Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii)
Abstract
1. Introduction
2. Materials and Methods
2.1. Feed Preparation
2.2. Crayfish and Feeding Management
2.3. Sampling and Processing
2.4. Indicator Detection
2.4.1. Determination of Growth Performance
2.4.2. Measurement of Biochemical Indicators
2.4.3. Gene Expression Analysis
2.5. Data Processing and Analysis
3. Results
3.1. Effects of Melatonin on Growth Performance of Procambarus clarkii
3.2. Effects of Melatonin on Diurnal Variation in Non-Specific Immune Indices and AST and ALT Activities in Procambarus clarkii Hemolymph
3.3. Effects of Melatonin on Diurnal Antioxidant Capacity in Procambarus clarkii Hepatopancreas
3.4. Effects of Melatonin on Diurnal Digestive Enzyme Activities in Procambarus clarkii Hepatopancreas and Intestines
3.5. Effects of Melatonin on Expression of Circadian Clock-Related Genes in Procambarus clarkii
4. Discussion
4.1. Effects of Melatonin on Growth Performance of Procambarus clarkii
4.2. Effects of Melatonin on Diurnal Variation in Non-Specific Immune Indices and AST, ALT Activities in Procambarus clarkii Hemolymph
4.3. Effects of Melatonin on Diurnal Antioxidant Capacity in Procambarus clarkii Hepatopancreas
4.4. Effects of Melatonin on Diurnal Digestive Enzyme Activities in Procambarus clarkii Hepatopancreas and Intestines
4.5. Effects of Melatonin on the Expression of Circadian Clock-Related Genes in Procambarus clarkii
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Carrillo-Vico, A.; Lardone, P.J.; Álvarez-Sánchez, N.; Rodríguez-Rodríguez, A.; Guerrero, J.M. Melatonin: Buffering the immune system. Int. J. Mol. Sci. 2013, 14, 8638–8683. [Google Scholar] [CrossRef] [Scilit]
- Foster, R.G. Melatonin. Curr. Biol. 2021, 31, 1456–1458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miller, S.C.; Pandi, P.S.; Esquifino, A.I.; Cardinali, D.P.; Maestroni, G.J. The role of melatonin in immuno-enhancement: Potential application in cancer. Int. J. Exp. Pathol. 2006, 87, 81–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, C.; Yang, X.Z.; Xu, M.J.; Huang, G.Y.; Zhang, Q.; Cheng, Y.X.; He, L.; Ren, H.Y. Melatonin promotes cheliped regeneration, digestive enzyme function, and immunity following autotomy in the Chinese mitten crab, Eriocheir sinensis. Front. Physiol. 2018, 9, 269. [Google Scholar] [CrossRef] [Scilit]
- Gao, W.X.; Ma, H.; Yang, M.N.; Peng, S.Y.; Qu, J.C.; Qu, Y.L. Effects of rumen-protected melatonin supplementation on melatonin and its precursors and metabolites contents in milk, melatonin synthetase activity, and performance in Holstein cows. Chin. J. Anim. Nutr. 2022, 34, 4438–4451. [Google Scholar]
- Yang, X.; Song, X.; Zhang, C.; Pang, Y.; Song, Y.; Cheng, Y.; Nie, L.; Zong, X. Effects of dietary melatonin on hematological immunity, antioxidant defense and antibacterial ability in the Chinese mitten crab, Eriocheir sinensis. Aquaculture 2020, 529, 735578. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Xu, W.; Du, X.; Ye, Y.; Tian, J.; Li, Y.; Jiang, Q.; Zhao, Y. Effects of dietary melatonin on growth performance, antioxidant capacity, and nonspecific immunity in crayfish, Cherax destructor. Fish Shellfish Immunol. 2023, 138, 108846. [Google Scholar] [CrossRef] [Scilit]
- Yıldırım, M.; Aktaș, M. The effects of melatonin’s pacific white shrimp, Litopenaeus vannamei (Boone 1931) on moulting, growth and meat composition. Yunus Arast. Bul. 2016, 16, 193–200. [Google Scholar]
- Evans, R.M. Regulation of Circadian Behavior and Metabolism by Clock Genes. J. Non-Cryst. Solids 1981, 44, 171–180. [Google Scholar]
- Fuhr, L.; Abreu, M.; Pett, P.; Relógio, A. Circadian systems biology: When time matters. Comput. Struct. Biotechnol. J. 2015, 13, 417–426. [Google Scholar] [CrossRef] [Scilit]
- Lin, Y.; Han, M.; Shimada, B.; Wang, L.; Gibler, T.M.; Amarakone, A.; Awad, T.A.; Stormo, G.D.; Van Gelder, R.N.; Taghert, P.H. Influence of the period-dependent circadian clock on diurnal, circadian, and aperiodic gene expression in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 2002, 99, 9562–9567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minnetti, M.; Hasenmajer, V.; Pofi, R.; Venneri, M.A.; Alexandraki, K.I.; Isidori, A.M. Fixing the broken clock in adrenal disorders: Focus on glucocorticoids and chronotherapy. J. Endocrinol. 2020, 246, R13–R31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hill, S.M.; Belancio, V.P.; Dauchy, R.T.; Xiang, S.; Brimer, S.; Mao, L.; Hauch, A.; Lundberg, P.W.; Summers, W.; Yuan, L.; et al. Melatonin: An inhibitor of breast cancer. Endocr.—Relat. Cancer 2015, 22, R183–R204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshiuchi, I. Analysis of evolution and ethnic diversity at glucose-associated SNPs of circadian clock-related loci with cryptochrome 1, cryptochrome 2, and melatonin receptor 1B. Biochem. Genet. 2021, 59, 1173–1184. [Google Scholar] [CrossRef] [Scilit]
- Coelho, L.D.; Peres, R.; Amaral, F.G.; Reiter, R.J.; Cipolla-Neto, J. Daily differential expression of melatonin-related genes and clock genes in rat cumulus–oocyte complex: Changes after pinealectomy. J. Pineal Res. 2015, 58, 490–499. [Google Scholar] [CrossRef] [Scilit]
- Tenorio, F.; Simoes, M.J.; Teixeira, V.W. Effects of melatonin and prolactin in reproduction: Review of literature. Rev. Assoc. Med. Bras. 2015, 61, 269–274. [Google Scholar] [CrossRef] [Scilit]
- Kandalepas, P.C.; Mitchell, J.W.; Gillette, M.U. Melatonin signal transduction pathways require E-box-mediated transcription of Per1 and Per2 to reset the SCN clock at dusk. PLoS ONE 2016, 11, e0157824. [Google Scholar] [CrossRef] [Scilit]
- Delgado-Lara, D.L.; González-Enríquez, G.V.; Torres-Mendoza, B.M.; González-Usigli, H.; Cárdenas-Bedoya, J.; Macías-Islas, M.A.; de la Rosa, A.C.; Jiménez-Delgado, A.; Pacheco-Moisés, F.; Cruz-Serrano, J.A. Effect of melatonin administration on the PER1 and BMAL1 clock genes in patients with Parkinson’s disease. Biomed. Pharmacother. 2020, 129, 110485. [Google Scholar] [CrossRef] [Scilit]
- Guo, K.; Ruan, G.; Fan, W.; Fang, L.; Wang, Q.; Luo, M.; Yi, T. The effect of nitrite and sulfide on the antioxidant capacity and microbial composition of the intestines of red swamp crayfish. Fish Shellfish Immunol. 2020, 96, 290–296. [Google Scholar] [CrossRef] [Scilit]
- Huang, P.D. Discovery and Epidemiological Investigation of New Viral Pathogens Causing “May Decay” in Procambarus Clarkii. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2019. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−∆∆CT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Tang, C.X. Effects of Active Immunization Against Melatonin on the Growth Performance and Carcass Quality of Growing Pigs. Master’s Thesis, Sichuan Agricultural University, Ya’an, China, 2005. [Google Scholar]
- Yan, J.M. Study on Effects of Melatonin on Growth Performance, Immune Function, and Antioxidant Capacity of Weaning Piglets. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2019. [Google Scholar]
- Osei, P.; Robbins, K.R.; Shirley, H.V. Effects of exogenous melatonin on growth and energy metabolism of chickens. Nutr. Res. 1989, 9, 69–81. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.F.; Liao, Q.H. Effects of melatonin on growth performance and immune function in broilers. Feed Ind. 2008, 13, 37–39. [Google Scholar]
- De Vlaming, V. Effects of pinealectomy and melatonin treatment on growth in the goldfish, Carassius auratus. Gen. Comp. Endocrinol. 1980, 40, 245–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alvariño, J.M.; Rebollar, P.G.; Olmedo, M.; Álvarez-Blázquez, B.; Ubilla, E.; Peleteiro, J.B. Effects of melatonin implants on reproduction and growth of turbot broodstock. Aquac. Int. 2001, 9, 477–487. [Google Scholar] [CrossRef] [Scilit]
- Ye, Y.; Li, S.; Zhu, B.; Yang, Y.; Du, X.; Li, Y.; Zhao, Y. Effects of dietary melatonin on growth performance, nutrient composition, and lipid metabolism of Pacific white shrimp (Penaeus vannamei). Aquaculture 2024, 578, 740095. [Google Scholar] [CrossRef] [Scilit]
- Lv, W.; Li, M.; Mao, Y.; Huang, W.; Yuan, Q.; Li, M.; Zhou, Q.; Yang, H.; Zhou, W. Effects of dietary melatonin supplementation on growth performance and intestinal health of rice field eel (Monopterus albus). Comp. Biochem. Physiol. D Genom. Proteom. 2024, 52, 101273. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Li, B.; Ma, J.; Wang, S.; Huang, B.; Sun, Y.; Zhang, L. Optimum dietary protein to lipid ratio for starry flounder (Platichthys stellatus). Aquac. Res. 2017, 48, 189–201. [Google Scholar] [CrossRef] [Scilit]
- Liu, F.; Qu, Y.K.; Geng, C.; Wang, A.M.; Zhang, J.H.; Chen, K.J.; Liu, B.; Tian, H.Y.; Yang, W.P.; Yu, Y.B. Effects of hesperidin on the growth performance, antioxidant capacity, immune responses and disease resistance of red swamp crayfish (Procambarus clarkii). Fish Shellfish Immunol. 2020, 99, 154–166. [Google Scholar] [CrossRef] [Scilit]
- Ashouri, G.; Soofiani, N.M.; Hoseinifar, S.H.; Jalali, S.A.; Morshedi, V.; Valinassab, T.; Bagheri, D.; Van Doan, H.; Mozanzadeh, M.T.; Carnevali, O. Influence of dietary sodium alginate and Pediococcus acidilactici on liver antioxidant status, intestinal lysozyme gene expression, histomorphology, microbiota, and digestive enzymes activity in Asian sea bass (Lates calcarifer) juveniles. Aquaculture 2020, 518, 734638. [Google Scholar] [CrossRef] [Scilit]
- Perez, L. Fish innate immune response to viral infection—An overview of five major antiviral genes. Viruses 2022, 14, 1546. [Google Scholar] [CrossRef] [Scilit]
- Zhu, L.; Wang, X.; Hou, L.; Jiang, X.; Li, C.; Zhang, J.; Pei, C.; Zhao, X.; Li, L.; Kong, X. The related immunity responses of red swamp crayfish (Procambarus clarkii) following infection with Aeromonas veronii. Aquac. Rep. 2021, 21, 100849. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.X.; Xu, H.Z.; Liu, C.J.; Wang, G.L.; Ai, Y.; Jiang, W.S.; Luo, Q.H.; Li, H.; Luo, L.; Xiang, X. Effects of Vitamin C on the Structure and Function of the Digestive System of Andrias davidianus. J. Fish. Sci. China 2023, 47, 161–172. [Google Scholar]
- Luo, J.; Fu, W.J.; Yang, E.J.; Huang, J.S.; Xie, R.T.; Chen, G. Effects of Quercetin on Growth Performance, Antioxidant Capacity, and Gut Microbiota of Hybrid Grouper. J. Guangdong Ocean Univ. 2022, 42, 13–22. [Google Scholar]
- Li, Y.; Yang, Y.; Li, S.; Ye, Y.; Du, X.; Liu, X.; Jiang, Q.; Che, X. Effects of dietary melatonin on antioxidant and immune function of the Pacific white shrimp (Litopenaeus vannamei), as determined by transcriptomic analysis. Comp. Biochem. Physiol. D: Genom. Proteom. 2023, 48, 101146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, Y.; Zhu, B.; Xu, W.; Tian, J.; Du, X.; Ye, Y.; Huang, Y.; Jiang, Q.; Li, Y.; Zhao, Y. Dietary melatonin positively impacts the immune system of crayfish, Cherax destructor, as revealed by comparative proteomics analysis. Fish Shellfish Immunol. 2023, 142, 109122. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Huang, Y.; Zhang, M.; Chen, Q.; Fan, W.; Zhao, Y. Effect of dietary vitamin E on growth, immunity and regulation of hepatopancreas nutrition in male oriental river prawn, Macrobrachium nipponense. Aquac. Res. 2019, 50, 1741–1751. [Google Scholar] [CrossRef] [Scilit]
- Reiter, R.J.; Tan, D.X.; Galano, A. Melatonin: Exceeding expectations. Physiology 2014, 29, 325–333. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Song, X.; Zhao, P.; Li, T.; Xu, J.W.; Yu, X. Role of melatonin in regulation of lipid accumulation, autophagy and salinity-induced oxidative stress in microalga Monoraphidium sp. QLY-1. Algal Res. 2021, 54, 102196. [Google Scholar] [CrossRef] [Scilit]
- Winiarska, K.; Fraczyk, T.; Malinska, D.; Drozak, J.; Bryla, J. Melatonin attenuates diabetes-induced oxidative stress in rabbits. J. Pineal Res. 2006, 40, 168–176. [Google Scholar] [CrossRef] [Scilit]
- Marí, M.; Morales, A.; Colell, A.; García-Ruiz, C.; Fernández-Checa, J.C. Mitochondrial glutathione, a key survival antioxidant. Antioxid. Redox Signal. 2009, 11, 2685–2700. [Google Scholar] [CrossRef] [Scilit]
- Pal, P.K.; Maitra, S.K. Response of gastrointestinal melatonin, antioxidants, and digestive enzymes to altered feeding conditions in carp (Catla catla). Fish Physiol. Biochem. 2018, 44, 1061–1073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Shi, X.; Wu, M.; Pang, Y.; Song, X.; Shi, A.; Niu, C.; Cheng, Y. Effects of melatonin feed on histology and antioxidant ability of the gills and oxygen consumption of Chinese mitten crab (Eriocheir sinensis), exposed to acute hypoxia stress. Aquaculture 2021, 544, 737015. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.; Wu, M.; Pang, Y.; Song, X.; Shi, A.; Shi, X.; Niu, C.; Cheng, Y.; Yang, X. Effects of melatonin feed on the changes of hemolymph immune parameters, antioxidant capacity, and mitochondrial functions in Chinese mitten crab (Eriocheir sinensis) caused by acute hypoxia. Aquaculture 2021, 535, 736374. [Google Scholar] [CrossRef] [Scilit]
- Coccia, E.; Varricchio, E.; Paolucci, M. Digestive enzymes in the crayfish Cherax albidus: Polymorphism and partial characterization. Int. J. Zool. 2011, 2011, 31037. [Google Scholar] [CrossRef] [Scilit]
- Yang, X.; Shi, A.; Song, Y.; Niu, C.; Yu, X.; Shi, X.; Pang, Y.; Ma, X.; Cheng, Y. The effects of ammonia-N stress on immune parameters, antioxidant capacity, digestive function, and intestinal microflora of Chinese mitten crab, Eriocheir sinensis, and the protective effect of dietary supplement of melatonin. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 250, 109127. [Google Scholar] [CrossRef] [Scilit]
- Song, Y.; Song, X.; Wu, M.; Pang, Y.; Shi, A.; Shi, X.; Niu, C.; Cheng, Y.; Yang, X. The protective effects of melatonin on survival, immune response, digestive enzymes activities and intestinal microbiota diversity in Chinese mitten crab (Eriocheir sinensis) exposed to glyphosate. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2020, 238, 108845. [Google Scholar] [CrossRef] [Scilit]
- Mardones, O.; Devia, E.; Labbé, B.S.; Oyarzún, R.; Vargas-Chacoff, L.; Muñoz, J.L. Effect of L-tryptophan and melatonin supplementation on the serotonin gastrointestinal content and digestive enzymatic activity for Salmo salar and Oncorhynchus kisutch. Aquaculture 2018, 482, 203–210. [Google Scholar] [CrossRef] [Scilit]
- Takekida, S.; Yan, L.; Maywood, E.S.; Hastings, M.H.; Okamura, H. Differential adrenergic regulation of the circadian expression of the clock genes Period1 and Period2 in the rat pineal gland. Eur. J. Neurosci. 2000, 12, 4557–4561. [Google Scholar] [CrossRef] [Scilit]










| Ingredients | Dietary Melatonin Levels/(mg/kg) | ||||
|---|---|---|---|---|---|
| 0 | 25 | 50 | 75 | 100 | |
| Fish meal | 12.00 | 12.00 | 12.00 | 12.00 | 12.00 |
| Soybean meal | 21.00 | 21.00 | 21.00 | 21.00 | 21.00 |
| Fermented rapeseed meal | 16.00 | 16.00 | 16.00 | 16.00 | 16.00 |
| Fermented cottonseed meal | 14.00 | 14.00 | 14.00 | 14.00 | 14.00 |
| Corn starch | 10.00 | 10.00 | 10.00 | 10.00 | 10.00 |
| Flour | 19.55 | 19.55 | 19.55 | 19.55 | 19.55 |
| Fish oil | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| Soybean oil | 2.50 | 2.50 | 2.50 | 2.50 | 2.50 |
| Ca(H2PO4)2 | 2.00 | 2.00 | 2.00 | 2.00 | 2.00 |
| Zeolite powder | 0.50 | 0.4975 | 0.495 | 0.4925 | 0.49 |
| Choline chloride | 0.40 | 0.40 | 0.40 | 0.40 | 0.40 |
| Vitamin premix 1 | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 |
| Mineral premix 1 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 |
| Cholesterin | 0.50 | 0.50 | 0.50 | 0.50 | 0.50 |
| Butylated Hydroxytoluene | 0.05 | 0.05 | 0.05 | 0.05 | 0.05 |
| Melatonin | 0.00 | 0.0025 | 0.005 | 0.0075 | 0.01 |
| Total: | 100 | 100 | 100 | 100 | 100 |
| Nutrient levels (%) 2 | |||||
| Moisture | 5.52 | 5.69 | 5.68 | 5.42 | 5.68 |
| Crude protein | 33.81 | 33.79 | 33.83 | 33.84 | 33.86 |
| Ether extract | 5.82 | 5.56 | 6.07 | 5.79 | 6.09 |
| Ash | 8.06 | 8.06 | 8.05 | 8.05 | 8.06 |
| Genes | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
|---|---|---|
| Clock | F: GGCGGATCAAGTAGTAAACGAG | R: AGCATCAGAACACGGAGAAGG |
| Bmal1 | F: TCCGAATGGCAGTTCAGCA | R: CAACCCAOGACAAACAAGAAAC |
| Cry1 | F: AATGCTGGGTCCTGGATGTG | R: TTCTGGCTCTGCTTGATGTGAT |
| Per1 | F: AATGGGAATAATACTGCCGAGAA | R: GAGCCTTGATOCTGATTGGTG |
| Tim1 | F: AGGAACCCAAGCAATCTCAATG | R: CCAACAACTGCGTCTGTAACCA |
| Tim2 | F: ATCTGTCCACGATCAGGTGTTG | R: CCGCATTTCCAGGAGTTCTTT |
| β-action | F: ATTCTCACCGAGCGTGGCT | R: AGGCGGCAGTGGTCATTTC |
| Items | Dietary Melatonin Levels (mg/kg) | ||||
|---|---|---|---|---|---|
| 0 | 25 | 50 | 75 | 100 | |
| IBW 1 (g) | 6.90 ± 0.16 | 6.77 ± 0.39 | 6.39 ± 0.29 | 6.55 ± 0.10 | 6.80 ± 0.37 |
| FBW 1 (g) | 19.36 ± 0.34 bc | 19.99 ± 0.49 ab | 20.49 ± 0.44 a | 19.50 ± 0.24 bc | 19.14 ± 0.31 c |
| WGR 1 (%) | 180.57 ± 5.11 b | 196.13 ± 21.25 ab | 220.97 ± 8.09 a | 197.65 ± 2.17 ab | 182.09 ± 17.68 b |
| SGR 1 (%) | 1.71 ± 0.01 b | 1.84 ± 0.07 ab | 1.96 ± 0.08 a | 1.82 ± 0.01 b | 1.74 ± 0.09 b |
| FCR 1 | 0.88 ± 0.05 ab | 0.83 ± 0.14 ab | 0.73 ± 0.01 b | 0.80 ± 0.01 ab | 0.91 ± 0.09 a |
| SR 1 (%) | 79.17 ± 5.32 ab | 84.72 ± 2.78 ab | 87.50 ± 5.32 a | 79.17 ± 2.78 ab | 77.78 ± 4.54 b |
| HIS 2 (%) | 8.01 ± 1.23 | 7.23 ± 1.11 | 7.50 ± 0.92 | 7.56 ± 0.73 | 7.89 ± 1.57 |
| MR 2 (%) | 13.79 ± 2.39 | 12.98 ± 2.39 | 13.77 ± 2.13 | 13.53 ± 2.36 | 13.61 ± 2.40 |
| CF 2 | 2.76 ± 0.28 | 3.01 ± 0.40 | 2.81 ± 0.33 | 2.95 ± 0.31 | 2.77 ± 0.30 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, J.; Du, Y.; Zhang, M.; Wang, J.; Ming, J.; Shao, X.; Wang, A.; Tian, H.; Zhang, W.; Xia, S.; et al. Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii). Fishes 2025, 10, 114. https://doi.org/10.3390/fishes10030114
Chen J, Du Y, Zhang M, Wang J, Ming J, Shao X, Wang A, Tian H, Zhang W, Xia S, et al. Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii). Fishes. 2025; 10(3):114. https://doi.org/10.3390/fishes10030114
Chicago/Turabian StyleChen, Jinglong, Youhai Du, Mengyue Zhang, Jiahui Wang, Jianhua Ming, Xianping Shao, Aimin Wang, Hongyan Tian, Wuxiao Zhang, Silei Xia, and et al. 2025. "Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii)" Fishes 10, no. 3: 114. https://doi.org/10.3390/fishes10030114
APA StyleChen, J., Du, Y., Zhang, M., Wang, J., Ming, J., Shao, X., Wang, A., Tian, H., Zhang, W., Xia, S., Cheng, W., Xu, J., Zheng, X., & Liu, B. (2025). Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii). Fishes, 10(3), 114. https://doi.org/10.3390/fishes10030114

