Next Article in Journal
New Record of Saurida micropectoralis Shindo & Yamada, 1972 (Aulopiformes: Synodontidae) in the Southern Red Sea and Evidence of Range Expansion to East Africa
Previous Article in Journal
Modeling Skipjack Tuna Purse Seine Fishery Distribution in the Western and Central Pacific Ocean Under ENSO Scenarios: An Integrated MGWR-BME Framework
Previous Article in Special Issue
The Influence of Different Feeding Time Management on the Growth and Stress Response of the African Catfish Clarias gariepinuns (Burchel, 1822) Under Farming Conditions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 10
Issue 9
10.3390/fishes10090451
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hawthorn Polysaccharide Enhances Growth, Immunity, and Intestinal Health in Crucian Carp (Carassius auratus) Challenged with Aeromonas hydrophila

by
Liang Luo
1,2,
Zhigang Zhao
1,
Shihui Wang
1,
Rui Zhang
1,
Kun Guo
1,
Cheng Zhao
1,
Baoquan He
1,
Wei Wang
2,* and
Wenhua Wu
1,*
1
Key Laboratory of Cold Water Fish Germplasm Resources and Multiplication and Cultivation of Heilongjiang Province, Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Harbin 150070, China
2
State Key Laboratory of Urban-rural Water Resource and Environment (SKLUWRE), School of Environment, Harbin Institute of Technology, Harbin 150090, China
*
Authors to whom correspondence should be addressed.
Fishes 2025, 10(9), 451; https://doi.org/10.3390/fishes10090451
Submission received: 17 June 2025 / Revised: 11 August 2025 / Accepted: 15 August 2025 / Published: 5 September 2025
(This article belongs to the Special Issue Physiological Response Mechanisms of Aquatic Animals to Stress)
Browse Figures
Versions Notes

Abstract

Bacterial disease infections pose a major challenge to the healthy growth of crucian carp. Hawthorn polysaccharide (HP) is a natural active ingredient in hawthorn and has a wide range of pharmacological effects. However, the mechanism of HP against Aeromonas hydrophila infection in crucian carp cultures is unknown. In this study, it was found that 0.4% HP could significantly reduce the mortality of crucian carp, significantly increase the activities of T-AOC, SOD, CAT, and GSH-PX of crucian carp infected with A. hydrophila (p < 0.05), decrease the activity of MDA, and decrease the expression levels of TGF-β, TNF-α, IFN-γ, and IL-8 genes. Increased IL-10 gene expression levels (p < 0.05) significantly improved the disease resistance of crucian carp. HP could relieve intestinal inflammation caused by A. hydrophila infection, restoring intestinal structural integrity. At the same time, HP increased the diversity and improved the structure of intestinal microbiota. At the phylum level, the abundance of Proteobacteria and Firmicutes increased, while that of Bacteroidota and Fusobacteriota decreased. At the genus level, the abundance of Aeromonas increased, while the abundance of Cetobacterium decreased. Non-targeted metabolomics analysis of crucian carp LC-MS revealed 147 different metabolites, 62 of which were up-regulated and 85 of which were down-regulated, and Linoleic acid metabolism and Glycerophospholipids were one of the most important metabolic pathways. In conclusion, the supplementation of HP in feed can promote the healthy breeding of crucian carp, and the effect of resisting A. hydrophila is better.
Keywords:
Aeromonas hydrophila; crucian carp; hawthorn polysaccharide; immunity; intestinal metabolism; intestinal microbiota
Key Contribution: This study reports that HP changes the intestinal flora, improving immunity and stimulating different metabolites and pathways under Aeromonas hydrophila stress to alleviate the damage in crucian carp.

1. Introduction

In recent years, the gradual expansion of aquaculture scale, increased stocking density, and environmental factors have led to disease issues in aquatic animals during the aquaculture process, resulting in a decline in economic benefits for fish farmers and a reduction in aquaculture area [1]. In aquaculture, A. hydrophila is a common and highly destructive pathogen. This Gram-negative bacterium is widely distributed in natural water bodies such as lakes, rivers, and reservoirs, posing a serious threat to various aquatic organisms, particularly fish [2]. A. hydrophila can cause various diseases including hemorrhagic septicemia, enteritis, and wound infections [3]. Its pathogenic mechanism primarily relies on the production of multiple virulence factors such as exotoxins, extracellular enzymes, and cell surface components. These virulence factors can disrupt the normal function of host cells, leading to tissue damage and death [4]. In order to reduce antibiotic usage and environmental pollution, an increasing number of researchers are turning their attention to ecological aquaculture and biological control strategies. For instance, the inclusion of prebiotics or probiotics in feed to mitigate the damage caused by A. hydrophila infection highlights the focus on natural products in aquaculture. Chinese herbal medicines and their extracts, recognized for their safety, efficacy, strong antioxidant properties, and broad-spectrum antibacterial activity, have become a research hotspot in the prevention and treatment of bacterial diseases in aquaculture [5,6].
Crucian carp (Carassius auratus) is widely regarded as an excellent model species for evaluating aquatic ecosystems and toxicological research [7,8]. Research indicates that the addition of specific components to feed can effectively promote the growth of aquatic organisms, enhance their immune response, and increase disease resistance, thereby significantly impacting yield improvement and quality optimization [9,10]. Wang et al. [11] discovered that polysaccharide components extracted from Ficus carica serve as beneficial immunostimulants, positively influencing the growth performance of crucian carp (final weight, feed conversion ratio, and survival rate). These polysaccharides enhance serum phagocytic activity, serum bactericidal activity, lysozyme activity, C3 content, superoxide dismutase (SOD) activity, and total protein levels, thereby augmenting the innate immune response and survival rate of crucian carp, rendering them less susceptible to infection by A. hydrophila. Wu et al. [12] found that polysaccharides from Coriolus versicolor mushroom significantly enhance the phagocytic activity of crucian carp following infection with A. hydrophila. These polysaccharides stimulate white leukocytes, lysozyme, complement components C3 and C4, erythrocyte immune adherence, and circulatory antibody titers in the serum of crucian carp, thereby enhancing their immune activity and survival rate. Chinese herbs and their extracts are used as immune stimulants in the management of aquaculture diseases and are essential for improving the growth and quality of aquatic animals.
Hawthorn (Crataegus pinnatifida), a member of genus Crataegus and family Rosaceae, has been used for centuries in traditional Chinese medicine due to its various medicinal and edible value [13]. Hawthorn polysaccharide (HP) is an important active ingredient in Hawthorn. It has rich pharmacological activity and many known health care activities, such as antioxidant activity, anti-tumor activity, anti-fatigue activity, immunomodulatory activity, and detumescence activity, showing extensive potential in the treatment of diseases [14,15]. More and more studies have confirmed that HP can promote the growth of beneficial bacteria in the gut and reduce the abundance of harmful bacteria, thereby promoting intestinal health and improving disease symptoms [16,17]. In a recent study, HP was found to increase the abundance of beneficial bacteria, including Bacteroidetes, Firmicutes, and Verrucomicrobia, while decreasing the abundance of harmful bacteria such as Proteobacteria and Psychrobacter. Moreover, HP restored the body weight of immunosuppressed mice, improved immune organ indices, and enhanced the secretion of IL-2, IL-6, and TNF-α. Therefore, HP can effectively regulate the intestinal flora, which plays a crucial role in immune regulation [18]. The aim of this study is to investigate the effects of HP on the immune response, intestinal microbiota, and metabolism of crucian carp infected with A. hydrophila and to provide a reference for the application of HP in the prevention and treatment of fish diseases.

2. Materials and Methods

2.1. Materials

HP was purchased from Baiwei Biotechnology Co., Ltd. (Xi’an, Shaanxi, China), with a purity of 51.2% and composed of glucose (95.37%), galacturonic acid (2.34%), arabinose (0.79%), rhamnose (0.70%), galactose (0.42%), and mannose (0.15%). The molecular weight was 60,402 Da. All other chemicals were of reagent grade.
Healthy Crucian carp with a body length of 6.35 ± 0.93 cm and weight of 5.95 ± 0.28 g were provided by the Hulan Experimental Station, a commercial fishery at the Heilongjiang Fisheries Research Institute (126.63° E, 45.97° N).

2.2. Experimental Design

Before the experiment, the crucian carp were domesticated for two weeks. At the beginning of the experiment, 300 crucian carp with uniform body size and healthy body were randomly selected and divided into five groups with three repeat tanks in each group. According to the feed preparation method described by Yu et al. [19], five edible feeds were prepared, which consisted of commercial feed mixed with HP, with an HP content of 0%, 0.1%, 0.2%, 0.4%, and 0.8%, respectively. The breeding experiment lasted for 8 weeks. During the experiment, the temperature was controlled at 25 ± 1 °C, the dissolved oxygen was maintained above 6 mg/L, the pH was maintained between 6.5 and 7.5, the ammonia nitrogen was no more than 0.01 mg/L, and the water exchange capacity was 5 L/min. Feeding occurred regularly at 8:30, 13:30, and 18:30 every day. After the experiment, crucian carp were starved for 24 h, and the weight and body length of each group were measured for the determination of growth performance parameters.

2.3. Growth Performance

Weight gain rate (WGR) and specific growth rate (SGR) were used to evaluate the effects of HP on the growth performance of crucian carp: WGR (%) = [Wt (g) − W0 (g)]/W0 (g) × 100%; SGR (%) = [lnWt (g) − lnW0 (g)]/T × 100%
Note: Wt: Final average weight of crucian carp; W0: Average initial weight of crucian carp; T: Feeding days.

2.4. Challenge Test

A. hydrophila was obtained from laboratory freeze-dried preserved samples and inoculated into LB medium. It was cultured at 28 °C for 12 h. The concentration of bacteria was adjusted by stroke-physiological saline solution. The absorbance at OD600 nm was measured by ultraviolet spectrophotometer and diluted to OD600 = 0.5.
CON is the treatment group without HP, CG is the treatment group without HP and injected with A. hydrophila, and HPAS is the treatment group with 0.4% HP and injected with A. hydrophila. According to the optimum concentration of 0.4%, the carp were divided into CON, CG, and HPAS groups, with 15 fish in each group and three repeated treatment groups. In the early stage, the LD50 of A. hydrophila was determined to be 7 × 106 CFU/mL, the injection volume of fish was 300 μL, and the challenge test was conducted for 72 h. The death of crucian carp was calculated every 24 h, and the survival curve was drawn. Survival rate (%) = final mantissa/Initial mantissa × 100. Figure 1 shows the schematic diagram of the experimental technique.

2.5. Sample Collection

After the challenge experiment, crucian carp were anesthetized with eugenol, and livers were dissected for the determination of antioxidant enzymes and gene expression; the intestine was used for the determination of histological and intestinal metabolomics, and the intestinal contents were used for the determination of intestinal flora. The collected samples were stored at −80 °C for easy detection.

2.6. Histological Observation

Intestinal structure was evaluated by the HE staining technique. The tissue was dehydrated with alcohol, made transparent with xylene, and embedded with paraffin. The continuous microtome (MICROM HM200, Walldorf, Germany) was used for the section, and the section thickness was set to 5 μm. Slices were dried, HE staining carried out, and gum fixed and sealed. All observations and photographs were made using an optical microscope (OLMPUS BX53, Tokyo, Japan).

2.7. Analysis of Liver Antioxidant Activity

Crucian liver tissue was taken and mixed according to liver tissue (g):normal saline (mL) = 1:9. It was homogenated at 20 °C, then centrifuged at 4000× g for 10 min, and the supernatant taken for further analysis. The contents of total antioxidant capacity (T-AOC), superoxide dismutase (SOD), catalase (CAT), acid phosphatase (AKP), alkaline phosphatase (ACP), Malondialdehyde (MDA), glutathione peroxidase (GSH-PX), and total protein (TP) were determined by the detection kit (Nanjing Jiancheng Biological Engineering Co., LTD., Nanjing, China).

2.8. Analysis of Gene Expression

Using quantitative real-time polymerase chain reaction (qRT−PCR) technology, the mRNA expression levels of tumor necrosis factor α (TNF-α), interferon γ (IFN-γ), interleukin-10 (IL-10), interleukin-8 (IL-8), nuclear factor κB (NF-κB), and transforming growth factor-β (TGF-β) were determined. RNA was extracted from liver tissues with Trizol reagent and converted to cDNA according to the instructions of PrimeScript™ RT reagent Kit (Takara, Dalian, China). Real-time PCR was performed using reverse-transcribed cDNA (Takara, Dalian, China). The reaction system was 10 μL, and the specific primers are shown in Table 1.

2.9. Analysis of Intestinal Microbiota Diversity

Crucian carp intestinal contents samples were sent to Meji Biopharmaceutical Technology Co., LTD. (Shanghai, China) for bacterial genomic DNA extraction and microbiota analysis. Sequencing was performed at an Illumina MiSeq platform; using the QIIME software package (version 1.8.0) to analyze the Illumina HiSeq raw sequencing data, we obtained optimized sequencing data through splice sequence removal, quality control, and sequence splicing to obtain operational taxa (OTUs) based on sequence distance similarity up to 97% or higher.

2.10. Analysis of Intestinal Metabolomics

The intestinal samples were thawed at −4 °C and fully ground into a 2 mL centrifuge tube with 400 μL of extraction solution (equal volume of methanol mixed with water, containing 0.02 mg/mL of internal standard L-2-chlorophenylalanine). After grinding and ultrasonic extraction at low temperature, the samples were placed in an environment of −20 °C for 30 min and centrifuged at 4 °C at 13,000× g for 15 min. The supernatant was collected for LC-MS detection.
Metabolomics analysis was performed using the UHPLC-Q Exactive HF-X high performance liquid chromatography and quadrupole mass spectrometry system of Thermo Field Technology. The raw data obtained were processed by Progenesis QI (Waters Corporation, Milford, CT, USA). According to the variable importance projection (VIP) > 1.0 obtained by OPLS-DA analysis and p < 0.05 in t-test, metabolites with significant differences between groups were screened.

2.11. Statistical Analysis

The experimental results were presented in the form of mean ± standard deviation, and repeated experiments were conducted for 3 times. The data were analyzed by SPSS statistical software package version 26.0 (SPSS, Chicago, IL, USA). Graphs are drawn using GraphPad prism 8.0 (GraphPad Software Inc., La Jolla, CA, USA). Analysis of variance (ANOVA) was used to reveal the significant difference among all groups, and the significance level was p < 0.05.

3. Results

3.1. Growth Performance

The effects of HP on growth performance of crucian carp are shown in Table 2. With the increase of HP concentration, WGR and SGR were significantly increased, and the 0.4% HP treatment group was significantly higher than other groups (p < 0.05), which were (325.71 ± 54.09) % and (2.58 ± 0.23) %, respectively. The feed coefficient in the 0.4% HP treatment group was significantly lower than that in other treatment groups (p < 0.05), but there was no significant difference between the 0.4% HP treatment group and the control group (p > 0.05).

3.2. Challenge Test

As shown in Figure 2, the survival rate of each group of crucian carp was recorded every 24 h. HP obviously affected the survival rate of crucian carp after the challenge test. After 72 h, there was no death in the CON treatment group, the cumulative survival rate was 31.58% in the CG treatment group and 63.16% in the HPAS treatment group.

3.3. Intestinal Morphology

As shown in Figure 3, the effect of HP on intestinal morphology of crucian carp infected with A. hydrophila. Figure 3A shows normal intestinal tissue characteristics, complete intestinal villi structure, and tight intestinal cell arrangement; Figure 3B shows obvious intestinal structural damage, inflammatory cell infiltration, intestinal villi shedding, and damage to intestinal cell tightness; Figure 3C shows that HP treatment can alleviate intestinal inflammation caused by A. hydrophila infection, reduce the production of inflammatory cells, and restore intestinal structural integrity.

3.4. Antioxidant Capacity

Figure 4 shows the effect of HP on the antioxidant capacity of the liver of crucian carp infected with A. hydrophila. Compared with the CON group, the activity of T-AOC, CAT, and SOD in crucian carp infected with A. hydrophila were significantly decreased (p < 0.05). The activity of T-AOC was significantly increased under the intervention of HP and was significantly higher than that in the CON group (p < 0.05). The activity of CAT was significantly higher than that of the CG group (p > 0.05). The SOD activity was significantly higher than in the CG group (p < 0.05). The MDA activity of crucian carp was significantly increased after infection with A. hydrophila, and the MDA activity was decreased in the HPAS group, but there was no significant difference (p > 0.05). There was no significant change in the activity of GSH-PX in the CON group and CG group (p > 0.05), but the activity of GSH-PX in the HPAS group was significantly higher than that in the CON and CG groups (p < 0.05).

3.5. Gene Expression

Figure 5 shows the effect of HP on the immune capacity of crucian carp infected with A. hydrophila. There was no significant difference in the expression level of TGF-β between the CG and CON groups (p > 0.05), but the expression level of the HPAS group was significantly higher than that between the CG and CON groups (p < 0.05). Compared with the CON group, the expression level of IL-10 in the CG group was decreased, while the expression level in the HPAS group was increased, but there was no significant difference (p > 0.05). The gene expression levels of IL-8 and TNF-α were significantly increased after infection with A. hydrophila (p < 0.05), and the gene expression level of TNF-α was significantly decreased after HP treatment, which was consistent with the CON level. The expression level of IL-8 was decreased, and the gene expression level of IFN-γ was increased in the HPAS group. The gene expression level of NF-κB was increased after infection (p > 0.05), and the gene expression level of the HPAS group was significantly increased (p < 0.05).

3.6. Intestinal Microbiota Diversity and Richness

3.6.1. Diversity Analysis of the Intestinal Microbiota

As shown in Figure 6A,B, the shannon index and rank–abundance curve of intestinal microbiota of crucian carp infected with A. hydrophila by HP tended to be flat, and the number of test data was reasonable. The rank–abundance curve indicated that species sequencing richness was high and sequencing samples were sufficient, which could be further analyzed. The effect of HP on alpha diversity in the intestinal microbiota of crucian carp infected with A. hydrophila is shown in Table 3. Compared with the control group, the chao index and shannon index were significantly decreased after challenge (p < 0.05), and there was no significant difference between chao index in the HPAS group and CG group (p > 0.05). The shannon index of the HPAS group was increased compared with the CG group, but there was no significant difference (p > 0.05). The coverage index in the three groups was more than 99.9%, showing good coverage. The Simpson index increased significantly after infection, while it decreased in the HPAS group (p < 0.05).
β-Diversity analysis was based on the PCoA analysis (Figure 6C,D). According to the PCoA based on weighted UniFrac distance in Figure 6C, the first principal component axis and principal coordinate axis explain 70.76% and 25.8% of the data variation, respectively. There is a significant separation between the CON group, the CG group, and the HPAS group and a significant difference between the three processing groups. Similar results can also be found in the unweighted PCoA based on the UniFrac distance shown in Figure 6D.

3.6.2. Intestinal Microbiota Structure and Composition

As shown in Figure 7, the structural composition of intestinal microbiota was analyzed at the phylum level and genus level. At the phylum level (Figure 7A), the dominant phylum were Proteobacteria, Bacteroidota, Fusobacteriota, Actinobacteriota, and Firmicutes. Compared with the CON group, the abundance of Proteobacteria and Actinobacteriota in the GC group decreased, while the abundance of Bacteroidota, Fusobacteriota, and Firmicutes increased. Compared with the CG group, in the HPAS group, the abundance of Proteobacteria and Firmicutes increased, while the abundance of Bacteroidota and Fusobacteriota decreased.
At the genus level (Figure 7B), Aeromonas, norank_f_Barnesiellaceae, and Cetobacterium are the dominant genera. Compared with the CON group, the relative abundance of Aeromonas in the GC group shows no significant difference, while the abundance of Aeromonas in the HPAS group has increased. Compared with the CON group, the abundance of norank_f_Barnesiellaceae and Cetobacterium in the GC group has increased, and their abundance in the HPAS group has decreased compared with the CG group.

3.7. Differential Analysis of Intestinal Microbiota

Microbial taxa with different abundances among the CON, CG, and HPAS groups were determined by LEfSe multilevel species difference discriminant analysis. Figure 8 shows other levels of biomarkers from phylum level to genus level for the three groups. Twenty-four, ten, and nine genus-level biomarkers have been detected in the CON, CG and HPAS groups, respectively. Spirochaetota and Actinobacteriota in the CON treatment group are genus-level biomarkers in this group. Fusobacteriota and Bacteroidota in the CG group are the genus level biomarkers of this group, and Gammaproteobacteria in the HPAS group are the genus level biomarkers of this group.

3.8. Analysis of Intestinal Metabolism of Crucian Carp

The LC-MS technique was used to analyze the non-targeted metabolomics of intestinal samples of crucian carp infected with A. hydrophila by HP. A total of 2759 unique metabolites were detected. The OPLS-DA model was used for multivariate statistical analysis to study differential metabolites (DEM) between the two groups (Figure 9). Figure 9A,C showed that there was a significant separation between the CG and HPAS groups, and HP caused significant changes in metabolite profiles after challenge. Figure 9B,D are used to judge the validation graphs of the OPLS-DA model in the CG and HPAS groups, indicating that the model is stable and effective for fitting and prediction and is suitable for subsequent DEM analysis.
According to the volcano map, a total of 147 differentially metabolites were identified in HPAS and GG groups (Figure 10A), with 62 up-regulated genes and 85 down-regulated genes. The top 20 most important pathways were selected based on enrichment factors, p-values and differential metabolite enrichment counts (Figure 10B). Studies have shown that the Linoleic acid metabolism pathway occupies the primary position among all metabolic pathways. It also includes Glycerophospholipid metabolism, Caffeine metabolism, Citrate cycle (TCA cycle), and Taurine and hypotaurine metabolism. By comparing CG and HPAS, significant differences were found in the precipitation of 147 metabolites (SDMs), adjuncts, VIP, p-value, fold change (FC) value, and regulatory parameters shown in Table S1, mainly concentrated on Glycerophospholipids, Fatty Acyls, Carboxylic acids, and derivatives in equal categories, and the clustering heat map of the top 50 SDMs was drawn (Figure 11).

4. Discussion

As a natural product, natural polysaccharide is safe and has a stable structure. It has a good development prospect in the fields of medicine and health care, food, cosmetics, biological materials, livestock production, aquaculture, and other applications [20,21]. In recent years, the application of Chinese herbal medicine and its polysaccharide as immune stimulants in the safe aquaculture of aquatic animals has become a research hotspot. In scientific research, Wang et al. [22] found that the addition of Radix isatidis polysaccharides, Schisandra chinensis polysaccharides, and Ficus carica polysaccharides as immune stimulants can enhance the immunity and resistance to A. hydrophila ability of Crucian carp, among which the most obvious effect is Ficus carica polysaccharides. In the study by Wang et al. [23], the effects of dietary Angelica polysaccharide on the innate cellular immune response and disease resistance of Epinephelus malabaricus were explored, and it was found that Angelica polysaccharide could enhance some cellular immune parameters and the disease resistance of Epinephelus malabaricus. In another study, macroalgae polysaccharide enhanced the immunity of carp by stimulating their immune response, protecting crucian carp against A. hydrophila and Edwardsiella tarda and reducing the mortality of crucian carp after infection [24]. In the case of ensuring food quality and safety to meet people’s daily needs, disease control technology and healthy aquaculture are the key. The disease prevention and control mode based on natural polysaccharide regulation has become one of the important technical means for the prevention and control of aquatic diseases and can play a role in inhibiting and treating pathogens and diseases caused by them. Ginger, with its unique efficacy, is widely recognized as being able to dispel cold and relieve surface, warm lungs, and cough and has a strong detoxification ability [25]. As the core active element of hawthorn, HP has multiple functions, covering many fields such as antioxidant, immune system regulation, and intestinal microecological balance maintenance [26].
A. hydrophila is one of the main pathogenic bacteria in fish culture. After infection, it can lead to a variety of fish diseases, which may cause fish death and hinder the development of aquaculture [27]. A. hydrophila, as a common pathogenic bacteria in water environment, has caused a wide variety of diseases among humans, animals, and fish, involving acute gastrointestinal diseases, sepsis, and even trauma infections, and can cause death in aquacultures [28]. Diseases caused by pathogenic bacteria hinder the development of aquatic animal farming; the common treatment methods on the market mainly focus on some chemicals such as antibiotics, the excessive use of which carries ecological risks due to resistance and accumulation. This study studied the effect of HP on the ability of Crucian carp to resist A. hydrophila. The protective effect of HP on the body damage of Crucian carp was analyzed from the perspective of antioxidant capacity, immunity, intestinal microbiota, and metabolomics. The results showed that HP could regulate the diversity and composition of intestinal microbiota and improve the metabolic capacity of Crucian carp by increasing the antioxidant capacity and immunity of crucian carp. Finally, the survival rate of crucian carp infected with A. hydrophila was enhanced.
As a key area for digestion and absorption, the gut is also a strong barrier against foreign pathogens, which is crucial to the health of animals [29,30]. This experiment showed that HP had a good effect on repairing the damage caused by pathogenic bacteria to the intestinal barrier of crucian carp, reducing the risk of pathogen invasion and promoting the ability of intestinal villus histology scoring, and that intestinal villus can strengthen the body’s ability to resist pathogen infection [31]. Through this experiment, we found that HP can effectively inhibit intestinal pathogens, improve the metabolic capacity of the body, enhance digestion and absorption, and promote the intestinal health and survival rate of crucian carp.
The liver organ is closely related to the health of fish (growth and development, immune performance, toxicity, etc.) and can be used as an indicator of the healthy growth of fish [32]. The antioxidant system is an important part of the non-specific immune system. It is composed of antioxidants and antioxidant enzymes. Antioxidant reaction can remove excessive reactive oxygen species (ROS) in the body to prevent oxidative stress and cell damage [33,34]. Antioxidant enzymes are an important part of the body’s defense mechanism, because the stress of the external environment will change the activity of antioxidant enzymes in the body [35].
In this study, compared with the control group, A. hydrophile decreased the antioxidant activities of T-AOC, CAT, SOD, GSH-PX, ACP, and AKP in the liver of carp and increased the activity of MDA. This is consistent with the research results of Wang et al. [35]. Pathogenic bacteria stress can reduce the antioxidant activity of CAT and SOD and increase the activity of MDA, resulting in body damage to Crucian carp. Antioxidant indexes T-AOC, CAT, SOD, and GSH-PX can evaluate the ability of scavenging free radicals in the body and can also be regarded as markers of oxidative stress [36], which are crucial to the occurrence of diseases and biological lesions in aquatic animals [37,38,39]. MDA can reflect the degree of cell damage caused by oxygen free radicals [40,41]. ACP and AKP participate in the decomposition and assimilation of nutrients, digestion, and detoxification processes and can play a detoxification role in the liver, ensure cell growth and metabolism and other functions, and maintain cell activity [42,43]. The dietary supplementation of HP can increase the activities of T-AOC, CAT, SOD, GSH-PX, ACP, and AKP in the liver of carp infected with A. hydrophila and decrease the activities of MDA. This may be due to the antioxidant effect of HP, which stimulates the body to produce a faster antioxidant reaction to remove ROS during the challenge, protect the immune damage caused by pathogens, and maintain the balance of the antioxidant system.
The addition of Chinese herbal medicine and its polysaccharides can help to enhance the immune system of animals infected with pathogenic bacteria and has the effect of immune stimulation and antibacterial [24,44]. After infection by A. hydrophila, the gene expressions of liver immune genes TGF-β and IL-10 were down-regulated, and the gene expressions of IL-8, IFN-γ, and TNF-α were up-regulated, indicating that A. hydrophila caused inflammation in crucian carp, while the gene expressions of TGF-β and IL-10 were increased in the HP treatment group. The gene expression of TNF-α and IL-8 was decreased, indicating that HP could play an anti-inflammatory role and alleviate the inflammation reaction of Crucian carp infected by A. hydrophila. The inflammatory response of the body needs the balance of anti-inflammatory factors and pro-inflammatory factors to regulate, so as to alleviate the health damage caused by external stress or the destruction of balance after the invasion of pathogens [45]. TGF-β and IL-10 can maintain the body’s immune function, play a very important role in a variety of diseases, and are also important inflammatory suppressors, inhibiting inflammation and protecting the body from damage [46,47]. TNF-α, IFN-γ, and IL-8 are considered to be pro-inflammatory factors, which exist in the period of pathogen infection and can induce inflammatory or immune diseases in the body [48,49,50,51]. NF-κB is involved in the expression of regulatory factors in immune cells, protecting cells from TNF-α- and IL-8-induced cell proliferation and apoptosis [47,52]. In summary, HP can treat the inflammatory diseases caused by Aeromonas hydrophila infection on Crucian carp by up-regulating NF-κB, TGF-β, and IL-10 and reducing the gene expressions of TNF-α, IFN-γ and IL-8.
Adding feed additives to feed can change the diversity of intestinal flora and the microbial composition of aquatic animals and affect the growth and development of aquatic animals and their health status [53,54,55]. In this study, the combination analysis of α diversity and β diversity was used to speculate that HP reduce the richness and diversity of intestinal microbiota of crucian carp infected with A. hydrophila. PcoA analysis showed that the differences between the three groups were clearly separated, indicating that HP supplementation significantly changed the composition of intestinal microbiota. Zhang et al. [56] and Chang et al. [57] found that the intestinal microbiota of fish infected with A. hydrophila had significantly changed, increasing the relative abundance of Fusobacteriota, Firmicutes, and Bacteroidota while decreasing the abundance of Proteobacteria. In addition, the level of Cetobacterium was increased, which was consistent with the results of this study, and the intestinal microbiota structure of Crucian carp was changed by infection with A. hydrophila. Proteobacteria participates in the energy metabolism and circulation of carbon, nitrogen, and sulfur required by fish, which can be used as a feature of the microecological imbalance of intestinal microbiota [58,59]. Firmicutes and Bacteroidota affect the growth and energy metabolism of the body and exist as the main fixed-value bacteria in the healthy intestine [60]. Fusobacteriota can cause necrosis and inflammation in different tissues of the body [61]. Cetobacterium is highly abundant in healthy fish and can produce vitamin B12, which provides energy and nutrients to the body and promotes the repair of intestinal cells [62,63]. After HP supplementation, the relative abundance of Fusobacteriota and Bacteroidota decreased, and the relative abundance of Proteobacteria increased, while the relative abundance of Cetobacterium decreased. HP has a significant effect on regulating the imbalance of intestinal microbiota and maintaining the balance of bacterial community, increasing the immunity of Crucian carp.
Studies have shown that adding astragalus extract to feed can affect the metabolic capacity of aquatic animals and cause changes in metabolic level [49,64]. In this study, metabolomics was used to analyze the effect of HP on the intestinal metabolism of Crucian carp infected with A. hydrophila. In this experiment, a total of 147 different metabolites were identified by the metabolomics method based on LC-MS, of which 62 were significantly up-regulated and 85 were significantly down-regulated. Through OPLS-DA model analysis, we found that there were obvious partitions in the CG group and the HPAS group. Compared with the CG group, the main metabolite pathway of the HPAS group was the Linoleic acid metabolism pathway. Glycerophospholipid metabolism, Caffeine metabolism, Citrate cycle (TCA cycle), and Taurine and hypotaurine metabolism. Linoleic acid (LA) is considered to be an endogenous anti-inflammatory molecule [65] and is an essential long-chain polyunsaturated fatty acid (n-6 PUFAs) [66]. The increase in n-6 PUFA content will increase the inflammatory response of Crucian carp and reduce the immune function of the body [67]. LA concentration was significantly positively correlated with TNF-α and other inflammatory factors [68]. After HP intervention, linoleic acid metabolism and TNF-α gene expression level decreased. Therefore, HP down-regulates the metabolism of linoleic acid and then reduces the occurrence of inflammation in the body, but the specific mechanism needs to be further studied. In this study, LC-MS technology was used for the first time to explore changes in the metabolites of Crucian carp infected with A. hydrophila by HP. In this study, LC-MS technology was used to explore the changes in hawthorn polysaccharide on the metabolites of crucian carp infected with Aeromonas hydrophila. When crucian carp is infected with A. hydrophila, the dietary addition of HP can cause significant differences in metabolomics level, resist the invasion of pathogenic bacteria, and prevent and treat the inflammatory response of the body.

5. Conclusions

HP has shown significant effect in protecting Crucian carp from A. hydrophila. The dietary supplementation of HP can improve the antioxidant performance, immune performance, intestinal microbiota structure, and metabolic level of Crucian carp and help enhance the resistance of crucian carp to infection with A. hydrophila. This study provides a theoretical reference for the mechanism by which HP enhances the disease resistance of animals in aquacultures.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes10090451/s1, Table S1: The main metabolites of HP were significantly different from those of crucian carp infected with A. hydrophila.

Author Contributions

Writing—original draft and conceptualization, L.L.; software and investigation, Z.Z., S.W. and R.Z.; methodology and supervision, K.G., C.Z. and B.H.; validation and resources, W.W. (Wei Wang); Funding acquisition, W.W. (Wenhua Wu). All authors have read and agreed to the published version of the manuscript.

Funding

This project was funded by the Natural Science Foundation of Heilongjiang Province (LH2023C058); the National Key Research and Development Project (2023YFD2401003); the Central Public-interest Scientic Institution Basal Research Fund, CAFS (2023TD59).

Institutional Review Board Statement

This study was reviewed and approved by the Committee for the Welfare and Ethics of Laboratory Animals of the Heilongjiang River Fisheries Research Institute. All animal procedures were conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals of the Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences (CAFS) with the approval number: 20231101-001, dated: 1 November 2023.

Data Availability Statement

Data will be made available on request.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Xu, Z.; Yang, L.; Feng, L.; Jiang, W.; Wu, P.; Liu, Y.; Zhang, L.; Yang, J.; Zhou, X. An emerging role of guanidine acetic acid in rescuing immune function injured by Aeromonas hydrophila in grass carp (Ctenopharyngodon idella). Aquac. Rep. 2024, 35, 101950. [Google Scholar] [CrossRef]
  2. Zhang, Y.; Zhou, X.; Jiang, W.; Wu, P.; Liu, Y.; Ren, H.; Zhang, L.; Mi, H.; Tang, L.; Zhong, C.; et al. Emerging role of vitamin D3 in alleviating intestinal structure injury caused by Aeromonas hydrophila in grass carp (Ctenopharyngodon idella). Anim. Nutr. 2024, 16, 202–217. [Google Scholar] [CrossRef]
  3. Daskalov, H. The importance of Aeromonas hydrophila in food safety. Food Control 2006, 17, 474–483. [Google Scholar] [CrossRef]
  4. Wang, L.; Li, H.; Chen, J.; Wang, Y.; Gu, Y.; Jiu, M. Antibacterial mechanisms and antivirulence activities of oridonin against pathogenic Aeromonas hydrophila AS 1.1801. Microorganisms 2024, 12, 415. [Google Scholar] [CrossRef]
  5. Negi, P.S. Plant extracts for the control of bacterial growth: Efficacy, stability and safety issues for food application. Int. J. Food Microbiol. 2012, 156, 7–17. [Google Scholar] [CrossRef]
  6. Barbieri, R.; Coppo, E.; Marchese, A.; Daglia, M.; Sobarzo-Sánchez, E.; Nabavi, S.F.; Nabavi, S.M. Phytochemicals for human disease: An update on plant-derived compounds antibacterial activity. Microbiol. Res. 2017, 196, 44–68. [Google Scholar] [CrossRef]
  7. Li, X.; Hu, X.; Lv, A.; Guan, Z. Skin immune response to Aeromonas hydrophila infection in crucian carp Carassius auratus revealed by multi-omics analysis. Fish Shellfish Immunol. 2022, 127, 866–875. [Google Scholar] [CrossRef]
  8. Cao, Y.; Kou, T.; Peng, L.; Munang’andu, H.M.; Peng, B. Fructose promotes crucian carp survival against Aeromonas hydrophila infection. Front. Immunol. 2022, 13, 865560. [Google Scholar] [CrossRef]
  9. Meng, X.; Luo, L.; Zhao, Z.; Wang, S.; Zhang, R.; Guo, K. Ginger polysaccharide alleviates the effects of acute exposure to carbonate in crucian carp (Carassius auratus) by regulating immunity, intestinal microbiota, and intestinal metabolism. Ecotoxicol. Environ. Saf. 2024, 273, 116127. [Google Scholar] [CrossRef]
  10. Zhang, Z.; Li, J.; Wang, G.; Ling, F. The oral protective efficacy of magnolol against Aeromonas hydrophila and A. veronii infection via enhancing anti-inflammatory ability in goldfish (Carassius auratus). J. Fish Dis. 2023, 46, 1413–1423. [Google Scholar] [CrossRef]
  11. Wang, E.; Chen, X.; Liu, T.; Wang, K. Effect of dietary Ficus carica polysaccharides on the growth performance, innate immune response and survival of crucian carp against Aeromonas hydrophila infection. Fish Shellfish Immunol. 2021, 120, 434–440. [Google Scholar] [CrossRef]
  12. Wu, Z.; Pang, S.; Liu, J.; Zhang, Q.; Fu, S.; Du, J.; Chen, X. Coriolus versicolor polysaccharides enhance the immune response of crucian carp (Corassius auratus gibelio) and protect against Aeromonas hydrophila. J. Appl. Ichthyol. 2013, 29, 562–568. [Google Scholar] [CrossRef]
  13. Li, T.; Fu, S.; Huang, X.; Zhang, X.; Cui, Y.; Zhang, Z.; Ma, Y.; Zhang, X.; Yu, Q.; Yang, S.; et al. Biological properties and potential application of hawthorn and its major functional components: A review. J. Funct. Foods 2022, 90, 104988. [Google Scholar] [CrossRef]
  14. Cheng, L.; Yang, Q.; Li, C.; Zheng, J.; Wang, Y.; Duan, B. Preparation, structural characterization, bioactivities, and applications of Crataegus spp. polysaccharides: A review. Int. J. Biol. Macromol. 2023, 253, 126671. [Google Scholar] [CrossRef] [PubMed]
  15. Sun, Y.; Meng, X.; Chen, M.; Li, D.; Liu, R.; Sun, T. Isolation, structural properties and bioactivities of polysaccharides from Crataegus pinnatifida. J. Ethnopharmacol. 2023, 323, 117688. [Google Scholar] [CrossRef]
  16. Guo, C.; Wang, Y.; Zhang, S.; Zhang, X.; Du, Z.; Li, M.; Ding, K. Crataegus pinnatifida polysaccharide alleviates colitis via modulation of gut microbiota and SCFAs metabolism. Int. J. Biol. Macromol. 2021, 181, 357–368. [Google Scholar] [CrossRef]
  17. Zhou, K.; Zhou, Q.; Han, X.; Gao, Z.; Peng, R.; Lin, X.; Cheng, X.; Zhao, W. In vitro digestion and fecal fermentation of polysaccharides from hawthorn and its impacts on human gut microbiota. Processes 2022, 10, 1922. [Google Scholar] [CrossRef]
  18. Jing, Y.; Zhang, Y.; Yan, M.; Zhang, R.; Hu, B.; Sun, S.; Zhang, D.; Zheng, Y.; Wu, L. Structural characterization of a heteropolysaccharide from the fruit of Crataegus pinnatifida and its bioactivity on the gut microbiota of immunocompromised mice. Food Chem. 2023, 413, 135658. [Google Scholar] [CrossRef]
  19. Yu, W.; Wen, G.; Lin, H.; Yang, Y.; Huang, X.; Zhou, C.; Li, T. Effects of dietary Spirulina platensis on growth performance, hematological and serum biochemical parameters, hepatic antioxidant status, immune responses and disease resistance of Coral trout Plectropomus leopardus (Lacepede, 1802). Fish Shellfish Immunol. 2018, 74, 649–655. [Google Scholar] [CrossRef] [PubMed]
  20. Jiang, F. Application of natural polysaccharides and their derivatives biomaterials. Shandong Chem. Ind. 2020, 49, 93–94, 100. [Google Scholar] [CrossRef]
  21. Liu, Y.; Yan, S.; Du, Y.; He, Y.; Shi, H.; Wang, K.; Dou, T.; Liu, L.; Shen, Z.; Jia, J.; et al. Application and research progress of plant polysaccharides in fish breeding. J. Shanxi Agric. Sci. 2022, 50, 272–280. [Google Scholar]
  22. Wang, E.; Chen, X.; Wang, K.; Wang, J.; Chen, D.; Geng, Y.; Lai, W.; Wei, X. Plant polysaccharides used as immunostimulants enhance innate immune response and disease resistance against Aeromonas hydrophila infection in fish. Fish Shellfish Immunol. 2016, 59, 196–202. [Google Scholar] [CrossRef]
  23. Wang, Q.; Chen, C.; Guo, Y.; Zhao, H.; Sun, J.; Ma, S.; Xing, K. Dietary polysaccharide from Angelica sinensis enhanced cellular defence responses and disease resistance of grouper Epinephelus malabaricus. Aquacult. Int. 2011, 19, 945–956. [Google Scholar] [CrossRef]
  24. Rajendran, P.; Subramani, P.A.; Michael, D. Polysaccharides from marine macroalga, Padina gymnospora improve the nonspecific and specific immune responses of Cyprinus carpio and protect it from different pathogens. Fish Shellfish Immunol. 2016, 58, 220–228. [Google Scholar] [CrossRef]
  25. Chen, K.; Zheng, G.; Shen, Y.; Tan, X.; Tang, T.; Li, R. Clinical research progress of ginger umbilical application. Guangming J. Chin. Med. 2022, 37, 2933–2936. [Google Scholar] [CrossRef]
  26. Jing, Y.; Yan, M.; Liu, D.; Tao, C.; Hu, B.; Sun, S.; Zheng, Y.; Wu, L. Research progress on the structural characterization, biological activity and product application of polysaccharides from Crataegus pinnatifida. Int. J. Biol. Macromol. 2023, 244, 125408. [Google Scholar] [CrossRef]
  27. Beaz-Hidalgo, R.M.; Figueras, M.J. Aeromonas spp. whole genomes and virulence factors implicated in fish disease. J. Fish Dis. 2013, 36, 371–388. [Google Scholar] [CrossRef] [PubMed]
  28. Chen, X.; Zhang, F.; Chen, Z.; Wei, L.; Fan, Y.; Zhang, J.; Zhong, Q. Bactericidal efficacy comparisonof povidone iodineon Aeromonas hydrophila between detection methods. Fish. Sci. 2018, 37, 348–353. [Google Scholar] [CrossRef]
  29. Sonnenburg, J.L.; Bäckhed, F. Diet–microbiota interactions as moderators of human metabolism. Nature 2016, 535, 56–64. [Google Scholar] [CrossRef]
  30. Yang, S.; Feng, L.; Zhang, J.; Yan, C.; Zhang, C.; Huang, Y.; Li, Y. Effect of Purslane (Portulaca oleracea L.) on intestinal morphology, digestion activity and microbiome of Chinese Pond Turtle (Mauremys reevesii) during Aeromonas hydrophila Infection. Int. J. Mol. Sci. 2023, 24, 10260. [Google Scholar] [CrossRef] [PubMed]
  31. Chin, A.; Hill, D.R.; Aurora, M.; Spence, J.R. Morphogenesis and maturation of the embryonic and postnatal intestine. Semin. Cell Dev. Biol. 2017, 66, 81–93. [Google Scholar] [CrossRef]
  32. Hoon, K.B.; Pyo, H.S.; Hee, C.S.; Don, L.Y.; Hoon, L.C. Exploring rearing water temperature conditions for inducing body growth without water temperature stress in red-spotted grouper (Epinephelus akaara). Ocean Sci. J. 2023, 58, 25. [Google Scholar] [CrossRef]
  33. Zheng, X.; Chi, C.; Xu, C.; Liu, J.; Zhang, C.; Zhang, L.; Huang, Y.; He, C.; Jia, X.; Liu, W. Effects of dietary supplementation with icariin on growth performance, antioxidant capacity and non-specific immunity of Chinese mitten crab (Eriocheir sinensis). Fish Shellfish Immunol. 2019, 90, 264–273. [Google Scholar] [CrossRef]
  34. Li, Z.; Han, C.; Wang, Z.; Li, Z.; Ruan, L.; Lin, H.; Zhou, C. Black soldier fly pulp in the diet of golden pompano: Effect on growth performance, liver antioxidant and intestinal health. Fish Shellfish Immunol. 2023, 142, 109156. [Google Scholar] [CrossRef] [PubMed]
  35. Wang, Q.; Sun, D.; Wang, D.; Ye, B.; Wang, S.; Zhou, A.; Dong, Z.; Zou, J. Effect of dietary koumine on the immune and antioxidant status of carp (Cyprinus carpio) after Aeromonas hydrophila infection. Microb. Pathog. 2023, 186, 106464. [Google Scholar] [CrossRef]
  36. Feng, D.; Yu, Y.; Liu, K.; Su, Y.; Fan, T.; Guo, X.; Li, M. Effects of dietary leucine on growth, antioxidant capacity, immune response, and inflammation in juvenile yellow catfish Pelteobagrus fulvidraco. Front. Physiol. 2023, 14, 1247410. [Google Scholar] [CrossRef] [PubMed]
  37. El-Shenawy, N.S.; Mohammadden, A.; Al-Fahmie, Z.H. Using the enzymatic and non-enzymatic antioxidant defense system of the land snail Eobania vermiculata as biomarkers of terrestrial heavy metal pollution. Ecotoxicol. Environ. Saf. 2012, 84, 347–354. [Google Scholar] [CrossRef] [PubMed]
  38. Xiong, L.; Ouyang, K.H.; Chen, H.; Yang, Z.; Hu, W.; Wang, N.; Liu, X.; Wang, W. Immunomodulatory effect of Cyclocarya paliurus polysaccharide in cyclophosphamide induced immunocompromised mice. Bioact. Carbohydr. Diet. Fibre 2020, 24, 100224. [Google Scholar] [CrossRef]
  39. Liu, W.; Zha, P.; Guo, L.; Chen, Y.; Zhou, Y. Effects of different levels of dietary chlorogenic acid supplementation on growth performance, intestinal integrity, and antioxidant status of broiler chickens at an early age. Anim. Feed Sci. Technol. 2023, 297, 115570. [Google Scholar] [CrossRef]
  40. Zhu, W.; Dong, R.; Ge, L.; Yang, Q.; Lu, N.; Li, H.; Feng, Z. Effects of dietary n-6 polyunsaturated fatty acids (PUFA) composition on growth performances and non-specific immunity in pacific white shrimp (Litopenaeus vannamei). Aquacult. Rep. 2023, 28, 101436. [Google Scholar] [CrossRef]
  41. Singh, Z.; Karthigesu, I.P.; Singh, P.; Rupinder, K. Use of malondialdehyde as a biomarker for assessing oxidative stress in different disease pathologies: A review. Iran. J. Public Health 2014, 43, 7–16. [Google Scholar]
  42. Liang, S.; Luo, X.; You, W.; Luo, L.; Ke, C. The role of hybridization in improving the immune response and thermal tolerance of abalone. Fish Shellfish Immunol. 2014, 39, 69–77. [Google Scholar] [CrossRef]
  43. Pérez-Acosta, J.A.; Burgos-Hernandez, A.; Velázquez-Contreras, C.A.; Márquez-Ríos, E.; Torres-Arreola, W.; Arvizu-Flores, A.A.; Ezquerra-Brauer, J.M. An in vitro study of alkaline phosphatase sensitivity to mixture of aflatoxin B1 and fumonisin B1 in the hepatopancreas of coastal lagoon wild and farmed shrimp Litopenaeus vannamei. Mycotoxin Res. 2016, 32, 117–125. [Google Scholar] [CrossRef]
  44. Raja Rajeswari, P.; Velmurugan, S.; Michael Babu, M.; Albin Dhas, S.; Kesavan, K.; Citarasu, T. A study on the influence of selected Indian herbal active principles on enhancing the immune system in Fenneropenaeus indicus against Vibrio harveyi infection. Aquacult. Int. 2012, 20, 1009–1020. [Google Scholar] [CrossRef]
  45. Zhao, X.; Liu, X.; Yang, Y.; Lu, Y.; Zhu, L.; Li, L.; Kong, X. Myo-inositol enhances the resistance and alleviates inflammation of Cyprinus carpio to Aeromonas hydrophila infection. Aquaculture 2024, 578, 740056. [Google Scholar] [CrossRef]
  46. Luo, Q.; Hu, Z.; Zhao, H.; Fan, Y.; Tu, X.; Wang, Y.; Liu, X. The role of TGF-β in the tumor microenvironment of pancreatic cancer. Genes Dis. 2022, 13, 788–799. [Google Scholar] [CrossRef]
  47. Abosalif, K.O.A.; Abdalla, A.E.; Junaid, K.; Eltayeb, L.B.; Ejaz, H. The interleukin-10 family: Major regulators of the immune response against Plasmodium falciparum infections. Saudi J. Biol. Sci. 2023, 30, 103805. [Google Scholar] [CrossRef] [PubMed]
  48. Aggarwal, B.B. Signalling pathways of the TNF superfamily: A double-edged sword. Nat. Rev. Immunol. 2003, 3, 745–756. [Google Scholar] [CrossRef] [PubMed]
  49. He, R.; Li, X.; Zhang, S.; Liu, Y.; Xue, Q.; Luo, Y.; Yu, B.; Li, X.; Liu, Z. Dexamethasone inhibits IL-8 via glycolysis and mitochondria-related pathway to regulate inflammatory pain. BMC Anesthesiol. 2023, 23, 317. [Google Scholar] [CrossRef] [PubMed]
  50. Tang, L.; Fu, C.; Zhao, H.; Wang, B.; Jia, S.; Chen, H.; Cai, H. Up-regulation of Core 1 Beta 1, 3-Galactosyltransferase suppresses osteosarcoma growth with induction of IFN-γ secretion and proliferation of CD8+ T Cells. Curr. Cancer Drug Targets 2023, 23, 265–277. [Google Scholar] [CrossRef]
  51. Sun, J.; Chen, F.; Wu, G. Role of NF-κB pathway in kidney renal clear cell carcinoma and its potential therapeutic implications. Aging 2023, 15, 11313. [Google Scholar] [CrossRef] [PubMed]
  52. Zinatizadeh, M.R.; Momeni, S.A.; Zarandi, P.K.; Chalbatani, G.M.; Dana, H.; Mirzaei, H.R.; Akbari, M.E.; Miri, S.R. The Role and Function of Ras-association domain family in Cancer: A Review. Genes Dis. 2019, 6, 378–384. [Google Scholar] [CrossRef]
  53. Wong, S.; Rawls, J.F. Intestinal microbiota composition in fishes is influenced by host ecology and environment. Mol. Ecol. 2012, 21, 3100–3102. [Google Scholar] [CrossRef] [PubMed]
  54. Zheng, Y.; Zhu, H.; Li, Q.; Xu, G. The effects of different feeding regimes on body composition, gut microbial population, and susceptibility to pathogenic infection in largemouth bass. Microorganisms 2023, 11, 1356. [Google Scholar] [CrossRef]
  55. Luo, L.; Meng, X.; Wang, S.; Zhang, R.; Guo, K.; Zhao, Z.-G. Effects of dietary ginger (Zingiber officinale) polysaccharide on the growth, antioxidant, immunity response, intestinal microbiota, and disease resistance to Aeromonas hydrophila in crucian carp (Carassius auratus). Int. J. Biol. Macromol. 2024, 275, 133711. [Google Scholar] [CrossRef]
  56. Zhang, L.; Wang, L.; Huang, J.; Jin, Z.; Guan, J.; Yu, H.; Zhang, M.; Yu, M.; Jiang, H.; Qiao, Z. Effects of Aeromonas hydrophila infection on the intestinal microbiota, transcriptome, and metabolomic of common carp (Cyprinus carpio). Fish Shellfish Immunol. 2023, 139, 108876. [Google Scholar] [CrossRef]
  57. Chang, S.; Wang, J.; Dong, C.; Jiang, Y. Intestinal microbiota signatures of common carp (Cyprinus carpio) after the infection of Aeromonas hydrophila. Aquacult. Rep. 2023, 30, 101585. [Google Scholar] [CrossRef]
  58. Liu, H.; Chen, G.; Li, L.; Lin, Z.; Tan, B.; Dong, X.; Zhou, X. Supplementing artemisinin positively influences growth, antioxidant capacity, immune response, gut health and disease resistance against Vibrio parahaemolyticus in Litopenaeus vannamei fed cottonseed protein concentrate meal diets. Fish Shellfish Immunol. 2022, 131, 105–118. [Google Scholar] [CrossRef]
  59. Jin, X.; Su, M.; Liang, Y.; Li, Y. Effects of chlorogenic acid on growth, metabolism, antioxidation, immunity, and intestinal flora of crucian carp (Carassius auratus). Front. Microbiol. 2023, 13, 1084500. [Google Scholar] [CrossRef]
  60. Sun, Y.; Zhang, S.; Nie, Q.; He, H.; Tan, H.; Geng, F.; Nie, S. Gut firmicutes: Relationship with dietary fiber and role in host homeostasis. Crit. Rev. Food Sci. Nutr. 2022, 63, 12073–12088. [Google Scholar] [CrossRef] [PubMed]
  61. Han, Y.; Ikegami, A.; Rajanna, C.; Kawsar, H.I.; Zhou, Y.; Li, M.; Sojar, H.T.; Genco, R.J.; Kuramitsu, H.K.; Deng, C.X. Identification and characterization of a novel adhesin unique to oral fusobacteria. J. Bacteriol. 2005, 187, 5330–5340. [Google Scholar] [CrossRef]
  62. McCormick, D.B. The vitamins: Fundamental aspects in nutrition and health. Am. J. Clin. Nutr. 1999, 70, 426–427. [Google Scholar] [CrossRef]
  63. Ofek, T.; Izhaki, I.; Halpern, M. Aeromonas hydrophila infection in tilapia triggers changes in the microbiota composition of fish internal organs. FEMS Microbiol. Ecol. 2023, 99, 137. [Google Scholar] [CrossRef]
  64. Zhang, X.; Xiao, J.; Guo, Z.; Zhong, H.; Luo, Y.; Wang, J.; Tang, Z.; Huang, T.; Li, M.; Zhu, J.; et al. Transcriptomics integrated with metabolomics reveals the effect of Lycium barbarum polysaccharide on apoptosis in Nile tilapia (Oreochromis niloticus). Genomics 2022, 114, 229–240. [Google Scholar] [CrossRef]
  65. Das, U.N. Essential fatty acids: Biochemistry, physiology and pathology. Biotechnol. J. 2006, 1, 420–439. [Google Scholar] [CrossRef] [PubMed]
  66. Horman, T.; Fernandes, M.F.; Tache, M.C.; Hucik, B.; Mutch, D.M.; Leri, F. Dietary n-6/n-3 Ratio influences brain fatty acid composition in adult rats. Nutrients 2020, 12, 1847. [Google Scholar] [CrossRef] [PubMed]
  67. Vazquez, W.; Arya, G.; Garcia, V. Long-Chain predominant lipid emulsions inhibit in vitro macrophage tumor necrosis factor production. JPEN. J. Parenter. Enter. Nutr. 1994, 18, 35–39. [Google Scholar] [CrossRef] [PubMed]
  68. Bai, Q.; Huang, J.; Zhou, X.; Li, Y.; Qin, L. Relationship between serum phospholipid polyunsaturated fatty acid profile and systemic low-grade inflammation in patients with coronary heart disease. J. Trop. Med. 2019, 19, 181–184. [Google Scholar]
Fishes 10 00451 g001
Figure 1. Schematic representation of experimental design in this study.
Figure 1. Schematic representation of experimental design in this study.
Fishes 10 00451 g001
Fishes 10 00451 g002
Figure 2. The Effect of HP on the survival of crucian carp infected with A. hydrophila.
Figure 2. The Effect of HP on the survival of crucian carp infected with A. hydrophila.
Fishes 10 00451 g002
Fishes 10 00451 g003
Figure 3. The effect of HP on the intestinal morphology of Crucian carp infected with A. hydrophila. (A). CON group; (B). CG group; (C). HPAS group.
Figure 3. The effect of HP on the intestinal morphology of Crucian carp infected with A. hydrophila. (A). CON group; (B). CG group; (C). HPAS group.
Fishes 10 00451 g003
Fishes 10 00451 g004
Figure 4. The effect of HP on the antioxidant capacity of crucian carp infected with A. hydrophila. (A). T-AOC; (B). CAT; (C). SOD; (D). MDA; (E). GSH-PX. The mean values marked with different letters (a–c) were signiffcantly different (p < 0.05).
Figure 4. The effect of HP on the antioxidant capacity of crucian carp infected with A. hydrophila. (A). T-AOC; (B). CAT; (C). SOD; (D). MDA; (E). GSH-PX. The mean values marked with different letters (a–c) were signiffcantly different (p < 0.05).
Fishes 10 00451 g004
Fishes 10 00451 g005
Figure 5. The effect of HP on the immune gene expression of crucian carp infected with A. hydrophila. (A). TGF-β; (B). NF-κB; (C). IL-8; (D). IL-10; (E). TNF-α; (F). IFN-γ The mean values marked with different letters (a,b) were signiffcantly different (p < 0.05).
Figure 5. The effect of HP on the immune gene expression of crucian carp infected with A. hydrophila. (A). TGF-β; (B). NF-κB; (C). IL-8; (D). IL-10; (E). TNF-α; (F). IFN-γ The mean values marked with different letters (a,b) were signiffcantly different (p < 0.05).
Fishes 10 00451 g005
Fishes 10 00451 g006
Figure 6. The rarefaction curve analysis of intestinal microbiota diversity, Shannon index (A), and rank–abundance curve (B). The weighted UniFrac distance-based PCoA (C) and the unweighted UniFrac distance-based PCoA (D).
Figure 6. The rarefaction curve analysis of intestinal microbiota diversity, Shannon index (A), and rank–abundance curve (B). The weighted UniFrac distance-based PCoA (C) and the unweighted UniFrac distance-based PCoA (D).
Fishes 10 00451 g006
Fishes 10 00451 g007
Figure 7. The Relative abundance of intestinal microbes at the phylum level (A) and at the genus level (B).
Figure 7. The Relative abundance of intestinal microbes at the phylum level (A) and at the genus level (B).
Fishes 10 00451 g007
Fishes 10 00451 g008
Figure 8. Intergroup variation in the relative abundance of intestinal microbiota. (A) Lefse branching map; (B) LDA score of Lefse-PICRUSt at the genus level.
Figure 8. Intergroup variation in the relative abundance of intestinal microbiota. (A) Lefse branching map; (B) LDA score of Lefse-PICRUSt at the genus level.
Fishes 10 00451 g008
Fishes 10 00451 g009
Figure 9. Qualitative analysis of metabolomics data. The orthogonal partial least squares discriminant analysis (OPLS-DA) (A) score plot and (B) arrangement test for positive ion mode. The OPLS-DA (C) score plot and (D) arrangement test for negative ion model.
Figure 9. Qualitative analysis of metabolomics data. The orthogonal partial least squares discriminant analysis (OPLS-DA) (A) score plot and (B) arrangement test for positive ion mode. The OPLS-DA (C) score plot and (D) arrangement test for negative ion model.
Fishes 10 00451 g009
Fishes 10 00451 g010
Figure 10. (A). Volcano map showing the regulation of the metabolism of Crucian carp by HP after infection with A. hydrophila. Red and green dots indicate metabolites that are significantly upregulated and downregulated, respectively, while gray dots indicate no significant difference; (B). KEGG enrichment analysis of differential metabolites. Rich factor refers to the ratio of the differential metabolites in corresponding pathways to the total number of metabolites detected in the same pathway. The color of the dot represents the p-value. The dot size represents the relative number of significantly different metabolites enriched in the corresponding pathway.
Figure 10. (A). Volcano map showing the regulation of the metabolism of Crucian carp by HP after infection with A. hydrophila. Red and green dots indicate metabolites that are significantly upregulated and downregulated, respectively, while gray dots indicate no significant difference; (B). KEGG enrichment analysis of differential metabolites. Rich factor refers to the ratio of the differential metabolites in corresponding pathways to the total number of metabolites detected in the same pathway. The color of the dot represents the p-value. The dot size represents the relative number of significantly different metabolites enriched in the corresponding pathway.
Fishes 10 00451 g010
Fishes 10 00451 g011
Figure 11. Heatmap of significantly different gill metabolites between HPAS and CG.
Figure 11. Heatmap of significantly different gill metabolites between HPAS and CG.
Fishes 10 00451 g011
Table 1. Primers sequences for qRT-PCR.
Table 1. Primers sequences for qRT-PCR.
Primers Sequence (5′−3′)
β-ActinFCAAGATGATGGTGTGCCAAGTG
RTCTGTCTCCGGCACGAAGTA
TNF-αFTTATGTCGGTGCGGCCTTC
RAGGTCTTTCCGTTGTCGCTTT
IFN-γFAACAGTCGGGTGTCGCAAG
RTCAGCAAACATACTCCCCAG
IL-10FGGAACGATGGGCAGATCAA
RAACTGAAGGGGAAGGGGAAG
NF-κBFAATGTGGTGCGTCTGTGCTT
RTGTTGTCATAGATGGGGTTGGA
IL-8FCTGAGAGTCGACGCATTGGAA
RTGGTGTCTTTACAGTGTGAGTTTGG
TGF-βFGTTGGCGTAATAACCAGAAGG
RAACAGAACAAGTTTGTACCGATAAG
Table 2. Effects of HP on growth performance of crucian carp after 8 weeks.
Table 2. Effects of HP on growth performance of crucian carp after 8 weeks.
ParametersGroup
Control0.1% HP0.2% HP0.4% HP0.8% HP
IBW (g)122.14 ± 8.73121.09 ± 6.49119.59 ± 9.71113.18 ± 12.32122.02 ± 14.90
FBW (g)480.82 ± 118.31399.92 ± 31.44424.73 ± 71.66478.60 ± 41.82448.04 ± 28.08
WGR (%)294.87 ± 25.59 ab231.74 ± 42.51 a253.46 ± 32.25 ab325.71 ± 54.09 b271.33 ± 56.84 ab
SGR (%)2.45 ± 0.12 ab2.13 ± 0.23 a2.25 ± 0.17 ab2.58 ± 0.23 b2.33 ± 0.27 ab
SR (%)100100100100100
The mean values marked with different letters (a,b) were signiffcantly different (p < 0.05).
Table 3. The alpha diversity indices of the intestinal microbiota.
Table 3. The alpha diversity indices of the intestinal microbiota.
Group
CON CG HPAS
chao977.60 ± 138.85 b79.18 ± 15.43 a71.16 ± 5.31 a
coverage0.99 ± 0.00 a1.00 ± 0.00 b1.00 ± 0.00 b
shannon3.83 ± 0.65 b1.43 ± 0.02 a1.77 ± 0.22 a
simpson0.08 ± 0.06 a0.34 ± 0.00 c0.26 ± 0.04 b
The mean values marked with different letters (a–c) were signiffcantly different (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Luo, L.; Zhao, Z.; Wang, S.; Zhang, R.; Guo, K.; Zhao, C.; He, B.; Wang, W.; Wu, W. Hawthorn Polysaccharide Enhances Growth, Immunity, and Intestinal Health in Crucian Carp (Carassius auratus) Challenged with Aeromonas hydrophila. Fishes 2025, 10, 451. https://doi.org/10.3390/fishes10090451

AMA Style

Luo L, Zhao Z, Wang S, Zhang R, Guo K, Zhao C, He B, Wang W, Wu W. Hawthorn Polysaccharide Enhances Growth, Immunity, and Intestinal Health in Crucian Carp (Carassius auratus) Challenged with Aeromonas hydrophila. Fishes. 2025; 10(9):451. https://doi.org/10.3390/fishes10090451

Chicago/Turabian Style

Luo, Liang, Zhigang Zhao, Shihui Wang, Rui Zhang, Kun Guo, Cheng Zhao, Baoquan He, Wei Wang, and Wenhua Wu. 2025. "Hawthorn Polysaccharide Enhances Growth, Immunity, and Intestinal Health in Crucian Carp (Carassius auratus) Challenged with Aeromonas hydrophila" Fishes 10, no. 9: 451. https://doi.org/10.3390/fishes10090451

APA Style

Luo, L., Zhao, Z., Wang, S., Zhang, R., Guo, K., Zhao, C., He, B., Wang, W., & Wu, W. (2025). Hawthorn Polysaccharide Enhances Growth, Immunity, and Intestinal Health in Crucian Carp (Carassius auratus) Challenged with Aeromonas hydrophila. Fishes, 10(9), 451. https://doi.org/10.3390/fishes10090451

Article Metrics

Back to TopTop