Transcriptomic Analysis of Endocrine System Responses in Zebrafish Embryos Following Exposure to Environmentally Relevant Concentrations of Arsenate

Abstract

Water environments contaminated with arsenic (As) have become a significant environmental concern. Previous research has highlighted the detrimental effects of As on fish, but limited knowledge exists regarding its impacts on endocrine systems. To address this gap, zebrafish embryos were exposed to various concentrations (0, 25, 50, 75, and 150 μg/L) of arsenate (AsV) for 120 h post-fertilization (hpf). Our findings indicate that exposure to AsV significantly increases cortisol- and thyroid-stimulating hormone (TSH) levels while decreasing estradiol (E2) and testosterone (T) levels. Additionally, it initially decreases and then increases thyroxine (T4) contents. Furthermore, several key genes relevant to these endocrine systems also show significant influences. The results from principal component analysis demonstrate that TRH, TSH, TRHRb, and TRβ primarily affect the level of T4 while Cyp11b, StAR, hmgrb MC2R, and GR mainly influence cortisol levels. On the other hand, Cyp19a, Cyp17, 17βhsd, ERβ, LHR, hmgrb, and AR predominantly impact E2 and T levels. Transcriptomics and enrichment analysis reveal that these pathways are primarily associated with steroid hormone synthesis and transport. Furthermore, it was found that AsV stimulates the cAMP signaling pathway through a compensation mechanism. These results suggest that AsV may potentially act as environmental endocrine-disrupting chemicals with non-negligible interference effects on the endocrine system in zebrafish. This study holds theoretical value in assessing the environmental risk posed by As overall as well as providing an important basis for addressing human health issues and implementing preventive measures.

1. Introduction

Arsenic (As) is a well-documented carcinogen, notorious for its remarkable toxicity [1,2,3]. It pervades various media and ultimately is released into aquatic environments, resulting in water contamination caused by As. Numerous studies have documented instances of As-contaminated water. For instance, Li et al. reported that As concentrations went up to 131 μg/L in Yarlung Tsangbo in Tibet, China [4]. Similarly, Weiske et al. reported that 160 μg/L As was detected in the Altenberg reservoir located in Saxony, Germany [5]. Barrett et al. found that As concentrations could range up to 56 μg/L in Angle Lake in the United States [6]. The high toxicity of As poses a significant threat to aquatic organisms, with fish being widely recognized as the most appropriate indicator species for assessing contamination in aquatic systems, thereby attracting increased attention [7,8]. To date, numerous studies have demonstrated that As can induce toxic effects in fish, even at environmentally relevant concentrations; for example, our previous studies demonstrated that exposure to 0~150 μg/L As can induce apoptosis in the liver and damage the gills of adult zebrafish, as well as caused oxidative damage and delay the heart development of zebrafish in the early life stage [9,10]. Nayak et al. found that As exposure at concentrations of 2~10 μg/L for 7 days significantly impairs the innate immune function of zebrafish embryos, reducing their ability to clear viral and bacterial infections, diminishing the respiratory burst response, and delaying or abrogating the induction of antiviral and antibacterial cytokines [11]. Kumar et al. showed that 15-day exposure to 10 μg/L As significantly impacts fish genotoxicity, leading to a significantly increase in the frequency of micronucleated cells in pond murrel (Channa punctatus) and goldfish (Carassius auratus) [12]. In addition, some studies have proposed that As is an potential endocrine disruptor, which can cause detrimental effects on endocrine systems; for example, Boyle et al. reported that exposure to As can cause it to accumulate in zebrafish (Danio rerio) and disrupt their reproductive function via decreasing embryo numbers [13]. Sun et al. discovered that zebrafish exhibited an increase in thyroxine levels after being exposed to 4.2 mg/L As for 48 h [14], and Thang et al. found that the accumulation of As in Oreochromis sp. resulted in a reduction in plasma cortisol levels [15]. However, these studies provide some evidence that is insufficient to elucidate the toxic effects of As on endocrine systems and the underlying mechanisms responsible for the As-induced disruption of these systems.

The endocrine system consists of various glands that produce and secrete hormones, which are transported to distant target organs, thereby regulating metabolism, growth, and development in humans. The regulation of sex hormones, thyroxine, and cortisol is governed by the hypothalamic–pituitary–gonad (HPG) axis, hypothalamic–pituitary–thyroid (HPT) axis, and hypothalamic–pituitary–adrenal (HPA) axis within the endocrine system, respectively [16]. Therefore, it is necessary to investigate the impacts of As on the HPG, HPT, and HPA axes as well as identify the mechanisms involved in the As-induced disruption of fish’s endocrine systems.

Zebrafish (Danio rerio) embryos, recommended by the Organization for Economic Co-operation and Development (OECD), serve as ideal experimental materials for evaluating the impact of chemicals on endocrine disruption due to their rapid embryonic development [17,18]. Hence, we employed zebrafish embryos to delve into the toxic effects of arsenic (As) on the HPG, HPT, and HPA axes, as well as unraveling the mechanisms underlying As-induced endocrine toxicity. Given that in aquatic environments, As exists as a mixture of arsenate (AsV) and arsenite (AsIII), with AsV typically prevailing, our research aimed at the following: (i) assessing the endocrine-disrupting toxicity of AsV; (ii) elucidating how AsV disrupts the endocrine system in zebrafish embryos; and (iii) comprehending the cross-talk effect of AsV on zebrafish’s endocrine systems. These findings offer novel insights into both the effects and mechanisms of AsV on the gonadal, thyroidal, and adrenal endocrine systems while providing new evidence concerning health risks associated with exposure to As.

2. Materials and Methods

2.1. Fish Maintenance and Embryos Acquisition

Wild-type, adult, AB-strain zebrafish were obtained from the China Zebrafish Resource Center (Wuhan, China). The zebrafish was cultured in an ESEN circulating system (Beijing, China), and the culture conditions were consistent with the method described by our previous study [19]. Briefly, the system was operated under optimal conditions for the well-being of the zebrafish, including maintaining a pH of 7.3 ± 0.3, an oxygen level ≥ 5 mg/L, and a conductivity of 520 ± 80 μS/cm. The photoperiod followed a light/dark cycle of 14/10 h, while the temperature was maintained at 27.5 ± 0.5 °C. The zebrafish were provided with brine shrimp larvae three times a day. To induce spawning, one female and one male individual were placed overnight in a separate incubator before spawning started the next day. The new embryos were cleaned using E3 medium and checked using an SXZ7 Olympus microscope (Olympus, Tokyo, Japan). Only embryos exhibiting normal development in the blastocyst stage (within 2 h post-fertilization (hpf)) were selected for further experimentation.

2.2. Arsenic Exposure

Arsenate (AsV; Na₂HAsO₄•7H₂O) was dissolved in ultrapure water to create AsV stock solution. The AsV stock solution was then added to E3 (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, 0.33 mM MgSO4, pH 7.4) medium to make the different exposure doses (0, 25, 50, 75, and 150 μg/L). Each dish (25 mm × 40 mm) contained 30 eggs and was filled with a volume of solution equal to 10 mL for each treatment replicate. The experiments were conducted at a temperature of 28 ± 0.5 °C under semi-static conditions. In our previous studies, we observed that arsenite (AsIII) maintains stability in solution [14]. Compared to AsIII, AsV exhibits greater stability. Therefore, we chose the same protocol to refresh the AsV exposure solution, replacing it every 24 h. After exposure for 120 hpf, the zerbafish larvae were washed with physiological saline solution at 4 °C and collected, snap-frozen in dry ice, and stored at −80 °C until further analysis.

2.3. Hormone Measurement

After exposure to AsV for 120 hpf, the zebrafish larvae were collected to measure the levels of thyroid-stimulating hormone (TSH), estradiol (E2), testosterone (T), thyroxine (T4), and cortisol. These measurements were conducted using enzyme-linked immune-sorbent assay (ELISA) kits according to the manufacturer’s protocols (Cusabio, Wuhan, China). Briefly, after collection, the larvae were rinsed with ultrapure water. Approximately 200 mg of zebrafish larvae in each treatment was homogenized in 2 mL of lysis buffer (with 10% larvae in the lysis buffer) using a homogenizer. The homogenate was then centrifuged at 12,000 for 5 min at 4 °C, and the supernatants were removed and assayed immediately. Finally, we measured the absorbance of hormones using a microplate reader (Infinite M Nano, Tecan, Switzerland) at 450 nm. All experiments were repeated three times.

2.4. Transcriptomic Analysis

We performed transcriptomic analysis of the AsV treatments and control groups. We homogenized sixscore larvae (in three replicates) and isolated total RNA using TRIzol reagent (TaKaRa, Osaka, Japan), according to the instructions of TaKaRa manufacturer. We measured the quality and concentration of total RNA using a spectrophotometer (NanoDrop One, Thermo Scientific, Waltham, MA, USA). We selected RNA samples with an A260/A280 ratio ranging from 1.9 to 2.1 for subsequent analysis. We analyzed the length of these RNA samples using the Agilent 2100 bioanalyzer (Santa Clara, CA, USA). Next, we pooled these selected RNA samples and added them to a fragmentation buffer for cDNA synthesis and subsequent sequencing. We filtered out low-quality reads using the Illumina HiSeqTM2500 sequencer (San Diego, CA, USA). We aligned the resulting pass-filter reads against the zebrafish genome assembly Danio rerio GRCz10.84 using Tophat2 software. We evaluated sequencing quality control using the Fas-tOC tool and ensured a sequencing error rate of less than 0.1% at single base positions. Over 70% of the reads were successfully mapped to the genome assembly, with less than 10% being multiple mapped reads that were utilized for aligning RNA-seq data. We performed gene structure analysis and gene expression-level analysis on the reads using DESeq. We identified differentially expressed genes by applying a hypergeometric test with log2(Foldchange) > 1 and q-value < 0.05 thresholds between the control and treated groups. These DEGs were used for subsequent analyses. All read data were publicly deposited in the NCBI sequence Read Archive (SRA) database.

2.5. RNA Isolation and cDNA Synthesis RNA Isolation, cDNA Synthesis, and Quantitative Real-Time PCR (qRT-PCR) Analysis

We used the RNA isolation and cDNA synthesis protocol outlined in our previous study to extract total RNA from sixty zenbrafish larvae in each group, employing Trizol reagent (TaKaRa, Japan) [19]. We performed reverse transcription on 1 μg of isolated RNA using random primers and reverse transcriptase. We employed SYBR Premix Ex Taq II for qRT-PCR analysis to measure the expression levels of genes and β-action. We used 0.5 μL of cDNA, along with 10 pmole of both forward and reverse primers (

Table 1. Primer sequence for quantitative reverse transcription–polymerase chain reaction used in this study.

Gene Name	Forward Primers (5′-3′)	Reverse Primers (5′-3′)	NCBI Accession
β-actin	atggatgaggaaatcgctgcc	ctccctgatgtctgggtcgtc	AF057040.1
dio2	ttataagccagctgccggtc	caccgtaggctatgttggca	NM_212789.4
dio3a	cgcgtacggagcttacttcg	tcacggagaatacaggtgcg	NM_001256003.1
trhrb	cttcctccaggacgcttacc	ctgccttattggcctgagca	NM_001114688.1
nis	gccacagatttctgacacgc	aagactggaacagcccgatg	BC134942.1
trα	ctatgaacagcacatccgacaagag	cacaccacacacggctcatc	BC096778.1
trβ	tgggagatgatacgggttgt	ataggtgccgatccaatgtc	XM_068215030.1
ugt1ab	gcctctctgctccacaagtt	atccactggcatgacaagca	NM_213422.2
tshr	gctccttgatgtgtccgaat	cgggcagtcaggttacaaat	NM_001145763.2
tshβ	gcagatcctcacttcacctacc	gcacaggtttggagcatctca	BC163605.1
crh	tttagtcgaaccgcagccaa	cgacaaccacgtgcagattc	EU052232.1
star	gaacaagctctccggacctg	gcccttgttgcacatagcac	NM_131663.1
hmgrb	ctgggataccgtctggaagc	caagagctgaagagtccggg	NM_001014292.3
pomc	gaggggagtgaggatgttgtgt	tcggagggaggctgtagatg	AY125332.2
hsd3b	gtgctccgacccttcctaac	ctggcacgtttaaccaacagg	NM_001386297.1
gr	ttctacgttgctgacgatgc	ccggtgttctcctgtttgat	EF567112.1
mr	attgggcctagtgcaaaatg	tctctgtttggctcggtctt	EF567113.1
mc2r	ctccgttctcccttcatctg	gcagatccttgaagctgagg	NM_180971.1
cyp11a	gaggggtggactcggttactt	gcaatacgagcggctgagat	NM_152953.2
cyp11b	ctgggccacacatcgagag	agcgaacggcagaaatcc	BC155806.1
cyp17	agcactcgtgatgtcggttt	tagattccccctgtcgctga	NM_212806.3
erα	agcatccagcctgtaatggga	agttgacagaggagctgatgc	KF275027.1
erβ	tgtcaagcggcctattctgg	ttcgaaggccgatgctactg	AF516874.1
ar	atctgtgcgctagcaggaat	caactgcgagtggaaagtca	NM_001083123.1
gnrh2	acctcaagagaagacgtgcc	caggataccagccgtgagac	NM_181439.4
gnrhr2	tgtcgtgttgtccataccgc	gcagctgcactttgttggac	NM_001144979.1
fshβ	ctccacgaaactcccgcagat	tggtgtcgattgtgacgcag	NM_205624.1
fshr	gcaggctaacctgacctacc	accagatcagaacacgcagg	AY278107.1
lhβ	tgagaccattaacctgcccg	gtccgaggtctagtatgcgg	NM_205622.2
lhr	acgcgttgtatcaacttcaagc	gatctccggacactcgaaaca	AY424302.1
17βhsd	tcgtcttgactgggacttgc	tttcgaaagctgcccatttcc	NM_200136.1
cyp19a	tccagccctgtggaatgaag	tgtagctccacacgcattgt	NM_131154.3

) and ultrapure water as necessary. We conducted PCR reactions with a thermal cycling profile consisting of an initial denaturation step at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s, annealing at 60 °C for 30 s, and extension steps as per requirements. We analyzed fluorescence results obtained from three reactions of reach sample using Roche Cycler96 (Basel, Switzerland). We enhanced accuracy and validity by performing three biological replicated experiments. We calculated the relative mRNA transcriptional levels utilizing the 2^−ΔΔCT method [20].

2.6. Statistical Analysis

All data are presented as the mean ± SD and were analyzed by one-way analysis of variance followed by Duncan’s multiple-range test (α = 0.05). All statistical analyses were conducted using SPSS 21 software (New York, NY, USA) and graphs were generated using SigmaPlot 9.0.

3. Results

3.1. Hormone

As shown in Figure 1, AsV exposure significantly affected the levels of hormones in zebrafish larvae. After exposure to AsV for 120 hpf, TSH levels and T4 levels firstly showed a decrease and then an increase, and TSH levels recovered to a normal level at 150 μg/L, while T4 levels significantly increased at 150 μg/L. For cortisol, the level was increased at 75–150 μg/L. For E2, the level was significantly decreased in the 150 μg/L treatment, and the T level showed a decrease in the 25 and 150 μg/L treatments.

3.1.1. HPT Axis

The mRNA transcription of genes related to the HPT axis is shown in Figure 2. The transcription levels of mRNA for tshβ were significantly down-regulated in the 25 and 150 μg/L AsV treatments, while the mRNA transcription of trβ was significantly up-regulated with 25, 75, and 150 μg/L AsV. The mRNA transcription of deiodinase 2 (dio2) and deiodinase 3a (dio3a) showed a trend of first increasing and then decreasing due to exposure to AsV. In addition, the mRNA transcription of trα showed an interesting trend, which increased in a dose-dependent manner, except for in the 50 μg/L AsV treatment.

3.1.2. HPA Axis

The mRNA transcription of HPA axis-related genes is shown in Figure 3. The mRNA transcription for corticotropin-releasing hormone (crh) was significantly up-regulated in the 50 and 150 μg/L AsV treatments, while it was down-regulated in the 75 μg/L AsV treatment. Meanwhile, the mRNA transcription of pomc was significantly down-regulated in the 150 μg/L AsV treatment, while 3β-hydroxysteroid dehydrogenase (hsd3b) was significantly down-regulated in the 25 and 150 μg/L treatments. The mRNA transcription of cytochrome P450 aromatase 11a (cyp11a) was significantly up-regulated in the 50 μg/L AsV treatment, while gr was significantly up-regulated by exposure to AsV. The mRNA transcription of cytochrome P450 aromatase 11b (cyp11b), hydroxymethylglutaryl-CoA reductases (hmcrb), and mr showed the trend of first increasing and then decreasing due to exposure to AsV. In addition, the mRNA transcription of steroidogenetic acute regulatory protein (star) showed an interesting trend, which increased in a dose-dependent manner, except for in the 50 μg/L treatment.

3.1.3. HPG Axis

The mRNA transcription of HPG axis-related genes is shown in Figure 4. The mRNA transcription for cytochrome P450 aromatase 17 (cyp17) was significantly up-regulated by exposure to AsV, while luteinizing hormone beta (lhβ) and follicle-stimulating hormone beta (fshβ) were significantly down-regulated by exposure to AsV. In addition, the mRNA transcription of cytochrome P450 aromatase 19a (cyp19a), 17β-hydroxysteroid dehydrogenase (17βhsd), erβ, lhr, and fshr showed a trend of first increasing and then decreasing.

3.2. Gene

As shown in Figure 5, the expression levels represent the numbers of different expressed genes obtained from zebrafish larvae treated with different AsV treatments. The expressed genes common to the zebrafish treated with AsV were sorted by Venn diagram analysis. Subsequently, the expressed genes that were differentially expressed between the zebrafish treated with AsV were filtered as follows: with fold ratios of 1.4 and −1.4. The functional analysis of the differentially expressed genes (DEGs) from KEGG databases was enriched using Gene Spring GX 11.5.1 (Agilent Technologies, San Clara, CA, USA). The data produced in this study are available from the Gene Expression Omnibus database (GSE77148).

3.3. Transcriptome Analysis

Analysis of GO terms showed AsV-induced changes in transcripts involved in reverse cholesterol transport, steroid metabolic process, cholesterol binding, cholesterol efflux, and cholesterol esterification (Figure 6). KEGG pathway analysis was used to analyze genes with significantly different expression levels (Figure 7). The main pathways affected by AsV exposure were the cholesterol metabolism and steroid hormone biosynthesis pathways.

4. Discussion

Zebrafish larvae were utilized to evaluate endocrine disruption resulting from AsV exposure. T4 was employed as an indicator of thyroid hormone (TH) levels, while TSH plays a crucial role in regulating THs in organisms and is considered an important biomarker for indicating thyroid dysfunction [21]. In this study, we found that TSH levels were significantly decreased in the 25, 50 and 75 μg/L AsV treatments and recovered to a normal level in the 150 μg/L treatment; these data indicate that ≥75 μg/L AsV exposure inhibited TSH levels and 150 μg/L AsV exposure probably caused a more severe effect on TSH production (Figure 1A). TSH is responsible for regulating T4 levels, and T4 levels also exhibited similar changes, which a decrease in the 50 μg/L AsV treatment and a gradual increase in the 75 and 150 μg/L AsV treatments (Figure 1B). A similar case was reported by Lei et al., who found that pentachlorophenol decreased T4 content by inhibiting TSH secretion [22]. Hence, we hypothesize that AsV probably inhibits T4 secretion through the inhibition of TSH synthesis, thereby interfering with the HPT axis. In addition, we also found that ≥75 μg/L AsV exposure significantly increased cortisol levels (Figure 1C), suggesting that ≥75 μg/L AsV caused cortisol production. Similar cases have also been reported in AsIII studies. Kim and Kang discovered that exposure to 100 μg/L AsIII significantly elevated cortisol levels in rockfish [23]. Meanwhile, exposure to AsV also demonstrated a significant impact on the levels of estradiol and testosterone, with both hormones being markedly suppressed at 150 µg/L AsV treatments (Figure 1D,E). These results indicate that AsV displayed different effects on sex hormones. Lee et al. also found that estradiol and testosterone levels were obviously reduced by 4-hydroxyphenyl 4-isoprooxyphenylsulfone in male zebrafish [24]. This indicates that AsV may interfere with the HPG axis and impact the sex differentiation of zebrafish by inhibiting E2 and T synthesis. Overall, exposure to AsV resulted in alterations in T4, TSH, cortisol, E2, and T levels in larvae, providing evidence for potential endocrine disruption caused by AsV in fish.

The HPT, HPA, and HPG axes play a crucial role in maintaining the homeostasis of T4, cortisol, estradiol, and testosterone levels [25,26]. Therefore, we further explored the effects of AsV on the HPT, HPA, and HPG endocrine systems. For the HPT axis, it released thyrotropin-releasing hormone from the hypothalamus to stimulate the pituitary gland to secrete TSH, and then TSH triggered the synthesis of THs by the thyroid (Figure 2). We conducted an analysis of gene responses associated with the HPT axis and specific transporters for TH in response to AsV exposure. Our findings indicated that the effects of AsV on THs levels caused gene transcription changes. For instance, our study observed a significant down-regulation of tshβ transcript levels following exposure to 150 μg/L AsV, indicating the activation of a negative feedback mechanism triggered by decreased T4 levels. It is well known that the dio2 enzyme facilitates the conversion of T4 into biologically active T3 through outer-ring deiodination (ORD), while the dio3 enzyme catalyzes the inner-ring deiodination (IRD) of both T4 and T3, leading to the production of metabolites such as reverse T3 and 2,2-diiodo-L-thyronine (T2). Dio3 is a major inactivating pathway for THs, increasing during hyperthyroidism and decreasing during hypothyroidism [27,28]. Therefore, a decrease in dio3a mRNA transcription may also indicate a response to elevated TH contents. As the major isoforms of thyroid hormone receptor (TRs), trα and trβ can mediate TH-regulated gene transcription [16]. In the present study, the mRNA transcriptions of trα and trβ were up-regulated during AsV exposure. This finding aligns with previous studies [28], where THs increased along with the up-regulation of trα and trβ expression in decabromodiphenylether-treated zebrafish larvae. Hence, the increase in TR mRNA expressions may have been a response to enhanced T4 levels under the AsV treatment.

In the HPA axis, many enzymes and proteins play important roles in regulating cortisol production (Figure 3). Hydroxymethylglutaryl-CoA reductases (hmgrb) is mainly involved in the anabolism of cholesterol [29]. Steroidogenetic acute regulatory protein (star) is responsible for transporting cholesterol from the mitochondrial outer membrane to the mitochondrial inner membrane [30]. Cholesterol is then converted to pregnenolone under the catalysis of cyp11a [31]. At last, hsd3b and cyp11b catalyze the conversion of pregnenolone to cortisol [32]. It seemed that significantly increased mRNA transcriptions of crh, hmgrb, star, cyp11a, and cyp11b stimulated cortisol synthesis. Meanwhile, the mRNA transcription of pomc was significantly down-regulated, which may have been caused by the activation of the negative feedback mechanism of HPA axis. In addition, the cortisol receptors gr and mr are essential for the regulation of multiple physiological functions, such as glucose metabolism, mineral balance, and behavior [33]. It is hypothesized that the mRNA transcriptions of mr and gr were significantly up-regulated, which may have been caused by the activation of the positive feedback mechanism of the HPA axis.

For the HPG axis, the gene response at molecular levels serves as a functional biomarker for assessing hormonal changes (Figure 4). The HPG axis regulates reproductive functions and fertility through the production of hormones such as fsh, lh, T, and E2. Fsh and lh bind to their respective receptors (FSHR and LHR) to induce gametogenesis [34,35]. Cyp17 converts progesterone to androstenedione in the steroidogenic pathway, while 17βhsd catalyzes the reduction in androstenedione to testosterone [36]. Cyp19 is involved in the final step of converting testosterone to estradiol (E2) [37]. After exposure to AsV, there was a significant decrease in E2 and T contents along with down-regulation of fsh, lh, fshr, and lhr mRNA transcriptions. It is speculated that AsV inhibits the expression of fsh, lh, fshr, and lhr, leading to decreased E2 and T levels. Lee et al. observed an increase in E2 and T concentrations accompanied by the up-regulation of cyp17 and cyp19a genes after exposure to 4-hydroxyphenyl and 4-sioprooxyphenylsulfone [24]. This differs from our results. Similarly to the HPT axis feedback mechanism mentioned earlier, it is hypothesized that negative feedback mechanisms activate the expression of cyp17, cyp19a, and 17βhsd genes within the HPG axis.

After exposure for 120 hpf, the mRNA transcription of zebrafish larvae showed significant changes in different AsV treatments (Figure 5). We found that 103 genes showed differences between 0 and 150 µg/L, 651 genes displayed differences between 0 and 50 µg/L, 3 genes exhibited differences between 0 and 75 µg/L, 243 genes showed differences between 25 and 50 µg/L, 543 genes displayed differences between 50 and 75 µg/L, and 33 genes exhibited differences between 75 and 150 µg/L. These results indicate that 50 µg/L AsV showed obvious differences from other AsV treatments. Transcriptome sequencing was used to investigate the concentration of 50 μg/L AsV, due to the hormone content and gene expression levels being different from those in other concentration groups (Figure 6 and Figure 7). The results showed that the GO terms and KEGG pathway analysis of the two groups were related to the steroid hormone generation process, indicating that AsV had a more significant effect on steroid hormones in the early development stage of zebrafish, and the hormone content results confirmed this point. However, the correlation analysis results showed that the changes in the thyroid hormone content was significantly correlated with the changes in the HPA and HPT axis-related genes’ expression (Figure 8), indicating that the cross-talk effect occurred in the early development stage of zebrafish after exposure to AsV.

5. Conclusions

In summary, we identified an endocrine-disrupting effect of AsV in zebrafish larvae. The results from principal component analysis demonstrate that TRH, TSH, TRHRb, and TRβ primarily affect the level of T4 while Cyp11b, StAR, hmgrb MC2R, and GR mainly influence cortisol levels. On the other hand, Cyp19a, Cyp17, 17βhsd, ERβ, LHR, hmgrb, and AR predominantly impact E2 and T levels. Transcriptomics and enrichment analysis revealed that these pathways are primarily associated with steroid hormone synthesis and transport. Furthermore, it was found that AsV stimulates the cAMP signaling pathway through a compensation mechanism. Since AsV poses a contamination risk to aquatic organisms, it is crucial to gain a comprehensive understanding of the endocrine toxicity caused by AsV. Future studies should be conducted to investigate the bioaccumulation and biotransformation processes of AsV within fish, as this will aid in uncovering the mechanism behind its endocrine toxicity.