T.; Buchmann, K. Expression of Pro-Inflammatory Cytokines in Rainbow Trout (Oncorhynchus mykiss) during an Infection with Ichthyophthirius Multifiliis. Fish Shellfish Immunol. 2004, 17, 75–86. [Google Scholar] [CrossRef]
  52. Ellis, A.E. Innate Host Defense Mechanisms of Fish against Viruses and Bacteria. Dev. Comp. Immunol. 2001, 25, 827–839. [Google Scholar] [CrossRef]
  53. Geijtenbeek, T.B.H.; Torensma, R.; van Vliet, S.J.; van Duijnhoven, G.C.F.; Adema, G.J.; van Kooyk, Y.; Figdor, C.G. Identification of DC-SIGN, a Novel Dendritic Cell–Specific ICAM-3 Receptor That Supports Primary Immune Responses. Cell 2000, 100, 575–585. [Google Scholar] [CrossRef][Green Version]
  54. Jiménez-Cantizano, R.M.; Infante, C.; Martin-Antonio, B.; Ponce, M.; Hachero, I.; Navas, J.I.; Manchado, M. Molecular Characterization, Phylogeny, and Expression of c-Type and g-Type Lysozymes in Brill (Scophthalmus rhombus). Fish Shellfish Immunol. 2008, 25, 57–65. [Google Scholar] [CrossRef]
  55. Gomard, T.; Michaud, H.-A.; Tempé, D.; Thiolon, K.; Pelegrin, M.; Piechaczyk, M. An NF-ΚB–Dependent Role for JunB in the Induction of Proinflammatory Cytokines in LPS-Activated Bone Marrow–Derived Dendritic Cells. PLoS ONE 2010, 5, e9585. [Google Scholar] [CrossRef][Green Version]
  56. Aerts-Toegaert, C.; Heirman, C.; Tuyaerts, S.; Corthals, J.; Aerts, J.L.; Bonehill, A.; Thielemans, K.; Breckpot, K.; Breckpot, K. CD83 Expression on Dendritic Cells and T Cells: Correlation with Effective Immune Responses. Eur. J. Immunol. 2007, 37, 686–695. [Google Scholar] [CrossRef] [PubMed]
  57. Sahoo, N.C.; Rao, K.V.S.; Natarajan, K. CD80 Expression Is Induced on Activated B Cells Following Stimulation by CD86. Scand. J. Immunol. 2002, 55, 577–584. [Google Scholar] [CrossRef] [PubMed]
  58. Lane, P. Regulation of T and B Cell Responses by Modulating Interactions between CD28/CTLA4 and Their Ligands, CD80 and CD86. Ann. N. Y. Acad. Sci. 1997, 815, 392–400. [Google Scholar] [CrossRef] [PubMed]
  59. Lüder, C.G.K.; Lang, T.; Beuerle, B.; Gross, U. Down-Regulation of MHC Class II Molecules and Inability to up-Regulate Class I Molecules in Murine Macrophages after Infection with Toxoplasma Gondii. Clin. Exp. Immunol. 1998, 112, 308. [Google Scholar] [CrossRef]
  60. Korytář, T.; Jaros, J.; Verleih, M.; Rebl, A.; Kotterba, G.; Kühn, C.; Goldammer, T.; Köllner, B. Novel Insights into the Peritoneal Inflammation of Rainbow Trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2013, 35, 1192–1199. [Google Scholar] [CrossRef]
  61. Trendel, N.; Kruger, P.; Gaglione, S.; Nguyen, J.; Pettmann, J.; Sontag, E.D.; Dushek, O. Perfect Adaptation of CD8+ T Cell Responses to Constant Antigen Input over a Wide Range of Affinity Is Overcome by Costimulation. Sci. Signal. 2021, 14, 666. [Google Scholar] [CrossRef]
  62. Hu, Q.; Ao, Q.; Zhu, J. Response of Chemokine Receptors CXCR2 and Integrin Β2 after Streptococcus agalactiae and Aeromonas hydrophila Challenge in GIFT Strain of Nile Tilapia Oreochromis Niloticus. Dev. Comp. Immunol. 2021, 115, 103897. [Google Scholar] [CrossRef]
  63. Silverstein, R.L. Type 2 Scavenger Receptor CD36 in Platelet Activation: The Role of Hyperlipemia and Oxidative Stress. Clin. Lipidol. 2009, 4, 767. [Google Scholar] [CrossRef][Green Version]
  64. Ferdous, F.; Scott, T.R. A Comparative Examination of Thrombocyte/Platelet Immunity. Immunol. Lett. 2015, 163, 32–39. [Google Scholar] [CrossRef]
  65. Köllner, B.; Fischer, U.; Rombout, J.H.W.M.; Taverne-Thiele, J.J.; Hansen, J.D. Potential Involvement of Rainbow Trout Thrombocytes in Immune Functions: A Study Using a Panel of Monoclonal Antibodies and RT-PCR. Dev. Comp. Immunol. 2004, 28, 1049–1062. [Google Scholar] [CrossRef]
  66. Zamora, C.; Cantó, E.; Nieto, J.C.; Ortiz, M.A.; Juarez, C.; Vidal, S. Functional Consequences of CD36 Downregulation by TLR Signals. Cytokine 2012, 60, 257–265. [Google Scholar] [CrossRef] [PubMed]
  67. Li, C.; Tian, M.; Zhang, L.; Fu, Q.; Song, L.; Yang, N. Expression Profiling and Functional Characterization of CD36 in Turbot (Scophthalmus maximus L.). Fish Shellfish Immunol. 2018, 81, 485–492. [Google Scholar] [CrossRef] [PubMed]
  68. Van der Sar, A.M.; Spaink, H.P.; Zakrzewska, A.; Bitter, W.; Meijer, A.H. Specificity of the Zebrafish Host Transcriptome Response to Acute and Chronic Mycobacterial Infection and the Role of Innate and Adaptive Immune Components. Mol. Immunol. 2009, 46, 2317–2332. [Google Scholar] [CrossRef]
  69. Merselis, L.C.; Rivas, Z.P.; Munson, G.P. Breaching the Bacterial Envelope: The Pivotal Role of Perforin-2 (MPEG1) within Phagocytes. Front. Immunol. 2021, 12, 1. [Google Scholar] [CrossRef] [PubMed]
  70. Heesterbeek, D.A.C.; Angelier, M.L.; Harrison, R.A.; Rooijakkers, S.H.M. Complement and Bacterial Infections: From Molecular Mechanisms to Therapeutic Applications. J. Innate Immun. 2018, 10, 455–464. [Google Scholar] [CrossRef] [PubMed]
  71. Lambris, J.D.; Ricklin, D.; Geisbrecht, B.V. Complement Evasion by Human Pathogens. Nat. Rev. Microbiol. 2008, 6, 132. [Google Scholar] [CrossRef]
  72. Merino, S.; Alberti, S.; Tomasl, J.M. Aeromonas salmonicida Resistance to Complement-Mediated Killing. Infect. Immun. 1994, 62, 5483–5490. [Google Scholar] [CrossRef][Green Version]
  73. Menanteau-Ledouble, S.; Kumar, G.; Saleh, M.; El-Matbouli, M. Aeromonas salmonicida: Updates on an Old Acquaintance. Dis. Aquat. Org. 2016, 120, 49–68. [Google Scholar] [CrossRef][Green Version]
  74. Volanakis, J.E. Transcriptional Regulation of Complement Genes. Annu. Rev. Immunol. 1995, 13, 277–305. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Graphic representation of (a) an infection with activated and (b) stimulation with inactivated Aeromonas salmonicida bacteria. In both scenarios, A. salmonicida activates the TLR-NF-κB pathway. (a) Previous investigations have documented the intracellular effects of AexT, Ati2 and AopP on inflammatory gene expression, whereas the impact of AopH, AopO and AopS has been predicted based on cytotoxic homologs from other bacterial species. (b) Stimulations with inactive bacteria do not contain an active T3SS system; the host cell response is directed against molecular antigens and induces immune-relevant gene expression. Abbreviations: LPS, lipopolysaccharide; TLR, toll-like receptor; ATP, adenosine triphosphate; ADP, adenosine diphosphate.
Figure 1. Graphic representation of (a) an infection with activated and (b) stimulation with inactivated Aeromonas salmonicida bacteria. In both scenarios, A. salmonicida activates the TLR-NF-κB pathway. (a) Previous investigations have documented the intracellular effects of AexT, Ati2 and AopP on inflammatory gene expression, whereas the impact of AopH, AopO and AopS has been predicted based on cytotoxic homologs from other bacterial species. (b) Stimulations with inactive bacteria do not contain an active T3SS system; the host cell response is directed against molecular antigens and induces immune-relevant gene expression. Abbreviations: LPS, lipopolysaccharide; TLR, toll-like receptor; ATP, adenosine triphosphate; ADP, adenosine diphosphate.
Fishes 07 00012 g001
Figure 2. Overview of the exposure conditions, subsequent sampling at specific time points and magnetic separation with a monoclonal antibody (MAb21) against a myeloid lineage marker to separate a MAb21-positive (MAb21P) fraction of myeloid cells from a depleted MAb21-negative (MAb21N) cell fraction enriched in lymphocytes and thrombocytes.
Figure 2. Overview of the exposure conditions, subsequent sampling at specific time points and magnetic separation with a monoclonal antibody (MAb21) against a myeloid lineage marker to separate a MAb21-positive (MAb21P) fraction of myeloid cells from a depleted MAb21-negative (MAb21N) cell fraction enriched in lymphocytes and thrombocytes.
Fishes 07 00012 g002
Figure 3. (A) Magnetic-activated sorting of head kidney cells from rainbow trout using the myeloid lineage marker specific monoclonal antibody MAb21 resulted in (B) an enriched myeloid cell fraction (MAb21-positive myeloid cells) and a depleted lymphoid cell fraction (MAb21-negative lymphocytes and thrombocytes).
Figure 3. (A) Magnetic-activated sorting of head kidney cells from rainbow trout using the myeloid lineage marker specific monoclonal antibody MAb21 resulted in (B) an enriched myeloid cell fraction (MAb21-positive myeloid cells) and a depleted lymphoid cell fraction (MAb21-negative lymphocytes and thrombocytes).
Fishes 07 00012 g003
Figure 4. Basal expression of the selected lineage marker genes in MAb21-positive myeloid cells and MAb21-negative lymphoid cells.
Figure 4. Basal expression of the selected lineage marker genes in MAb21-positive myeloid cells and MAb21-negative lymphoid cells.
Fishes 07 00012 g004
Figure 5. Expression modulation of immune genes specific to myeloid cells (left panel) and to lymphocytes and thrombocytes (right panel) after peritoneal injection of A. salmonicida into rainbow trout. The heat map is representative of four samples and illustrates the average expression ratios as log2 FC values of the A. salmonicida–stimulated group relative to the control group (n = 4) for the immune genes listed at the left margin of each panel. EEF1A1b and RPS5 were used as reference genes to normalise the data. Grey fields indicate that the calculation of FC values failed because of undetectable expression in the treated or control groups. Increased and decreased transcript levels in the samples of the stimulated group compared with the controls are indicated by red and blue fields, respectively, according to the legend on the right.
Figure 5. Expression modulation of immune genes specific to myeloid cells (left panel) and to lymphocytes and thrombocytes (right panel) after peritoneal injection of A. salmonicida into rainbow trout. The heat map is representative of four samples and illustrates the average expression ratios as log2 FC values of the A. salmonicida–stimulated group relative to the control group (n = 4) for the immune genes listed at the left margin of each panel. EEF1A1b and RPS5 were used as reference genes to normalise the data. Grey fields indicate that the calculation of FC values failed because of undetectable expression in the treated or control groups. Increased and decreased transcript levels in the samples of the stimulated group compared with the controls are indicated by red and blue fields, respectively, according to the legend on the right.
Fishes 07 00012 g005
Figure 6. Expression modulation of genes specific to inflammation and immune regulation after p.i. injection of inactivated A. salmonicida into rainbow trout. The heat map is representative of four samples and illustrates the average expression ratios as log2 FC values of the stimulated group relative to the control groups (n = 4) for the given immune genes. EEF1A1b and RPS5 were used as reference genes to normalise the data. Grey fields indicate that the calculation of FC values failed because of undetectable expression in the treated or control groups. Increased and decreased transcript levels in the samples of stimulated rainbow trout compared with controls are indicated by red and blue fields, respectively, according to the legend on the right.
Figure 6. Expression modulation of genes specific to inflammation and immune regulation after p.i. injection of inactivated A. salmonicida into rainbow trout. The heat map is representative of four samples and illustrates the average expression ratios as log2 FC values of the stimulated group relative to the control groups (n = 4) for the given immune genes. EEF1A1b and RPS5 were used as reference genes to normalise the data. Grey fields indicate that the calculation of FC values failed because of undetectable expression in the treated or control groups. Increased and decreased transcript levels in the samples of stimulated rainbow trout compared with controls are indicated by red and blue fields, respectively, according to the legend on the right.
Fishes 07 00012 g006
Table 1. Primers used in the study, amplicon length and function of each analysed gene. The left column reports the specific cell population.
Table 1. Primers used in the study, amplicon length and function of each analysed gene. The left column reports the specific cell population.
Cell PopulationGene SymbolPrimer 5′–3′Length (bp)Accession No.FunctionRef.
Dendritic cellsTAP1CACTCCTGGCAGGGGCTACTT176XM_021559784Antigen presentation[14]
CCTTATTTCATACGCTTTGGAGC
TAP2CATCTGTGAGACGTTTATCCCTT99XM_024386707Antigen presentation[15]
TCATGTACGCCATTGGAGGCAT
CD83GTCTGCATTCTAGCTGCCTACT128XM_021593617Immune cell interactions[16]
ACGTAAGCCTGGGGTCCAGTA
CD209ATCTCTCAGGTACCGGAAGAGT127HG428763Intercellular adhesion, antigen uptake[17]
GACTGTCTGGAGAGAGGAGCA
MacrophagesLYGGCAGGTTGACAAGCGCTACCA118BT073825Hydrolyzation of the bacterial cell wall[18]
AAAGGGGGAATTTCAGCCTACAA
DAA (MHCII)CAGTGATTCAGATGGAGTGAATAT131FR688130Cell surface proteins with a key role in adaptive immunity[19]
AGATTTCCTTCCCTGGATATTATG
CD80/86GCGTCGGCTGCTTCGAAGGT152NM_001160477Co-stimulation of T-cells[20]
AGACTCCCAAACCACCTGTATG
CD68GACACTGGAAAGACAGGAGTATT115XM_021578316Scavenger receptor and antigen processor[21]
TTCAAGGAGGGCTTCATCACCT
SPICCACCTGGTCCTGCATCAGAAG127NM_001124513Immune gene expression[22]
CTGGGACTATCACGCCACTCA
B- and T-cellsCD79BTGAACCTCTCAGTGGCTTTAAAC111XM_021565350Signalling through B-cell receptors[23]
TCTGTGTGGTGTCGGACCGAA
PAX5AAGTATCCGTCCCGGGGTGAT144NM_001124682Development of lymphoid progenitors[24]
GACTATTGGCTGAGAGAGTGTG
TARPGAGAAGTGGAGTGGGACCAGA105XM_021619909Antigen presentation[25]
AGGTGAGTGACGGGGGACAC
Pan-T-cells and ThrombocytesGAPDHTCAACGGATTTGGCCGTATTGG134NM_001124246Influence cytokine production[26]
GTTCAAGTATGACTCCACCCAC
CSCACCTTCAACGAGGTTTACCCC131XM_021610150Metabolic regulator[27]
GAGATGTGCTTTTGGATCTTGTC
CD18AGTGAGTTGAGGGTTACATAGGA148XM_021579244Leukocyte migration and adhesion[28]
GTATGTTCCAAAACAGTGATCAAC
CD41CAGTTTAGCAACAAAACCATCAGT161XM_021624569Leukocyte migration and adhesion[29]
TGACACAAAAGGTGATGAGGTTTA
CD36GACTGTTACAAAGGAATCGGTCAT112XM_021577070Ligand binding[30]
ACAGTTCTGGCTCTTTGACGTG
Natural Killer cellsGZMBTCCTTTCCTCTGCTGGAGCCT94XM_021598076Destruction of infected and/or transformed cells[31]
TATATGGTCTCTCTGCAACACAG
PRF1GCGGGTATTACAGCTATCGAGTA161XM_021558434Destruction of infected and/or transformed cells[32]
ATTACATTACCAAGGTGAGCCTG
KLRD1 (CD94)TGGGGCAACGATCGGCTCAAA114XM_021559366“Missing-self” discrimination[33]
GAATCCTGCCACAGCAGTGGA
Complement systemCFDGACAAGTCATGAGCCCCAAG151NM_001246346Serine protease activity of the alternative complement pathway[34]
GTGCCGAAAGTGGGTATTGT
CFHGCTGGACCAAGACACTTGGC166NM_001124410Complement regulation[34]
CCTCTACCGGGGGTTGGTG
CFIACCCAGTGTTTGCAAGAGAACC167XM_021593383Inactivation of C3b/C4b factors[34]
CAGTTGGCGATCAGAGAGACG
C3-1AGCCTCTGACCAGGGAGATATT164L24433Opsonisation, elimination of pathogens[34]
GACGATGTCAGGGAGTTTGAAC
C1r/sAACCAGAGGGGACTCTGTCCA182NM_001124380Initiation of classical complement pathway[35]
TGGACAGAGTCCCCTCTGGTT
Immune regulationNFKBIAAACCCTGGAGGAAAACAGTGAC153NM_001124368Inhibition of NF-κB pathways[36]
GAACAATCAGAGACAGACGGCG
SERPINB1TACCAGTTCGTTGAGACGTTCC116NM_001124515Reduction of tissue damage; cell differentiation; immune activation[37]
ATCAAGAACCTATTGGCGGAGG
SERPING1AAGGAATGACGAACGGCAAACG169NM_001124379Activation of the C1 complex[37]
TCAGCTGTCTCACAGTAGTACAT
CD59GATTGAGTGGGCAAAGTATTGTAT167XM_021606996Inhibition of the membrane-attack complex[38]
CATACCCTGTTACATAACATTGCT
IL10TGCCCAGTGCAGACGTGTACC137NM_001245099Anti-inflammatory function[39]
TACACCACTTGAAGAGCCCCG
SOD2TCCCTGACCTGACCTACGAC201XR_00247449Oxidative stress[40]
GAGGTTTAATGGAGGAGGCC
A2MGGGAGGAAGGATGAGATGAGTA184XM_021582312Inhibition of cytokine-induced inflammation[41]
CTAACAGTGGAGCTTCAGGACC
InflammationRIPK2TGTTGGCGAAAGGGAGAGGAAT105KJ184523Modulation of innate and adaptive immune responses[42]
GTACATGAGCAATGGCTCTCTG
NKIRAS2aTGCATGTCTGCCTGTCTCTTTTT201XM_021557705Regulation of NF-κB signalling[43]
TGAGCCCGCAATATGATTGGCA
RANKLGAGAGCATCGACTGGGAAAATGT125XM_021620403Regulation of interactions between T-cells and dendritic cells[44]
TGTTCTGGGTACTCTGACACCA
IL2RG (CD132)ACCCCCAATGTAAACTGCCTGA112NM_001124356Cytokine signalling involved in the stimulation of phagocytosis[45]
TTTCAGCAGCAGGTTCATCAAAG
IL6GTGTTAGTTAAGGGGAATCCAGT128NM_001124657Proinflammatory cytokine and anti-inflammatory myokine[46]
CCTTGCGGAACCAACAGTTTGT
CXCL8ATATAACACTTGTTACCAGCGAGA106HG917307Chemoattraction[47]
ATTACTGAGGAGATGAGTCTGAG
IL12ACATTCAGTGAGAGTGCGTGTC118HE798148Differentiation of naïve T-cells[48]
ACAAGGGGATCCTTCCTCACAA
IL4/13CTGTCAGAGGAACTTCTGGAAAC131NM_001246341Regulation of inflammatory processes[49]
GTGAAAAATGACGCGTTTGGTGA
IL2RB (CD122)AGAGGACAGTGGCGGTAATGAT94XM_021622445Cytokine signalling involved in T-cell-mediated immune responses[50]
CTCACAACCTCCAAGGACTGTT
IL1BGAGAGTGCTGTGGAAGAACATAT157NM_001124347Inflammation[51]
ATGAATGAGGCTATGGAGCTGC
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sarais, F.; Montero, R.; Ostermann, S.; Rebl, A.; Köllner, B.; Goldammer, T. The Early Immune Response of Lymphoid and Myeloid Head-Kidney Cells of Rainbow Trout (Oncorhynchus mykiss) Stimulated with Aeromonas salmonicida. Fishes 2022, 7, 12. https://doi.org/10.3390/fishes7010012

AMA Style

Sarais F, Montero R, Ostermann S, Rebl A, Köllner B, Goldammer T. The Early Immune Response of Lymphoid and Myeloid Head-Kidney Cells of Rainbow Trout (Oncorhynchus mykiss) Stimulated with Aeromonas salmonicida. Fishes. 2022; 7(1):12. https://doi.org/10.3390/fishes7010012

Chicago/Turabian Style

Sarais, Fabio, Ruth Montero, Sven Ostermann, Alexander Rebl, Bernd Köllner, and Tom Goldammer. 2022. "The Early Immune Response of Lymphoid and Myeloid Head-Kidney Cells of Rainbow Trout (Oncorhynchus mykiss) Stimulated with Aeromonas salmonicida" Fishes 7, no. 1: 12. https://doi.org/10.3390/fishes7010012

Article Metrics

Back to TopTop