Next Article in Journal
Red Mullet (Mullus barbatus) Collected from North and South Euboean Gulf, Greece: Fishing Location Effect on Nutritive Quality
Next Article in Special Issue
Research Progress and Application Prospects of Dietary Supplements in Growth and Immune Regulation of Aquatic Animals
Previous Article in Journal
Identification of Different Ecomorphotypes of Coilia nasus in the Dawanzhou Section of the Yangtze River
Previous Article in Special Issue
Thyroid-Active Agents Triiodothyronine, Thyroxine and Propylthiouracil Differentially Affect Growth, Intestinal Short Chain Fatty Acids and Microbiota in Little Yellow Croaker Larimichthys polyactis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii)

1
Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, College of Life Sciences, Huzhou University, Huzhou 313000, China
2
College of Marine and Biology Engineering, Yancheng Institute of Technology, Yancheng 224051, China
3
Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
*
Authors to whom correspondence should be addressed.
Fishes 2025, 10(3), 114; https://doi.org/10.3390/fishes10030114
Submission received: 28 January 2025 / Revised: 24 February 2025 / Accepted: 3 March 2025 / Published: 5 March 2025

Abstract

This study aimed to investigate the effects of dietary melatonin supplementation on growth and diurnal non-specific immunity, antioxidant capacity, digestive enzyme activities, and circadian clock-related gene expression in crayfish (Procambarus clarkii). A total of 500 healthy juvenile crayfish (6.68 ± 0.31 g) were randomly distributed into five groups with four replicates each and fed five different diets supplemented with melatonin at 0, 25, 50, 75, and 100 mg/kg for 60 days. The results indicated that dietary supplementation of 50 mg/kg melatonin significantly increased the weight gain rate (WGR), specific growth rate (SGR), and survival rate (SR) of juvenile Procambarus clarkii. However, no significant differences were observed in the hepatosomatic index (HSI), meat yield, and condition factor (p > 0.05). When the dietary melatonin level was 50 mg/kg, the activities of LZM and ALP in the hemolymph of Procambarus clarkii were higher than the levels at both 15:00 and 03:00, while the activities of AST and ALT remained at lower levels during these two time points. It also significantly upregulated the mRNA expression levels of Clock, Per1, Cry1, Tim1, and Tim2 in the hepatopancreas (p < 0.05). Furthermore, dietary melatonin at 50 mg/kg significantly reduced the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), as well as the malondialdehyde (MDA) content across day and night (p < 0.05). No significant differences were found in acid phosphatase (ACP) at 15:00, alkaline phosphatase (ALP), and amylase (AMS) activities in the hepatopancreas and intestine at 3:00 among the groups (p > 0.05). At 15:00, supplementation with 50 mg/kg significantly upregulated Bmal1 mRNA expression (p < 0.05). Melatonin supplementation at 50–75 mg/kg resulted in significantly higher levels of TP, LZM, ALP, and CAT activities, as well as significantly higher mRNA expression of Clock, Bmal1, Cry1, Per1, Tim1, and Tim2 in the hepatopancreas at 3:00 compared to 15:00 (p < 0.05), with the opposite trend observed for MDA content (p < 0.05). No significant differences were found in ACP, ALT, and AST activities between 3:00 and 15:00 among the groups (p > 0.05). Thus, dietary supplementation of 50 mg/kg melatonin could promote the growth of juvenile Procambarus clarkii, enhance their non-specific immunity and antioxidant capacity during both day and night, increase the activities of digestive enzymes in the hepatopancreas and intestine, and regulate the expression of circadian clock-related genes.
Key Contribution: This study aimed to investigate the effects of dietary melatonin supplementation on the growth of P. clarkii, as well as on diurnal and nocturnal non-specific immunity, antioxidant capacity, digestive enzyme activities, and circadian clock-related gene expression. The findings intended to provide a reference for the application of melatonin in P. clarkii feed and the establishment of precise feeding strategies.

1. Introduction

Melatonin is widely present in various organisms. In vertebrates, melatonin is mainly secreted by the pineal gland, while in invertebrates, it is mainly secreted by the eyestalk ganglion [1]. As a neurotransmitter, melatonin regulates various physiological functions such as antioxidation, immunity, and anti-stress in crustaceans [2,3,4]. Currently, several studies have investigated the incorporation of melatonin into the feed of aquaculture animals. The addition of an appropriate amount of melatonin to the feed can promote growth and improve non-specific immunity, antioxidant capacity, and intestinal trypsin activity in juvenile black carp (Mylopharyngodon piceus) [5]. Yang et al. [6] investigated the effects of melatonin on blood immunity, antioxidant defense, and disease resistance in the Chinese mitten crab (Eriocheir sinensis). The study found that incorporating melatonin into the diet significantly enhanced the antioxidant capacity, immune response, and antibacterial properties of the Chinese mitten crab, while also increasing melatonin concentration in eyestalks. Yang et al. [7] added melatonin to the diet of crayfish (Cherax destructor), which improved growth performance, enhanced the antioxidant capacity of the hepatopancreas, and elevated the immune indices of the hemolymph. The optimal dosage is between 75 and 81 mg/kg. Similar findings have been observed in Pacific white shrimp (Litopenaeus vannamei) [8]. The above results indicated that adding a proper amount of melatonin in feed had effects on the growth, immunity, and antioxidant capacity of aquatic animals. However, the effects of melatonin on the changes of non-specific immunity, antioxidant capacity, and digestive enzyme activity in aquatic animals during the day and night have not been reported.
The biological clock is an endogenous timekeeping system in living organisms [9]. It is widely distributed and found in almost all living organisms, interacting through a complex regulatory network to control downstream genes [10]. Circadian clock genes have been reported to include circadian locomotor output cycle kaput (Clock), brain and muscle ARNT-like 1 (Bmal1), timeless (Tim), period circadian protein 1/2/3 (Per1/2/3), pigment dispersion factor (Pdf), cryptochrome 1/2 (Cry1/2), etc. [11]. The circadian rhythm of the biological clock relies on positive feedback loops involving proteins such as CLOK/BMAL1, negative feedback loops involving proteins such as CRY, and regulation by clock genes such as Per and Tim. Melatonin can influence the expression of genes associated with the biological clock [12,13,14]. Previous studies have demonstrated that melatonin affected the expression of genes such as Clock, Bmal1, Cry1, and Per1 in mice (Mus musculus) [15,16,17]; melatonin also enhanced the expression of Bmal1 mRNA in humans [18]. Currently, there are few studies on the effects of melatonin on the expression of circadian clock-related genes in aquatic animals.
P. clarkii is favored by aquaculture farmers and consumers due to its strong environmental adaptability, fast growth, delicious meat, and rich nutrition [19,20]. Before the experiment, the feeding rhythm of P. clarkii was examined, revealing diurnal variations. This suggests that physiological functions, such as nutrient absorption and digestive enzyme activity, might also exhibit diurnal fluctuations influenced by circadian rhythms. Therefore, understanding how melatonin impacts these diurnal physiological changes is essential. However, the effects of dietary melatonin on the diurnal physiological state changes in P. clarkii and the expression of circadian clock genes is still lacking. This study investigated the effects of dietary melatonin supplementation on the growth and diurnal variation of non-specific immunity, antioxidant capacity, digestive enzyme activity, and circadian clock-related gene expression in P. clarkii. These findings not only address the research gap concerning the varying effects of melatonin on P. clarkii during day and night but also offer a scientific foundation for the development of melatonin-based feed and the establishment of precise feeding strategies and models.

2. Materials and Methods

2.1. Feed Preparation

The composition and nutrient levels of the experimental diets are presented in Table 1. Melatonin (purity ≥ 99%) was obtained from Sigma-Aldrich Co., Ltd. (Sigma, St. Louis, MO, USA). The basic feed was formulated using imported fish meal, soybean meal, fermented cottonseed meal, and fermented rapeseed meal as protein sources, along with fish oil and soybean oil as fat sources, flour as a carbohydrate source, and vitamin and mineral premixes. The basal diet was supplemented with melatonin at concentrations of 0 (control group), 25, 50, 75, and 100 mg/kg, respectively. For the preparation of the experimental diets, all dry ingredients were ground through a 60-mesh sieve. The ingredients for each diet were first homogenized, after which oil and distilled water were added to the mixture and thoroughly mixed. This mixture was then pelleted into granules with a diameter of 2 mm using a small feed pelleting machine and dried for approximately 12 h in a ventilated oven at 45 °C. All dry diets were stored at −20 °C until use.

2.2. Crayfish and Feeding Management

Juvenile red swamp crayfish were obtained from a local aquaculture farm in Huzhou (Huzhou, China). After a week of indoor acclimatization, 500 healthy juvenile P. clarkii, with an initial body weight of 6.68 ± 0.31 g, were randomly distributed into 20 tanks, 4 tanks per group, 25 crayfish per tank (300 L, height 78 cm). The tanks were randomly assigned to five experimental groups, each consisting of four replicates. Artificial shelters were provided as hiding places, and regular cleaning and water exchanges were performed. Crayfish were fed to apparent satiation once daily at 18:00. Continuous aeration was maintained using air stones to ensure adequate dissolved oxygen levels. The rearing trial lasted for 60 days. During the experimental period, the feeding trial was conducted under a natural light and dark cycle (12L:12D). The water depth was kept at 20–30 cm, the water temperature ranged from 26 °C to 28 °C, and the water quality parameters were as follows: pH 7.2–7.6, dissolved oxygen (DO) > 6.5 mg/L, and ammonia nitrogen (NH3-N) < 0.01 mg/L.

2.3. Sampling and Processing

After 60 days of formal feeding, the crayfish were fasted for 24 h and sampled at 15:00 and 3:00, respectively. The crayfish were quickly placed into an ice–water mixture to induce rapid loss of consciousness. Each tank’s crayfish were weighed and counted, and three crayfish with similar body weights were randomly selected from each tank. Following this, the crayfish were weighed and measured for body length. Hemolymph was extracted from the posterior margin of the carapace using a disposable medical syringe and mixed with an anticoagulant. The hemolymph samples were then allowed to stand overnight in a refrigerator at 4 °C. Subsequently, the samples were centrifuged at 3000 rpm for 10 min at 4 °C to prepare a serum, which was frozen at −80 °C for later use. After hemolymph collection, the viscera and hepatopancreas were removed and weighed. Appropriate amounts of liver and intestine were taken for routine and molecular biological analysis. After being quickly frozen in liquid nitrogen, these samples were stored at −80 °C.

2.4. Indicator Detection

2.4.1. Determination of Growth Performance

Weight gain rate (WGR), specific growth rate (SGR), feed coefficient (FC), survival rate (SR), hepatosomatic index (HSI), meat ratio (MR), and condition factor (CF) were calculated according to the following formula:
Weight gain rate (WGR, %) = 100× (Wt − W0)/W0
Specific growth rate (SGR, %/d) = 100 × (ln Wt − ln W0)/t
Feed coefficient (FC) = FI/(Wt − W0)
Survival rate (SR, %) = 100 × Nt/N0
Hepatosomatic index (HSI) = Wh/(Wt − W0)
Meat ratio (MR, %) = Wj/Wt × 100%
Condition factor (CF) (g/cm3) = Wt/L3 × 100
In the formula, W0 (g) is the initial average weight of a crayfish; Wt (g) is the final average weight of a crayfish carcass; t (d) is the number of feeding days; FI (g) is the average total feed intake per crayfish (air-dried crayfish weight); N0 is the initial number of crayfish; number of Nt is the final number of crayfish; Wh (g) is the weight of hepatopancreas per crayfish; Wj (g) is the muscle weight of each crayfish; L (cm) is the body length of each crayfish.

2.4.2. Measurement of Biochemical Indicators

At 3:00 and 15:00, measurements were taken for the following parameters in Procambarus clarkii: total protein (TP) level, lysozyme (LZM), acid phosphatase (ACP), alkaline phosphatase (ALP), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) activities in the hemolymph; catalase (CAT), glutathione peroxidase (GPx), glutathione reductase (GR) activities, and malondialdehyde (MDA) levels were measured in the hepatopancreas; trypsin, amylase, and lipase activities were assessed in the hepatopancreas and intestine. The above indicators were measured in accordance with the instructions of the kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

2.4.3. Gene Expression Analysis

The total RNA was extracted from the hepatopancreas of P. clarkii using the EASY spin Plus Total RNA Extraction Kit (Aidlab, Beijing, China). The purity and concentration were measured using a microvolume spectrophotometer (NanoDrop 2000, Thermo, Waltham, MA, USA) with an OD260/OD280 ratio between 2.1 to 2.2. Subsequently, the total RNA was reverse transcribed to cDNA using the PrimeScript™ RT Reagent Kit (Takara Bio Inc., Kusatsu, Shiga, Japan) and stored at −20 °C. Based on the nucleotide sequences of the Clock, Bmal1, Cry1, Per1, Tim1, and Tim2 genes in the P. clarkii genome database JAIWQB000000000.1, specific primers for the aforementioned genes and the housekeeping gene β-actin were designed using Primer 5.0 (Table 2). The primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China).
Real-time quantitative PCR was performed using the TB Green® Premix Ex Taq™ II (Takara Bio Inc., Kusatsu, Shiga, Japan) kit on a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The PCR reaction system consisted of a total volume of 20 μL, including 10 μL of 2 × TB Green Premix Ex Tag II, 10 μmol/L forward and reverse primers of 0.8 μL each, 1 μL of cDNA template, and 7.4 μL of ddH2O. The amplification conditions were as follows: pre-denaturation at 95 °C for 30 s; denaturation at 95 °C for 5 s; annealing at the optimal temperature for each gene for 30 s for a total of 40 cycles. Under conditions where the amplification efficiencies of each gene and β-actin were approximately equal, the mRNA expression levels of the related genes were compared and analyzed using the 2−ΔΔCt method [21], with the mRNA expression level of the control group as the baseline.

2.5. Data Processing and Analysis

Experimental data were statistically analyzed using SPSS 25. Data from different melatonin supplementation groups at two sampling time points were analyzed using one-way ANOVA and Tukey’s multiple comparison test, while t-tests were performed for the same melatonin supplementation group at two time points. Results are expressed as means ± standard deviation (Means ± SD), with p < 0.05 indicating significant differences.

3. Results

3.1. Effects of Melatonin on Growth Performance of Procambarus clarkii

As shown in Table 3, with the increase of melatonin supplementation in the feed, the weight gain rate, specific growth rate, and survival rate of juvenile P. clarkii exhibited a trend of initially rising and then declining, while the feed conversion ratio showed a trend of initially decreasing and then increasing. When the melatonin supplementation level was 50 mg/kg, the weight gain rate, specific growth rate, and survival rate reached relatively high levels, while the feed conversion ratio decreased to a relatively low level (p < 0.05). There were no significant differences in the hepatosomatic index, meat yield, and condition factor among the different experimental groups of P. clarkii (p > 0.05).

3.2. Effects of Melatonin on Diurnal Variation in Non-Specific Immune Indices and AST and ALT Activities in Procambarus clarkii Hemolymph

As shown in Figure 1A, the total protein (TP) content in the hemolymph of P. clarkii increased following the addition of melatonin to the diet. Specifically, TP levels measured at 3:00 and 15:00 were significantly higher than those in the control group (p < 0.05). However, no significant differences in TP levels were observed among other dietary groups (p > 0.05). Furthermore, when the dietary melatonin concentration ranged from 50 to 100 mg/kg, the TP levels at 3:00 were significantly higher than those measured at 15:00 (p < 0.05).
Figure 1B indicated that lysozyme (LZM) activity in the hemolymph increased initially and then decreased with increasing dietary melatonin levels at 3:00 and 15:00. When the melatonin level was 50 mg/kg, LZM activity was significantly higher than in other groups (p < 0.05). At dietary melatonin levels of 50–100 mg/kg, LZM activity at 3:00 was significantly higher than at 15:00 (p < 0.05).
As shown in Figure 1C, the acid phosphatase (ACP) activity in the hemolymph at 3:00 initially increased and then decreased with rising dietary melatonin levels. At levels of 25–50 mg/kg, ACP activity was higher but showed no significant difference compared to the control group (p > 0.05). No significant differences in ACP activity were observed among the groups at 15:00 (p > 0.05), nor between 3:00 and 15:00 within any group (p > 0.05).
Figure 1D shown that with increasing dietary melatonin levels, no significant differences in alkaline phosphatase (ALP) activity were observed among the groups at 3:00 (p > 0.05). However, at 15:00, ALP activity exhibited an increasing trend, with levels significantly higher than the control group when melatonin was added at 100 mg/kg (p < 0.05), though no significant differences were noted among the other groups (p > 0.05). ALP levels at 3:00 were significantly higher than at 15:00 across all groups (p < 0.05).
Figure 1E,F illustrated that the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the hemolymph showed a decreasing and then increasing trend with the addition of dietary melatonin. When melatonin was at 50 mg/kg, both ALT and AST activities were at relatively low levels (p < 0.05). No significant differences were observed in ALT and AST activities between 3:00 and 15:00 within any group (p > 0.05).

3.3. Effects of Melatonin on Diurnal Antioxidant Capacity in Procambarus clarkii Hepatopancreas

As shown in Figure 2A, increasing melatonin supplementation in the feed, catalase (CAT) activity within the hepatopancreas of P. clarkii, showing an initial increase followed by a subsequent decrease at both 3:00 and 15:00. Notably, at a melatonin supplementation level of 50 mg/kg, CAT activities were significantly elevated compared to the other groups (p < 0.05). Furthermore, at melatonin supplementation levels ranging from 50 to 100 mg/kg, CAT activity at 3:00 was significantly greater than that observed at 15:00 (p < 0.05).
Figure 2B,C indicated that with increasing melatonin supplementation, the activities of glutathione peroxidase (GPx) and glutathione reductase (GR) in the hepatopancreas of P. clarkii at 3:00 and 15:00 exhibit an initial increase followed by a decrease. At a melatonin level of 50 mg/kg, both GPx and GR activities reached relatively high levels (p < 0.05). At melatonin supplementation levels of 0–25 mg/kg, GPx and GR activities at 3:00 were significantly higher than those at 15:00 (p < 0.05).
As illustrated in Figure 2D, increasing levels of melatonin supplementation resulted in a decrease in malondialdehyde (MDA) content within the hepatopancreas of P. clarkii at both 3:00 and 15:00, followed by an increase. At a melatonin supplementation level of 50 mg/kg, MDA content reached a relatively low level (p < 0.05). Furthermore, at melatonin supplementation levels ranging from 25 to 100 mg/kg, MDA content at 3:00 was significantly lower than that at 15:00 (p < 0.05).

3.4. Effects of Melatonin on Diurnal Digestive Enzyme Activities in Procambarus clarkii Hepatopancreas and Intestines

As shown in Figure 3A,B, increasing the level of melatonin supplementation in the feed initially enhances the activities of trypsin (TPS) and lipase (LPS) in the hepatopancreas of P. clarkii, followed by a subsequent decline. When the melatonin supplementation level ranged from 50 to 100 mg/kg, TPS and LPS activities reached significantly elevated levels (p < 0.05). At melatonin supplementation levels of 0 to 25 mg/kg, TPS activity at 3:00 was significantly higher than at 15:00 (p < 0.05). For LPS, at melatonin levels of 0 to 50 mg/kg, activity at 3:00 was also significantly higher than at 15:00 (p < 0.05).
Figure 3C demonstrated that with increasing melatonin supplementation, there were no significant differences in amylase (AMS) activity among the groups at 3:00 (p > 0.05). At 15:00, AMS activity in the hepatopancreas of P. clarkii initially increases and then decreases, reaching a relatively high level at a melatonin supplementation of 50 mg/kg (p < 0.05). At melatonin levels of 25–50 mg/kg, AMS content at 3:00 is significantly higher than at 15:00 (p < 0.05).
Figure 4A,B demonstrated that with increasing melatonin supplementation in the feed, the activities of trypsin (TPS) and lipase (LPS) in the hepatopancreas of P. clarkii initially increased and then decreased. When the melatonin supplementation level was 50–100 mg/kg, TPS and LPS activities reached relatively high levels (p < 0.05). At melatonin supplementation levels of 0–25 mg/kg, TPS activity at 3:00 was significantly higher than at 15:00 (p < 0.05). For LPS, at melatonin levels of 0–50 mg/kg, activity at 3:00 was also significantly higher than at 15:00 (p < 0.05).
As illustrated in Figure 4C, there were no significant differences in amylase (AMS) activity among the groups at 3:00 with increasing melatonin supplementation (p > 0.05). However, at 15:00, AMS activity in the hepatopancreas of P. clarkii initially increased and subsequently decreased, reaching a relatively high level at a melatonin supplementation of 50 mg/kg (p < 0.05). Furthermore, at melatonin levels of 25–50 mg/kg, AMS content at 3:00 was significantly higher than that at 15:00 (p < 0.05).

3.5. Effects of Melatonin on Expression of Circadian Clock-Related Genes in Procambarus clarkii

As illustrated in Figure 5A, increasing levels of melatonin supplementation in the feed correspond to a rising trend in the mRNA expression of Clock in P. clarkii at 3:00. At melatonin supplementation levels of 50–100 mg/kg, the Clock mRNA expression reached significantly elevated levels (p < 0.05). At 15:00, the Clock mRNA expression initially increased before subsequently decreasing, with the expression at 50 mg/kg being significantly higher than that in the other groups (p < 0.05). Furthermore, at melatonin levels of 25–75 mg/kg, the Clock mRNA expression at 3:00 was significantly lower than that observed at 15:00 (p < 0.05).
Figure 5B,C illustrated that with increasing melatonin supplementation, there were no significant differences in the mRNA expression of Bmal1 and Cry1 among the groups at 3:00 (p > 0.05). At 15:00, the mRNA expression of Bmal1 and Cry1 initially increased before subsequently decreasing. The mRNA expression of Bmal1 was significantly higher at 50 mg/kg compared to the other groups (p < 0.05), while the mRNA expression of Cry1 reached relatively elevated levels at dosages of 50–75 mg/kg (p < 0.05). At melatonin dosages of 50–100 mg/kg, the mRNA expression of Bmal1 at 3:00 was significantly lower than that observed at 15:00 (p < 0.05). Furthermore, the mRNA expression of Cry1 at 3:00 was significantly lower than at 15:00 for melatonin dosages of 0 and 50–100 mg/kg (p < 0.05).
As illustrated in Figure 5D, increasing melatonin supplementation resulted in an initial rise in Per1 mRNA expression in P. clarkii, followed by a subsequent decline. At 3:00, Per1 mRNA expression reached relatively high levels with melatonin dosages of 50–100 mg/kg (p < 0.05). By 15:00, Per1 mRNA expression was significantly higher at 50 mg/kg compared to the other groups (p < 0.05). Furthermore, at melatonin levels of 50–100 mg/kg, Per1 mRNA expression at 3:00 was significantly lower than at 15:00 (p < 0.05).
Figure 5E illustrated that with increasing melatonin supplementation, the expression of Tim1 mRNA in P. clarkii initially rose and then declined. At 3:00, the Tim1 mRNA expression was significantly higher at a dosage of 25 mg/kg compared to the other groups (p < 0.05). At 15:00, the Tim1 mRNA expression was significantly elevated at a dosage of 75 mg/kg relative to the other groups (p < 0.05). Furthermore, at melatonin levels ranging from 50 to 100 mg/kg, the Tim1 mRNA expression at 3:00 was significantly lower than that observed at 15:00 (p < 0.05).
Figure 5F illustrated that with increasing melatonin supplementation, the expression of Tim2 mRNA in P. clarkii initially increased, then declined. At 3:00, the Tim2 mRNA expression at a dosage of 50 mg/kg was significantly higher than that in the other groups (p < 0.05). Conversely, at 15:00, the Tim2 mRNA expression was significantly elevated at a dosage of 25 mg/kg compared to the other groups (p < 0.05). Furthermore, at melatonin levels ranging from 25 to 100 mg/kg, the Tim2 mRNA expression at 3:00 was significantly lower than that at 15:00 (p < 0.05).

4. Discussion

4.1. Effects of Melatonin on Growth Performance of Procambarus clarkii

The study of exogenous melatonin in mammals is relatively extensive, demonstrating significant improvements in milk production in dairy cows [5], as well as in weight gain and feed efficiency in domestic pigs (Sus scrofa) [22,23] and chickens (Gallus gallus domesticus) [24,25]. However, research on melatonin in aquaculture species is comparatively limited. Studies have shown that melatonin injections can enhance the growth performance of goldfish (Carassius auratus) and turbot (Scophthalmus maximus) [26,27]. Dietary supplementation with 9.28 mg/kg of melatonin has been found to promote growth in juvenile M. piceus [5], while a dosage of 82.7 mg/kg of melatonin in the diet significantly increased the survival rate, weight gain, and specific growth rate in L. vannamei [28]. In Asian swamp eel (Monopterus albus), a diet containing 120 mg/kg of melatonin significantly improved weight gain and specific growth rates while reducing the feed conversion ratio [29]. C. destructor fed with melatonin at 75–81 mg/kg exhibited enhanced growth performance, as reported by Yang et al. [7]. In the current study, the addition of 50 mg/kg of melatonin to the diet of juvenile P. clarkii significantly enhanced their weight gain, specific growth rate, and survival rate, while simultaneously reducing the feed conversion ratio. The results indicated that dietary melatonin at 50 mg/kg could improve the growth performance of P. clarkii. Various researchers have proposed different optimal levels of melatonin supplementation, which may be influenced by factors such as species, growth stages, and the aquacultural environment of the studied organisms. Further research is necessary to elucidate the specific reasons and underlying mechanisms.

4.2. Effects of Melatonin on Diurnal Variation in Non-Specific Immune Indices and AST, ALT Activities in Procambarus clarkii Hemolymph

Dietary supplementation with melatonin not only influences the growth of aquatic animals but also significantly impacts non-specific immunity. The total protein (TP) content in hemolymph serves as an indicator of protein absorption and utilization in aquatic species [30]. Additionally, lysozyme (LZM), acid phosphatase (ACP), and alkaline phosphatase (ALP) are closely associated with the humoral immunity of crustaceans [31]. LZM can exert bactericidal effects indirectly by hydrolyzing the cell walls of pathogens and facilitating phagocytosis [32,33]. ACP acts as a marker enzyme for macrophage lysosomes [34], while ALP modifies the surface structure of pathogenic bacteria, thereby enhancing the organism’s ability to recognize and phagocytize them [35]. Variations in the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) can indicate damage to the hepatopancreas [36]. Li et al. [37] found that dietary supplementation with melatonin at 41.2 mg/kg significantly increased LZM activity in the hemolymph of L. vannamei. Yang et al. [6] reported that adding 50.80 mg/kg of melatonin to the diet could enhance ALP activity in the hemolymph of E. sinensis post-challenge. Furthermore, Yang et al. [38] indicated that dietary melatonin supplementation of 75–81 mg/kg significantly reduced AST and ALT activities in C. destructor. These studies explored the effect of dietary melatonin on various non-specific immune parameters in different aquatic animals, but the impact of melatonin on the diurnal non-specific immunity of aquatic animals has not been reported. In the current study, increased levels of dietary melatonin were associated with a trend of first increasing and then decreasing TP content and LZM activity in the hemolymph of P. clarkii at 03:00 and 15:00. The activity of ACP at 03:00 exhibited a similar pattern. At a dietary melatonin level of 50 mg/kg, the activities of LZM and ALP in the hemolymph of P. clarkii remained elevated at both 15:00 and 03:00, while the activities of AST and ALT were comparatively lower at these two time points. Consistent with these findings, dietary melatonin supplementation promoted the enhancement of diurnal non-specific immunity and supported hepatopancreatic health in P. clarkii. At dietary melatonin levels ranging from 50 to 100 mg/kg, TP and LZM levels at 03:00 were significantly higher than those at 15:00. This study demonstrated that melatonin supplementation enhances both diurnal and nocturnal non-specific immune responses in juvenile P. clarkii.

4.3. Effects of Melatonin on Diurnal Antioxidant Capacity in Procambarus clarkii Hepatopancreas

The hepatopancreas is the primary organ responsible for energy storage and digestion in crustaceans, performing essential functions such as lipid storage, digestive enzyme secretion, and detoxification [39]. Melatonin acts as a potent direct free radical scavenger and serves as an indirect antioxidant [40,41]. Catalase (CAT) plays a crucial role in protecting cells from oxidative damage by catalyzing the decomposition of hydrogen peroxide (H2O2). Glutathione reductase (GR) is responsible for reducing oxidized glutathione disulfide (GSSG) back to reduced glutathione (GSH), while glutathione peroxidase (GPx) is an antioxidant enzyme that decomposes peroxides, including H2O2 [42]. In aquatic animals, the intestinal concentration in Indian carp (Catla catla) is positively correlated with the activities of CAT and GPx [43]. Yang et al. [6] demonstrated that the addition of 50.80 mg/kg of melatonin to the feed significantly increased the activities of CAT and GPx in the hepatopancreas of E. sinensis under stress conditions. Furthermore, the inclusion of 75–81 mg/kg of melatonin in the feed enhanced GR activity in the hepatopancreas of C. destructor [7]. Additionally, in E. sinensis, the addition of 50.80 mg of melatonin significantly increased the activities of CAT and GPx in the gills after 4 h of hypoxia, while also alleviating the elevated malondialdehyde (MDA) content resulting from hypoxia [44,45]. These experimental results investigated the effects of melatonin supplementation in feed on antioxidant capacity and other indicators in the hepatopancreas of various aquatic animals. However, the effects of melatonin on the diurnal antioxidant capacity of the hepatopancreas in aquatic animals have not been reported. In this study, with melatonin supplementation in the feed increased, the activities of CAT, GPx, and GR in the hepatopancreas of P. clarkii exhibited a trend of initially increasing and then decreasing at 3:00 and 15:00, while MDA displayed the opposite trend. At a melatonin concentration of 50 mg/kg, the activities of CAT, GPx, and GR at both 15:00 and 3:00 were relatively higher levels, whereas MDA content was at a comparatively lower level, aligning with previous studies. Melatonin supplementation in the feed appears to enhance the diurnal and nocturnal antioxidant capacity of the hepatopancreas in P. clarkii. Furthermore, this study demonstrated that when melatonin supplementation ranged from 50 to 100 mg/kg, CAT activity at 3:00 was significantly higher than that at 15:00, while MDA content showed the opposite pattern. Additionally, when melatonin supplementation was between 0 and 25 mg/kg, GPx and GR activities at 3:00 were significantly greater than those at 15:00. These results indicate that melatonin administration significantly enhanced the antioxidant capacity in juvenile P. clarkii across circadian cycles.

4.4. Effects of Melatonin on Diurnal Digestive Enzyme Activities in Procambarus clarkii Hepatopancreas and Intestines

Trypsin (TPS), lipase (LPS), and amylase (AMS) are common digestive enzymes found in crustaceans, involved in the digestion and absorption of food [46]. In C. catla, endogenous melatonin levels are positively correlated with the activity of these digestive enzymes [44]. Supplementing 120 mg/kg of melatonin in the feed significantly enhanced the activities of amylase, trypsin, and lipase in the intestines of M. albus [29]. Additionally, injecting 20 µL of melatonin into E. sinensis markedly promoted the activities of trypsin and lipase in the hepatopancreas [47]. Furthermore, incorporating 50.80 mg/kg of melatonin into the feed significantly increased the activities of trypsin and amylase in the intestines of E. sinensis under conditions of ammonia nitrogen stress [2]. Similarly, adding 80 mg/kg of melatonin significantly boosted the activities of trypsin and amylase in the intestines of E. sinensis under glyphosate stress [48]. Mardones et al. [49] conducted an experiment in which silver salmon (Oncorhynchus kisutch) were fed with feed immersed in melatonin solutions at concentrations of 0.002%, 0.01%, and 0.05% for 10 days, resulting in an increase in intestinal TPS activity. These studies explored that fish and crustaceans exhibit similarities in the types and functions of digestive enzymes, as well as in the fundamental mechanisms of enzyme secretion and regulation. These experimental results explored the effects of exogenous melatonin on the activities of digestive enzymes in the hepatopancreas and intestines of various aquatic animals. However, studies examining the influence of melatonin on the diurnal and nocturnal activity of digestive enzymes in these organs have not been reported. In this experiment, increased melatonin supplementation in the feed resulted in the activities of TPS and LPS in the hepatopancreas and intestines of P. clarkii exhibiting a trend of initially increasing followed by decreasing activity. When melatonin was added at 50 mg/kg, the activities of TPS and LPS in the hepatopancreas and intestines at 15:00 and 03:00 reached relatively high levels. At 15:00, the activity of AMS in the hepatopancreas of P. clarkii also demonstrated a trend of first increasing and then decreasing, peaking at the same melatonin concentration of 50 mg/kg. This finding aligned with previous studies, suggesting that melatonin supplementation in the feed enhances the levels of digestive enzymes in the hepatopancreas and intestines of P. clarkii during both day and night, thereby improving nutrient digestion capabilities. Furthermore, this experiment revealed that when melatonin was added from 0 to 25 mg/kg, the activities of TPS and LPS in the intestines and hepatopancreas of P. clarkii at 03:00 were significantly higher than those at 15:00. However, when melatonin supplementation exceeded 25 mg/kg, the difference in enzyme activity levels between 03:00 and 15:00 was not significant. Initial findings indicate that ideal dietary melatonin levels could enhance the activities of digestive enzymes in P. clarkii during both light and dark phases.

4.5. Effects of Melatonin on the Expression of Circadian Clock-Related Genes in Procambarus clarkii

The effects of melatonin on the expression of circadian clock-related genes have been extensively studied in mammals, but there were relatively few reports on aquatic animals. Circadian clock-related genes maintain the homeostasis of circadian rhythms by regulating melatonin secretion, which, in turn, can affect the expression of these genes [50,51]. Studies have shown that melatonin influences the expression of genes such as Clock, Bmal1, Cry1, and Per1 by regulating cumulus–oocyte complexes in Mus musculus [15,16]. Kandalepas et al. [17] directly applied 1 μL of 1 nM melatonin to Mus musculus suprachiasmatic nucleus (SCN) slices, finding that melatonin induced an increase in Per1 mRNA expression. When used as a treatment for improving sleep conditions in Parkinson’s patients, melatonin increased the expression of Bmal1 mRNA [18]. These studies explored the effects of exogenous melatonin on the expression of circadian clock-related genes in different animals, but there have been no reports on the effects of melatonin on the circadian expression of circadian clock-related genes in aquatic animals during day and night. In this experiment, with increasing melatonin supplementation in the feed, the circadian mRNA expression levels of Clock, Bmal1, Cry1, and Per1 in the hepatopancreas of P. clarkii at 15:00 and 3:00 showed a trend of first increasing and then decreasing. When the melatonin addition was 50 mg/kg, the mRNA expression levels of Clock, Bmal1, Cry1, and Per1 in the hepatopancreas at 15:00 and 3:00 were significantly upregulated. At 3:00, a melatonin addition of 25 mg/kg in the feed significantly upregulated the expression level of Tim1 in P. clarkii. At 15:00, a melatonin addition of 50 mg/kg significantly upregulated the expression level of Bmal1 mRNA in P. clarkii. These results are similar to the aforementioned studies, indicating that melatonin supplementation in the feed upregulates the expression of circadian clock-related genes during day and night. Furthermore, this study found that with increased melatonin supplementation, the mRNA levels of Clock, Bmal1, Cry1, Per1, Tim1, and Tim2 at 3:00 were significantly lower than those at 15:00. We hypothesize that melatonin-enriched feed may synchronize circadian clock gene expression in P. clarkii, thereby maintaining circadian homeostasis through transcriptional-translational feedback loops. The results of this study revealed that melatonin significantly influenced the expression of circadian clock-related genes in P. clarkii, providing new insights into the regulatory mechanisms of circadian rhythms in aquatic invertebrates. Particularly in the context of aquaculture, this finding offers a theoretical basis and practical direction for using exogenous melatonin to regulate circadian rhythms in crustaceans.

5. Conclusions

Thus, the diet supplemented with melatonin 50 mg/kg could promote the growth of Procambarus clarkii, enhance diurnal non-specific immunity, antioxidant capacity, hepatopancreas, and intestinal digestive enzyme activities, and regulate the expression of circadian clock-related genes to maintain its circadian rhythm homeostasis. However, further study is required to explore how melatonin can improve the sustainability of aquaculture.

Author Contributions

Conceptualization, J.M., J.C. and A.W.; methodology, J.M. and A.W.; software, J.C., J.W., M.Z. and Y.D.; validation, A.W., H.T., W.Z. and S.X.; formal analysis, Y.D., M.Z., X.Z. and B.L.; investigation, J.W., X.S. and B.L.; resources, J.M., W.C., J.X., X.Z. and B.L.; data curation, J.C. and X.S.; writing—original draft preparation, J.M. and J.C.; writing—review and editing, J.M. and J.C.; visualization, H.T., S.X., J.X., W.Z. and B.L.; supervision, W.C. and X.Z.; project administration, J.M. and A.W. All authors reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Research on Public Welfare Technology Application of Science and Technology Project of Huzhou in China (2024GZ30), the National Key Research and Development Plan project (2023YFD2402000), the National Natural Science Foundation of China (No. 32102767), the Yancheng Fishery High-Quality Development Project (2022yc003), the Jiangsu Modern Agricultural Industrial Technology System Construction Special Fund (JATS [2023] 471), the Postgraduate Research and Innovation Project of Huzhou University (2024KYCX98) and Zhejiang Provincial College Student Innovation and Entrepreneurship Training Program (S202410347060).

Institutional Review Board Statement

Animal procedures were performed in accordance with the regulations and approved by the Institutional Animal Care and Use Committee of Huzhou University (approval ID: ZJHU-DW-2024-032; approval date: 18 March 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

Research data are available upon request to the authors.

Acknowledgments

The authors thank the editors and reviewers for their valuable comments and suggestions.

Conflicts of Interest

The authors report no declarations of conflicts of interest.

References

  1. Carrillo-Vico, A.; Lardone, P.J.; Álvarez-Sánchez, N.; Rodríguez-Rodríguez, A.; Guerrero, J.M. Melatonin: Buffering the immune system. Int. J. Mol. Sci. 2013, 14, 8638–8683. [Google Scholar] [CrossRef] [Scilit]
  2. Foster, R.G. Melatonin. Curr. Biol. 2021, 31, 1456–1458. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Miller, S.C.; Pandi, P.S.; Esquifino, A.I.; Cardinali, D.P.; Maestroni, G.J. The role of melatonin in immuno-enhancement: Potential application in cancer. Int. J. Exp. Pathol. 2006, 87, 81–87. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Zhang, C.; Yang, X.Z.; Xu, M.J.; Huang, G.Y.; Zhang, Q.; Cheng, Y.X.; He, L.; Ren, H.Y. Melatonin promotes cheliped regeneration, digestive enzyme function, and immunity following autotomy in the Chinese mitten crab, Eriocheir sinensis. Front. Physiol. 2018, 9, 269. [Google Scholar] [CrossRef] [Scilit]
  5. Gao, W.X.; Ma, H.; Yang, M.N.; Peng, S.Y.; Qu, J.C.; Qu, Y.L. Effects of rumen-protected melatonin supplementation on melatonin and its precursors and metabolites contents in milk, melatonin synthetase activity, and performance in Holstein cows. Chin. J. Anim. Nutr. 2022, 34, 4438–4451. [Google Scholar]
  6. Yang, X.; Song, X.; Zhang, C.; Pang, Y.; Song, Y.; Cheng, Y.; Nie, L.; Zong, X. Effects of dietary melatonin on hematological immunity, antioxidant defense and antibacterial ability in the Chinese mitten crab, Eriocheir sinensis. Aquaculture 2020, 529, 735578. [Google Scholar] [CrossRef] [Scilit]
  7. Yang, Y.; Xu, W.; Du, X.; Ye, Y.; Tian, J.; Li, Y.; Jiang, Q.; Zhao, Y. Effects of dietary melatonin on growth performance, antioxidant capacity, and nonspecific immunity in crayfish, Cherax destructor. Fish Shellfish Immunol. 2023, 138, 108846. [Google Scholar] [CrossRef] [Scilit]
  8. Yıldırım, M.; Aktaș, M. The effects of melatonin’s pacific white shrimp, Litopenaeus vannamei (Boone 1931) on moulting, growth and meat composition. Yunus Arast. Bul. 2016, 16, 193–200. [Google Scholar]
  9. Evans, R.M. Regulation of Circadian Behavior and Metabolism by Clock Genes. J. Non-Cryst. Solids 1981, 44, 171–180. [Google Scholar]
  10. Fuhr, L.; Abreu, M.; Pett, P.; Relógio, A. Circadian systems biology: When time matters. Comput. Struct. Biotechnol. J. 2015, 13, 417–426. [Google Scholar] [CrossRef] [Scilit]
  11. Lin, Y.; Han, M.; Shimada, B.; Wang, L.; Gibler, T.M.; Amarakone, A.; Awad, T.A.; Stormo, G.D.; Van Gelder, R.N.; Taghert, P.H. Influence of the period-dependent circadian clock on diurnal, circadian, and aperiodic gene expression in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 2002, 99, 9562–9567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Minnetti, M.; Hasenmajer, V.; Pofi, R.; Venneri, M.A.; Alexandraki, K.I.; Isidori, A.M. Fixing the broken clock in adrenal disorders: Focus on glucocorticoids and chronotherapy. J. Endocrinol. 2020, 246, R13–R31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Hill, S.M.; Belancio, V.P.; Dauchy, R.T.; Xiang, S.; Brimer, S.; Mao, L.; Hauch, A.; Lundberg, P.W.; Summers, W.; Yuan, L.; et al. Melatonin: An inhibitor of breast cancer. Endocr.—Relat. Cancer 2015, 22, R183–R204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Yoshiuchi, I. Analysis of evolution and ethnic diversity at glucose-associated SNPs of circadian clock-related loci with cryptochrome 1, cryptochrome 2, and melatonin receptor 1B. Biochem. Genet. 2021, 59, 1173–1184. [Google Scholar] [CrossRef] [Scilit]
  15. Coelho, L.D.; Peres, R.; Amaral, F.G.; Reiter, R.J.; Cipolla-Neto, J. Daily differential expression of melatonin-related genes and clock genes in rat cumulus–oocyte complex: Changes after pinealectomy. J. Pineal Res. 2015, 58, 490–499. [Google Scholar] [CrossRef] [Scilit]
  16. Tenorio, F.; Simoes, M.J.; Teixeira, V.W. Effects of melatonin and prolactin in reproduction: Review of literature. Rev. Assoc. Med. Bras. 2015, 61, 269–274. [Google Scholar] [CrossRef] [Scilit]
  17. Kandalepas, P.C.; Mitchell, J.W.; Gillette, M.U. Melatonin signal transduction pathways require E-box-mediated transcription of Per1 and Per2 to reset the SCN clock at dusk. PLoS ONE 2016, 11, e0157824. [Google Scholar] [CrossRef] [Scilit]
  18. Delgado-Lara, D.L.; González-Enríquez, G.V.; Torres-Mendoza, B.M.; González-Usigli, H.; Cárdenas-Bedoya, J.; Macías-Islas, M.A.; de la Rosa, A.C.; Jiménez-Delgado, A.; Pacheco-Moisés, F.; Cruz-Serrano, J.A. Effect of melatonin administration on the PER1 and BMAL1 clock genes in patients with Parkinson’s disease. Biomed. Pharmacother. 2020, 129, 110485. [Google Scholar] [CrossRef] [Scilit]
  19. Guo, K.; Ruan, G.; Fan, W.; Fang, L.; Wang, Q.; Luo, M.; Yi, T. The effect of nitrite and sulfide on the antioxidant capacity and microbial composition of the intestines of red swamp crayfish. Fish Shellfish Immunol. 2020, 96, 290–296. [Google Scholar] [CrossRef] [Scilit]
  20. Huang, P.D. Discovery and Epidemiological Investigation of New Viral Pathogens Causing “May Decay” in Procambarus Clarkii. Master’s Thesis, Nanjing Agricultural University, Nanjing, China, 2019. [Google Scholar]
  21. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−∆∆CT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
  22. Tang, C.X. Effects of Active Immunization Against Melatonin on the Growth Performance and Carcass Quality of Growing Pigs. Master’s Thesis, Sichuan Agricultural University, Ya’an, China, 2005. [Google Scholar]
  23. Yan, J.M. Study on Effects of Melatonin on Growth Performance, Immune Function, and Antioxidant Capacity of Weaning Piglets. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2019. [Google Scholar]
  24. Osei, P.; Robbins, K.R.; Shirley, H.V. Effects of exogenous melatonin on growth and energy metabolism of chickens. Nutr. Res. 1989, 9, 69–81. [Google Scholar] [CrossRef] [Scilit]
  25. Lu, Y.F.; Liao, Q.H. Effects of melatonin on growth performance and immune function in broilers. Feed Ind. 2008, 13, 37–39. [Google Scholar]
  26. De Vlaming, V. Effects of pinealectomy and melatonin treatment on growth in the goldfish, Carassius auratus. Gen. Comp. Endocrinol. 1980, 40, 245–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Alvariño, J.M.; Rebollar, P.G.; Olmedo, M.; Álvarez-Blázquez, B.; Ubilla, E.; Peleteiro, J.B. Effects of melatonin implants on reproduction and growth of turbot broodstock. Aquac. Int. 2001, 9, 477–487. [Google Scholar] [CrossRef] [Scilit]
  28. Ye, Y.; Li, S.; Zhu, B.; Yang, Y.; Du, X.; Li, Y.; Zhao, Y. Effects of dietary melatonin on growth performance, nutrient composition, and lipid metabolism of Pacific white shrimp (Penaeus vannamei). Aquaculture 2024, 578, 740095. [Google Scholar] [CrossRef] [Scilit]
  29. Lv, W.; Li, M.; Mao, Y.; Huang, W.; Yuan, Q.; Li, M.; Zhou, Q.; Yang, H.; Zhou, W. Effects of dietary melatonin supplementation on growth performance and intestinal health of rice field eel (Monopterus albus). Comp. Biochem. Physiol. D Genom. Proteom. 2024, 52, 101273. [Google Scholar] [CrossRef] [Scilit]
  30. Wang, J.; Li, B.; Ma, J.; Wang, S.; Huang, B.; Sun, Y.; Zhang, L. Optimum dietary protein to lipid ratio for starry flounder (Platichthys stellatus). Aquac. Res. 2017, 48, 189–201. [Google Scholar] [CrossRef] [Scilit]
  31. Liu, F.; Qu, Y.K.; Geng, C.; Wang, A.M.; Zhang, J.H.; Chen, K.J.; Liu, B.; Tian, H.Y.; Yang, W.P.; Yu, Y.B. Effects of hesperidin on the growth performance, antioxidant capacity, immune responses and disease resistance of red swamp crayfish (Procambarus clarkii). Fish Shellfish Immunol. 2020, 99, 154–166. [Google Scholar] [CrossRef] [Scilit]
  32. Ashouri, G.; Soofiani, N.M.; Hoseinifar, S.H.; Jalali, S.A.; Morshedi, V.; Valinassab, T.; Bagheri, D.; Van Doan, H.; Mozanzadeh, M.T.; Carnevali, O. Influence of dietary sodium alginate and Pediococcus acidilactici on liver antioxidant status, intestinal lysozyme gene expression, histomorphology, microbiota, and digestive enzymes activity in Asian sea bass (Lates calcarifer) juveniles. Aquaculture 2020, 518, 734638. [Google Scholar] [CrossRef] [Scilit]
  33. Perez, L. Fish innate immune response to viral infection—An overview of five major antiviral genes. Viruses 2022, 14, 1546. [Google Scholar] [CrossRef] [Scilit]
  34. Zhu, L.; Wang, X.; Hou, L.; Jiang, X.; Li, C.; Zhang, J.; Pei, C.; Zhao, X.; Li, L.; Kong, X. The related immunity responses of red swamp crayfish (Procambarus clarkii) following infection with Aeromonas veronii. Aquac. Rep. 2021, 21, 100849. [Google Scholar] [CrossRef] [Scilit]
  35. Yang, L.X.; Xu, H.Z.; Liu, C.J.; Wang, G.L.; Ai, Y.; Jiang, W.S.; Luo, Q.H.; Li, H.; Luo, L.; Xiang, X. Effects of Vitamin C on the Structure and Function of the Digestive System of Andrias davidianus. J. Fish. Sci. China 2023, 47, 161–172. [Google Scholar]
  36. Luo, J.; Fu, W.J.; Yang, E.J.; Huang, J.S.; Xie, R.T.; Chen, G. Effects of Quercetin on Growth Performance, Antioxidant Capacity, and Gut Microbiota of Hybrid Grouper. J. Guangdong Ocean Univ. 2022, 42, 13–22. [Google Scholar]
  37. Li, Y.; Yang, Y.; Li, S.; Ye, Y.; Du, X.; Liu, X.; Jiang, Q.; Che, X. Effects of dietary melatonin on antioxidant and immune function of the Pacific white shrimp (Litopenaeus vannamei), as determined by transcriptomic analysis. Comp. Biochem. Physiol. D: Genom. Proteom. 2023, 48, 101146. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Yang, Y.; Zhu, B.; Xu, W.; Tian, J.; Du, X.; Ye, Y.; Huang, Y.; Jiang, Q.; Li, Y.; Zhao, Y. Dietary melatonin positively impacts the immune system of crayfish, Cherax destructor, as revealed by comparative proteomics analysis. Fish Shellfish Immunol. 2023, 142, 109122. [Google Scholar] [CrossRef] [Scilit]
  39. Li, Y.; Huang, Y.; Zhang, M.; Chen, Q.; Fan, W.; Zhao, Y. Effect of dietary vitamin E on growth, immunity and regulation of hepatopancreas nutrition in male oriental river prawn, Macrobrachium nipponense. Aquac. Res. 2019, 50, 1741–1751. [Google Scholar] [CrossRef] [Scilit]
  40. Reiter, R.J.; Tan, D.X.; Galano, A. Melatonin: Exceeding expectations. Physiology 2014, 29, 325–333. [Google Scholar] [CrossRef] [Scilit]
  41. Zhao, Y.; Song, X.; Zhao, P.; Li, T.; Xu, J.W.; Yu, X. Role of melatonin in regulation of lipid accumulation, autophagy and salinity-induced oxidative stress in microalga Monoraphidium sp. QLY-1. Algal Res. 2021, 54, 102196. [Google Scholar] [CrossRef] [Scilit]
  42. Winiarska, K.; Fraczyk, T.; Malinska, D.; Drozak, J.; Bryla, J. Melatonin attenuates diabetes-induced oxidative stress in rabbits. J. Pineal Res. 2006, 40, 168–176. [Google Scholar] [CrossRef] [Scilit]
  43. Marí, M.; Morales, A.; Colell, A.; García-Ruiz, C.; Fernández-Checa, J.C. Mitochondrial glutathione, a key survival antioxidant. Antioxid. Redox Signal. 2009, 11, 2685–2700. [Google Scholar] [CrossRef] [Scilit]
  44. Pal, P.K.; Maitra, S.K. Response of gastrointestinal melatonin, antioxidants, and digestive enzymes to altered feeding conditions in carp (Catla catla). Fish Physiol. Biochem. 2018, 44, 1061–1073. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Yang, X.; Shi, X.; Wu, M.; Pang, Y.; Song, X.; Shi, A.; Niu, C.; Cheng, Y. Effects of melatonin feed on histology and antioxidant ability of the gills and oxygen consumption of Chinese mitten crab (Eriocheir sinensis), exposed to acute hypoxia stress. Aquaculture 2021, 544, 737015. [Google Scholar] [CrossRef] [Scilit]
  46. Song, Y.; Wu, M.; Pang, Y.; Song, X.; Shi, A.; Shi, X.; Niu, C.; Cheng, Y.; Yang, X. Effects of melatonin feed on the changes of hemolymph immune parameters, antioxidant capacity, and mitochondrial functions in Chinese mitten crab (Eriocheir sinensis) caused by acute hypoxia. Aquaculture 2021, 535, 736374. [Google Scholar] [CrossRef] [Scilit]
  47. Coccia, E.; Varricchio, E.; Paolucci, M. Digestive enzymes in the crayfish Cherax albidus: Polymorphism and partial characterization. Int. J. Zool. 2011, 2011, 31037. [Google Scholar] [CrossRef] [Scilit]
  48. Yang, X.; Shi, A.; Song, Y.; Niu, C.; Yu, X.; Shi, X.; Pang, Y.; Ma, X.; Cheng, Y. The effects of ammonia-N stress on immune parameters, antioxidant capacity, digestive function, and intestinal microflora of Chinese mitten crab, Eriocheir sinensis, and the protective effect of dietary supplement of melatonin. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2021, 250, 109127. [Google Scholar] [CrossRef] [Scilit]
  49. Song, Y.; Song, X.; Wu, M.; Pang, Y.; Shi, A.; Shi, X.; Niu, C.; Cheng, Y.; Yang, X. The protective effects of melatonin on survival, immune response, digestive enzymes activities and intestinal microbiota diversity in Chinese mitten crab (Eriocheir sinensis) exposed to glyphosate. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2020, 238, 108845. [Google Scholar] [CrossRef] [Scilit]
  50. Mardones, O.; Devia, E.; Labbé, B.S.; Oyarzún, R.; Vargas-Chacoff, L.; Muñoz, J.L. Effect of L-tryptophan and melatonin supplementation on the serotonin gastrointestinal content and digestive enzymatic activity for Salmo salar and Oncorhynchus kisutch. Aquaculture 2018, 482, 203–210. [Google Scholar] [CrossRef] [Scilit]
  51. Takekida, S.; Yan, L.; Maywood, E.S.; Hastings, M.H.; Okamura, H. Differential adrenergic regulation of the circadian expression of the clock genes Period1 and Period2 in the rat pineal gland. Eur. J. Neurosci. 2000, 12, 4557–4561. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effects of dietary melatonin on hemolymph levels of TP (A), ACP (B), ALP (C), LZM (D), ALT (E), and AST (F) in P. clarkii. Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3:00 and 15:00 sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3 h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05). TP, total protein; ACP, acid phosphatase; ALP, alkaline phosphatase; LZM, lysozyme; ALT, alanine aminotransferase; AST, aspartate aminotransferase.
Figure 1. Effects of dietary melatonin on hemolymph levels of TP (A), ACP (B), ALP (C), LZM (D), ALT (E), and AST (F) in P. clarkii. Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3:00 and 15:00 sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3 h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05). TP, total protein; ACP, acid phosphatase; ALP, alkaline phosphatase; LZM, lysozyme; ALT, alanine aminotransferase; AST, aspartate aminotransferase.
Fishes 10 00114 g001aFishes 10 00114 g001bFishes 10 00114 g001c
Figure 2. Effects of dietary melatonin on hepatopancreatic levels of CAT (A), GPx (B), GR (C), and MDA (D) of P. clarkii. Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3 h and 15 h sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3 h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05). CAT, catalase; GPx, glutathione peroxidase; GR, glutathione reductase; MDA, malondialdehyde.
Figure 2. Effects of dietary melatonin on hepatopancreatic levels of CAT (A), GPx (B), GR (C), and MDA (D) of P. clarkii. Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3 h and 15 h sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3 h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05). CAT, catalase; GPx, glutathione peroxidase; GR, glutathione reductase; MDA, malondialdehyde.
Fishes 10 00114 g002
Figure 3. Effects of melatonin on the activities of TPS (A), LPS (B), and ALS (C) in the hepatopancreas of P. clarkii. Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3 h and 15 h sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3 h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05) TPS, trypsin; LPS, lipase; AMS, amylase.
Figure 3. Effects of melatonin on the activities of TPS (A), LPS (B), and ALS (C) in the hepatopancreas of P. clarkii. Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3 h and 15 h sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3 h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05) TPS, trypsin; LPS, lipase; AMS, amylase.
Fishes 10 00114 g003aFishes 10 00114 g003b
Figure 4. Effects of melatonin on intestinal TPS (A), LPS (B) and ALS (C) activities of P. clarkii. Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3 h and 15 h sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05). TPS, trypsin; LPS, lipase; AMS, amylase.
Figure 4. Effects of melatonin on intestinal TPS (A), LPS (B) and ALS (C) activities of P. clarkii. Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3 h and 15 h sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05). TPS, trypsin; LPS, lipase; AMS, amylase.
Fishes 10 00114 g004aFishes 10 00114 g004b
Figure 5. Effects of melatonin on the expression of circadian clock-related genes Clock (A), Bmal1 (B), Cry1 (C), Per1 (D), Tim1 (E), and Tim2 (F) of crayfish (P. clarkii). Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3 h and 15 h sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3 h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05). Clock: circadian locomotor output cycles kaput; Bmal1: brain and muscle ARNT-like protein-1; Cry1: cryptochrome circadian regulator 1; Per1: period circadian regulator 1; Tim1: timeless circadian regulator 1; Tim2: timeless circadian regulator 2.
Figure 5. Effects of melatonin on the expression of circadian clock-related genes Clock (A), Bmal1 (B), Cry1 (C), Per1 (D), Tim1 (E), and Tim2 (F) of crayfish (P. clarkii). Bars represent the means ± SD (n = 4). Asterisks above the bars indicate significant differences between the 3 h and 15 h sampling groups within the same melatonin dose group, according to t-test (p < 0.05). Different lowercase and uppercase letters above the bars indicate significant differences among different melatonin dose groups in the 3 h and 15 h sampling groups, respectively, according to one-way ANOVA and Tukey’s multiple range test (p < 0.05). Clock: circadian locomotor output cycles kaput; Bmal1: brain and muscle ARNT-like protein-1; Cry1: cryptochrome circadian regulator 1; Per1: period circadian regulator 1; Tim1: timeless circadian regulator 1; Tim2: timeless circadian regulator 2.
Fishes 10 00114 g005aFishes 10 00114 g005b
Table 1. Formulation and proximate composition of experimental diets (air-dry basis).
Table 1. Formulation and proximate composition of experimental diets (air-dry basis).
IngredientsDietary Melatonin Levels/(mg/kg)
0255075100
Fish meal12.0012.0012.0012.0012.00
Soybean meal21.0021.0021.0021.0021.00
Fermented rapeseed meal16.0016.0016.0016.0016.00
Fermented cottonseed meal14.0014.0014.0014.0014.00
Corn starch10.0010.0010.0010.0010.00
Flour19.5519.5519.5519.5519.55
Fish oil1.001.001.001.001.00
Soybean oil2.502.502.502.502.50
Ca(H2PO4)22.002.002.002.002.00
Zeolite powder0.500.49750.4950.49250.49
Choline chloride0.400.400.400.400.40
Vitamin premix 10.200.200.200.200.20
Mineral premix 10.300.300.300.300.30
Cholesterin0.500.500.500.500.50
Butylated Hydroxytoluene0.050.050.050.050.05
Melatonin0.000.00250.0050.00750.01
Total:100100100100100
Nutrient levels (%) 2
Moisture5.525.695.685.425.68
Crude protein33.8133.7933.8333.8433.86
Ether extract5.825.566.075.796.09
Ash8.068.068.058.058.06
Note: 1 Vitamin premix and mineral premix were provided by Beijing Dabeinong Science and Technology Group Co., Ltd. 2 The following values were measured according to the methods of AOAC.
Table 2. The primers for real-time qPCR.
Table 2. The primers for real-time qPCR.
GenesForward Primer Sequence (5′-3′)Reverse Primer Sequence (5′-3′)
ClockF: GGCGGATCAAGTAGTAAACGAGR: AGCATCAGAACACGGAGAAGG
Bmal1F: TCCGAATGGCAGTTCAGCAR: CAACCCAOGACAAACAAGAAAC
Cry1F: AATGCTGGGTCCTGGATGTGR: TTCTGGCTCTGCTTGATGTGAT
Per1F: AATGGGAATAATACTGCCGAGAAR: GAGCCTTGATOCTGATTGGTG
Tim1F: AGGAACCCAAGCAATCTCAATGR: CCAACAACTGCGTCTGTAACCA
Tim2F: ATCTGTCCACGATCAGGTGTTGR: CCGCATTTCCAGGAGTTCTTT
β-actionF: ATTCTCACCGAGCGTGGCTR: AGGCGGCAGTGGTCATTTC
Note: F, forward; R, reverse; Clock: circadian locomotor output cycles kaput; Bmal1: brain and muscle ARNT-like protein-1; Cry1: cryptochrome circadian regulator 1; Per1: period circadian regulator 1; Tim1: timeless circadian regulator 1; Tim2: timeless circadian regulator 2.
Table 3. Effects of melatonin on growth and body indexes of P. clarkii
Table 3. Effects of melatonin on growth and body indexes of P. clarkii
ItemsDietary Melatonin Levels (mg/kg)
0255075100
IBW 1 (g)6.90 ± 0.166.77 ± 0.396.39 ± 0.296.55 ± 0.106.80 ± 0.37
FBW 1 (g)19.36 ± 0.34 bc19.99 ± 0.49 ab20.49 ± 0.44 a19.50 ± 0.24 bc19.14 ± 0.31 c
WGR 1 (%)180.57 ± 5.11 b196.13 ± 21.25 ab220.97 ± 8.09 a197.65 ± 2.17 ab182.09 ± 17.68 b
SGR 1 (%)1.71 ± 0.01 b1.84 ± 0.07 ab1.96 ± 0.08 a1.82 ± 0.01 b1.74 ± 0.09 b
FCR 10.88 ± 0.05 ab0.83 ± 0.14 ab0.73 ± 0.01 b0.80 ± 0.01 ab0.91 ± 0.09 a
SR 1 (%)79.17 ± 5.32 ab84.72 ± 2.78 ab87.50 ± 5.32 a79.17 ± 2.78 ab77.78 ± 4.54 b
HIS 2 (%)8.01 ± 1.237.23 ± 1.117.50 ± 0.927.56 ± 0.737.89 ± 1.57
MR 2 (%)13.79 ± 2.3912.98 ± 2.3913.77 ± 2.1313.53 ± 2.3613.61 ± 2.40
CF 22.76 ± 0.283.01 ± 0.402.81 ± 0.332.95 ± 0.312.77 ± 0.30
Note: 1. Values are the mean ± SD (standard deviation) of 4 replicates (n = 4). 2. Values are the mean ± SD of 9 samples. Experimental data were analyzed using SPSS 25 software with one-way ANOVA and Tukey’s multiple comparison test. Different superscript letters within the same row indicate significant differences (p < 0.05). Identical letters or no superscript indicate no significant difference (p > 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, J.; Du, Y.; Zhang, M.; Wang, J.; Ming, J.; Shao, X.; Wang, A.; Tian, H.; Zhang, W.; Xia, S.; et al. Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii). Fishes 2025, 10, 114. https://doi.org/10.3390/fishes10030114

AMA Style

Chen J, Du Y, Zhang M, Wang J, Ming J, Shao X, Wang A, Tian H, Zhang W, Xia S, et al. Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii). Fishes. 2025; 10(3):114. https://doi.org/10.3390/fishes10030114

Chicago/Turabian Style

Chen, Jinglong, Youhai Du, Mengyue Zhang, Jiahui Wang, Jianhua Ming, Xianping Shao, Aimin Wang, Hongyan Tian, Wuxiao Zhang, Silei Xia, and et al. 2025. "Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii)" Fishes 10, no. 3: 114. https://doi.org/10.3390/fishes10030114

APA Style

Chen, J., Du, Y., Zhang, M., Wang, J., Ming, J., Shao, X., Wang, A., Tian, H., Zhang, W., Xia, S., Cheng, W., Xu, J., Zheng, X., & Liu, B. (2025). Effects of Melatonin on the Growth and Diurnal Variation of Non-Specific Immunity, Antioxidant Capacity, Digestive Enzyme Activity, and Circadian Clock-Related Gene Expression in Crayfish (Procambarus clarkii). Fishes, 10(3), 114. https://doi.org/10.3390/fishes10030114

Article Metrics

Back to TopTop