Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi
Abstract
1. Introduction
2. Materials and Methods
2.1. Feed Formulation
2.2. Experimental Fish and Daily Management
2.3. Sample Collection
2.4. Acute Ammonia Nitrogen Stress Trial
2.5. Nutritional Composition Analysis
2.6. Biochemical Indicators and Enzyme Activity Analysis
2.7. Histological Analysis
2.8. RNA Extraction and Quantitative Real-Time PCR Analysis
2.9. Calculations and Statistical Methods
Weight Gain Rate (WGR, %): WGR = [(Final body weight − Initial body weight)/Initial body weight] × 100. |
Survival Rate (SR, %): SR = (Final fish number/Initial fish number) × 100. |
Specific Growth Rate (SGR, %/day): SGR = [100 × (ln(Final body weight) − ln(Initial body weight))]/days. |
Feeding Ratio (FR, %/day): FR = [Total feed intake/((Final body weight + Initial body weight)/2 × days)] × 100. |
Feed Conversion Ratio (FCR): FCR = Feed intake/Weight gain. |
Intraperitoneal Fat Ratio (IPF, %): IPF = (Intraperitoneal fat weight/Whole body weight) × 100. |
Viscerosomatic Index (VSI, %): VSI = (Visceral weight/Whole body weight) × 100. |
Hepatosomatic Index (HSI, %): HSI = (Liver weight/Whole body weight) × 100. |
Gonadosomatic Index (GSI, %): GSI = (Gonad weight/Whole body weight) × 100. |
3. Results
3.1. Growth Performance and Morphometric Indices
3.2. Whole-Body and Hepatic Nutrient Composition
3.3. Appetite-Related Gene Expression in the Brain of Mandarin Fish
3.4. Serum Components
3.5. Liver Biochemical Indicators
3.6. Liver Histology
3.7. Gene Expression in the Liver of Mandarin Fish
3.8. Hindgut Histology
3.9. Gene Expression in the Midgut of Mandarin Fish
3.10. Acute Ammonia Nitrogen Stress Response
4. Discussion
4.1. Seventy Percent of Fish Meal Replaced with PBM Has No Adverse Effect on the Growth of Mandarin Fish
4.2. Excessive Replacement Induces Hepatic Lipid Accumulation and Liver Damage in Mandarin Fish
4.3. Moderate Replacement Improves Intestinal Structure, While Excessive Replacement Impairs Intestinal Health
4.4. Excessive Replacement Weakens the Antioxidant Defense Capacity Under Ammonia Nitrogen Stress, Reduces the Survival Rate and Exacerbates Liver Damage
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, J.; Liang, X.-F.; He, S.; Li, J.; Huang, K.; Zhang, Y.-P.; Huang, D. Lipid deposition pattern and adaptive strategy in response to dietary fat in Chinese perch (Siniperca chuatsi). Nutr. Metab. 2018, 15, 77. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Liang, X.F.; He, S.; Wang, J.; Li, L.; Zhang, Z.; Li, J.; Chen, X.; Li, L.; Alam, M.S. Metabolic responses of Chinese perch (Siniperca chuatsi) to different levels of dietary carbohydrate. Fish Physiol. Biochem. 2021, 47, 1449–1465. [Google Scholar] [CrossRef] [PubMed]
- Hussain, S.M.; Khurram, F.; Naeem, A.; Hussain Shah, S.Z.; Sarker, P.K.; Naeem, E.; Arsalan, M.Z.-U.-H.; Riaz, D.; Yousaf, Z.; Faisal, M. A review on the prospects and potentials of fishmeal replacement with different animal protein sources. Int. Aquat. Res. 2024, 16, 7–16. [Google Scholar]
- Boateng, A.G.; Zhao, J.; Zhao, J.; Xu, H.; Li, H.; Zhao, M.; Xu, Q.; Liu, C.; Qin, J. Effects of Replacement of Fish Meal with Poultry By-Product Meal (PBM) on Growth Performance, Digestive Enzyme, and Immunity of Giant River Prawn (Macrobrachium rosenbergii). Aquac. Res. 2023, 2023, 7500596. [Google Scholar] [CrossRef]
- Chaklader, M.R.; Howieson, J.; Fotedar, R. Growth, hepatic health, mucosal barrier status and immunity of juvenile barramundi, Lates calcarifer fed poultry by-product meal supplemented with full-fat or defatted Hermetia illucens larval meal. Aquaculture 2021, 543, 737026. [Google Scholar] [CrossRef]
- Chaklader, M.R.; Chung, W.H.; Howieson, J.; Fotedar, R. A Mixture of Full-Fat and Defatted Hermetia illucens Larvae and Poultry By-Products as Sustainable Protein Sources Improved Fillet Quality Traits in Farmed Barramundi, Lates calcarifer. Foods 2023, 12, 362. [Google Scholar] [CrossRef] [PubMed]
- Gu, J.; Zhang, Q.; Huang, D.; Zhang, L.; Chen, X.; Wang, Y.; Liang, H.; Ren, M. Effects of partial substitution of enzymatic hydrolysate of poultry by-product meal for fishmeal on the growth performance, hepatic health, antioxidant capacity, and immunity of juvenile largemouth bass (Micropterus salmoides). Aquac. Rep. 2024, 35, 101990. [Google Scholar] [CrossRef]
- Islam, M.R.; Cho, S.H.; Kim, T. Inclusion Effect of Various Levels of Jack Mackerel Meal in Olive Flounder (Paralichthys olivaceus) Diets Substituting 50% Fish Meal with Duck By-Product Meal on Growth and Feed Utilization. Animals 2024, 14, 2184. [Google Scholar] [CrossRef]
- Marzouk, Y.; Gaber, M.M.; Ahmad, I.; Ahmed, I.; El Basuini, M.F.; Zaki, M.A.; Nour, A.-E.M.; Labib, E.M.H.; Khalil, H.S. Impacts of poultry by-product meal substituting fishmeal on growth efficiency, body composition, liver, and intestine morphology of European sea bass, Dicentrarchus labrax. Food Chem. X 2024, 23, 101569. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Luo, H.; Zheng, Y.; Wang, D.; Wang, Y.; Zhang, W.; Chen, Z.; Chen, X.; Shao, J. Effects of poultry by-product meal replacing fish meal on growth performance, feed utilization, intestinal morphology and microbiota communities in juvenile large yellow croaker (Larimichthys crocea). Aquac. Rep. 2023, 30, 101547. [Google Scholar] [CrossRef]
- Yi, C.; Huang, D.; Yu, H.; Gu, J.; Liang, H.; Ren, M. Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Largemouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth. Foods 2023, 12, 3485. [Google Scholar] [CrossRef]
- AOAC International. Official Methods of Analysis of AOAC International; AOAC International: Gaithersburg, MD, USA, 2000. [Google Scholar]
- Ma, Y.; Li, M.; Xie, D.; Chen, S.; Dong, Y.; Wang, M.; Zhang, G.; Zhang, M.; Chen, H.; Ye, R. Fishmeal can be replaced with a high proportion of terrestrial protein in the diet of the carnivorous marine teleost (Trachinotus ovatus). Aquaculture 2020, 519, 734910. [Google Scholar] [CrossRef]
- Betancor, M.; Sprague, M.; Sayanova, O.; Usher, S.; Campbell, P.; Napier, J.A.; Caballero, M.J.; Tocher, D.R. Evaluation of a high-EPA oil from transgenic Camelina sativa in feeds for Atlantic salmon (Salmo salar L.): Effects on tissue fatty acid composition, histology and gene expression. Aquaculture 2015, 444, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Wei, C.-C.; Wu, K.; Gao, Y.; Zhang, L.-H.; Li, D.-D.; Luo, Z. Magnesium reduces hepatic lipid accumulation in yellow catfish (Pelteobagrus fulvidraco) and modulates lipogenesis and lipolysis via PPARA, JAK-STAT, and AMPK pathways in hepatocytes. J. Nutr. 2017, 147, 1070–1078. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Ran, C.; Ding, Q.-w.; Liu, H.-l.; Xie, M.-x.; Yang, Y.-l.; Xie, Y.-d.; Gao, C.-c.; Zhang, H.-l.; Zhou, Z.-g. Ability of prebiotic polysaccharides to activate a HIF1α-antimicrobial peptide axis determines liver injury risk in zebrafish. Commun. Biol. 2019, 2, 274. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Sathishkumar, G.; Felix, N.; Prabu, E. Effects of dietary protein substitution of fish meal with bioprocessed poultry by-product meal on growth performances, nutrient utilization, whole-body composition and haemato-biochemical responses of GIFT tilapia reared in floating cages. Aquac. Res. 2021, 52, 5407–5418. [Google Scholar] [CrossRef]
- Chaklader, M.R.; Howieson, J.; Foysal, M.J.; Fotedar, R. Transformation of fish waste protein to Hermetia illucens protein improves the efficacy of poultry by-products in the culture of juvenile barramundi, Lates calcarifer. Sci. Total Environ. 2021, 796, 149045. [Google Scholar] [CrossRef]
- Moutinho, S.; Martínez-Llorens, S.; Tomás-Vidal, A.; Jover-Cerdá, M.; Oliva-Teles, A.; Peres, H. Meat and bone meal as partial replacement for fish meal in diets for gilthead seabream (Sparus aurata) juveniles: Growth, feed efficiency, amino acid utilization, and economic efficiency. Aquaculture 2017, 468, 271–277. [Google Scholar] [CrossRef]
- Gisbert, E.; Ortiz-Delgado, J.B.; Sarasquete, C. Nutritional cellular biomarkers in early life stages of fish. Histol. Histopathol. 2008, 23, 1525–1539. [Google Scholar]
- Hayashi, Y.; Shimamura, A.; Ishikawa, T.; Fujiwara, Y.; Ichi, I. FADS2 inhibition in essential fatty acid deficiency induces hepatic lipid accumulation via impairment of very low-density lipoprotein (VLDL) secretion. Biochem. Biophys. Res. Commun. 2018, 496, 549–555. [Google Scholar] [CrossRef] [PubMed]
- Roff, D.A. An allocation model of growth and reproduction in fish. Can. J. Fish. Aquat. Sci. 1983, 40, 1395–1404. [Google Scholar] [CrossRef]
- Najafabadi, H.J.; Moghaddam, H.N.; Pourreza, J.; Shahroudi, F.E.; Golian, A. Determination of chemical composition, mineral contents, and protein quality of poultry by-product meal. Int. J. Poult. Sci. 2007, 6, 875–882. [Google Scholar] [CrossRef]
- Payne, A.H.; Hales, D.B. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr. Rev. 2004, 25, 947–970. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.-Y.; Qi, P.-P.; Chen, M.; Yuan, Y.-C.; Shen, Z.-G.; Fan, Q.-X. Effects of sex steroid hormones on sexual size dimorphism in yellow catfish (Tachysurus fulvidraco). Acta Hydrobiol. Sin. 2020, 44, 379–388. [Google Scholar]
- Baek, S.I.; Jeong, H.S.; Cho, S.H. Replacement effect of fish meal by plant protein sources in olive flounder (Paralichthys olivaceus) feeds with an addition of jack mackerel meal on growth, feed availability, and biochemical composition. Aquac. Nutr. 2023, 2023, 7965258. [Google Scholar] [CrossRef] [PubMed]
- Assan, D.; Mustapha, U.F.; Chen, H.; Li, Z.; Peng, Y.; Li, G. The roles of neuropeptide Y (Npy) and peptide YY (Pyy) in teleost food intake: A mini review. Life 2021, 11, 547. [Google Scholar] [CrossRef]
- Liu, M.; Alimov, A.; Wang, H.; Frank, J.A.; Katz, W.; Xu, M.; Ke, Z.-J.; Luo, J. Thiamine deficiency induces anorexia by inhibiting hypothalamic AMPK. Neuroscience 2014, 267, 102–113. [Google Scholar] [CrossRef]
- Sheashea, M.; Xiao, J.; Farag, M.A. MUFA in metabolic syndrome and associated risk factors: Is MUFA the opposite side of the PUFA coin? Food Funct. 2021, 12, 12221–12234. [Google Scholar] [CrossRef] [PubMed]
- Mata-Sotres, J.A.; Marques, V.H.; Barba, D.; Braga, A.; Araújo, B.; Viana, M.T.; Rombenso, A.N. Increasing dietary SFA: MUFA ratio with low levels of LC-PUFA affected lipid metabolism, tissue fatty acid profile and growth of juvenile California Yellowtail (Seriola dorsalis). Aquaculture 2021, 543, 737011. [Google Scholar] [CrossRef]
- Coeurdacier, J.-L.; Dutto, G.; Gasset, E.; Blancheton, J.-P. Is total serum protein a good indicator for welfare in reared sea bass (Dicentrarchus labrax)? Aquat. Living Resour. 2011, 24, 121–127. [Google Scholar] [CrossRef]
- Sabatini, D.M. Twenty-five years of mTOR: Uncovering the link from nutrients to growth. Proc. Natl. Acad. Sci. USA 2017, 114, 11818–11825. [Google Scholar] [CrossRef]
- Rahman, A.N.A.; Mohamed, A.A.-R.; Dahran, N.; Farag, M.F.; Alqahtani, L.S.; Nassan, M.A.; AlThobaiti, S.A.; El-Naseery, N.I. Appraisal of sub-chronic exposure to lambada-cyhalothrin and/or methomyl on the behavior and hepato-renal functioning in Oreochromis niloticus: Supportive role of taurine-supplemented feed. Aquat. Toxicol. 2022, 250, 106257. [Google Scholar] [CrossRef] [PubMed]
- Duan, P.; Zhang, L.; Wang, J.; Li, B. The effects of new protein sources substitute fishmeal on the amino acid compositions of juvenile starry flounder (Platichthys stellatus). Oceanol. Limnol. Sin. 2011, 42, 229–236. [Google Scholar]
- Zou, Y.; Zhong, L.; Hu, C.; Zhong, M.; Peng, N.; Sheng, G. LDL/HDL cholesterol ratio is associated with new-onset NAFLD in Chinese non-obese people with normal lipids: A 5-year longitudinal cohort study. Lipids Health Dis. 2021, 20, 28. [Google Scholar] [CrossRef]
- Peng, S.; Li, W.; Hou, N.; Huang, N. A review of FoxO1-regulated metabolic diseases and related drug discoveries. Cells 2020, 9, 184. [Google Scholar] [CrossRef]
- Selvaraj, R.K.; Shanmugasundaram, R.; Klasing, K.C. Effects of dietary lutein and PUFA on PPAR and RXR isomer expression in chickens during an inflammatory response. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2010, 157, 198–203. [Google Scholar] [CrossRef]
- Wright, P.A.; Wood, C.M. A new paradigm for ammonia excretion in aquatic animals: Role of Rhesus (Rh) glycoproteins. J. Exp. Biol. 2009, 212, 2303–2312. [Google Scholar] [CrossRef] [PubMed]
- Psofakis, P.; Meziti, A.; Berillis, P.; Mente, E.; Kormas, K.A.; Karapanagiotidis, I.T. Effects of dietary fishmeal replacement by poultry by-product meal and hydrolyzed feather meal on liver and intestinal histomorphology and on intestinal microbiota of gilthead seabream (Sparus aurata). Appl. Sci. 2021, 11, 8806. [Google Scholar] [CrossRef]
- Keramat Amirkolaie, A.; Shahsavari, M.; Hedayatyfard, M. Full replacement of fishmeal by poultry by–product meal in rainbow trout, Oncorhynchus mykiss (Walbaum, 1972) diet. Iran. J. Fish. Sci. 2014, 13, 1069–1081. [Google Scholar]
- Aydin, B.; GÜMÜŞ, E.; BALCI, B. Effect of dietary fish meal replacement by poultry by-product meal on muscle fatty acid composition and liver histology of fry of Nile tilapia, Oreochromis niloticus (Actinopterygii: Perciformes: Cichlidae). Acta Ichthyol. Pisc. 2015, 45, 343–351. [Google Scholar] [CrossRef]
- Xu, S.; Chen, T.; Dong, L.; Li, T.; Xue, H.; Gao, B.; Ding, X.; Wang, H.; Li, H. Fatty acid synthase promotes breast cancer metastasis by mediating changes in fatty acid metabolism. Oncol. Lett. 2021, 21, 27. [Google Scholar] [CrossRef]
- Althaher, A.R. An Overview of Hormone-Sensitive Lipase (HSL). Sci. World J. 2022, 2022, 1964684. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Chen, L.; Li, L.; Qi, Y.; Tong, H.; Wu, H.; Xu, J.; Leng, L.; Cheema, S.; Sun, G. Downregulation of adipose LPL by PAR2 contributes to the development of hypertriglyceridemia. JCI Insight 2024, 9, e173240. [Google Scholar] [CrossRef]
- Ngo, J.; Choi, D.W.; Stanley, I.A.; Stiles, L.; Molina, A.J.; Chen, P.H.; Lako, A.; Sung, I.C.H.; Goswami, R.; Kim, M. Mitochondrial morphology controls fatty acid utilization by changing CPT1 sensitivity to malonyl-CoA. EMBO J. 2023, 42, e111901. [Google Scholar] [CrossRef]
- Xu, J.; Li, X.; Yao, X.; Xie, S.; Chi, S.; Zhang, S.; Cao, J.; Tan, B. Protective effects of bile acids against hepatic lipid accumulation in hybrid grouper fed a high-lipid diet. Front. Nutr. 2022, 9, 813249. [Google Scholar] [CrossRef]
- Okada, L.S.d.R.R.; Oliveira, C.P.; Stefano, J.T.; Nogueira, M.A.; da Silva, I.D.C.G.; Cordeiro, F.B.; Alves, V.A.F.; Torrinhas, R.S.; Carrilho, F.J.; Puri, P. Omega-3 PUFA modulate lipogenesis, ER stress, and mitochondrial dysfunction markers in NASH–proteomic and lipidomic insight. Clin. Nutr. 2018, 37, 1474–1484. [Google Scholar] [CrossRef]
- Malik, A.N.; Simões, I.C.; Rosa, H.S.; Khan, S.; Karkucinska-Wieckowska, A.; Wieckowski, M.R. A diet induced maladaptive increase in hepatic mitochondrial DNA precedes OXPHOS defects and may contribute to non-alcoholic fatty liver disease. Cells 2019, 8, 1222. [Google Scholar] [CrossRef]
- Tsikas, D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef] [PubMed]
- Chang, E.; Zhang, X.; Xu, J.; Wu, Y.; Guo, X.; Fu, L.; Xing, X.; Dong, X.; Wang, A.; Miao, S. Effects of Replacement of Fish Meal by Chicken Meal Combined with Egg Meal on Growth, Digestive Ability and Antioxidant Capacity of Eriocheir sinensis. Chin. J. Anim. Nutr. 2024, 36, 6631–6642. (In Chinese) [Google Scholar]
- Wu, J.; Liao, R.; Kuang, W.; Sun, H.; Chen, Y.; Tan, B.; Lin, S. Effects of replacing fish meal with domestic poultry by-product meal on growth, liver health and intestinal barrier of Micropterus salmoides. J. Fish. China 2023, 47, 109605. [Google Scholar]
- Linh, N.V.; Lubis, A.R.; Dinh-Hung, N.; Wannavijit, S.; Montha, N.; Fontana, C.M.; Lengkidworraphiphat, P.; Srinual, O.; Jung, W.-K.; Paolucci, M. Effects of shrimp shell-derived chitosan on growth, immunity, intestinal morphology, and gene expression of nile tilapia (Oreochromis niloticus) reared in a biofloc system. Mar. Drugs 2024, 22, 150. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.-z.; Jiang, W.-d.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.-y.; Tang, L.; Zhang, Y.-a.; Zhou, X.-q.; Feng, L. Gossypol reduced the intestinal amino acid absorption capacity of young grass carp (Ctenopharyngodon idella). Aquaculture 2018, 492, 46–58. [Google Scholar] [CrossRef]
- Calder, P.C. Omega-3 polyunsaturated fatty acids and inflammatory processes: Nutrition or pharmacology? Br. J. Clin. Pharmacol. 2013, 75, 645–662. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Castejon, G.; Brough, D. Understanding the mechanism of IL-1β secretion. Cytokine Growth Factor Rev. 2011, 22, 189–195. [Google Scholar] [CrossRef] [PubMed]
- Atreya, I.; Atreya, R.; Neurath, M. NF-κB in inflammatory bowel disease. J. Intern. Med. 2008, 263, 591–596. [Google Scholar] [CrossRef] [PubMed]
- Geay, F.; Mellery, J.; Tinti, E.; Douxfils, J.; Larondelle, Y.; Mandiki, S.; Kestemont, P. Effects of dietary linseed oil on innate immune system of Eurasian perch and disease resistance after exposure to Aeromonas salmonicida achromogen. Fish Shellfish Immunol. 2015, 47, 782–796. [Google Scholar] [CrossRef]
- Rocha, D.; Caldas, A.; Oliveira, L.; Bressan, J.; Hermsdorff, H. Saturated fatty acids trigger TLR4-mediated inflammatory response. Atherosclerosis 2016, 244, 211–215. [Google Scholar] [CrossRef]
- Caplan, M.S.; Russell, T.; Xiao, Y.; Amer, M.; Kaup, S.; Jilling, T. Effect of polyunsaturated fatty acid (PUFA) supplementation on intestinal inflammation and necrotizing enterocolitis (NEC) in a neonatal rat model. Pediatr. Res. 2001, 49, 647–652. [Google Scholar] [CrossRef] [PubMed]
- Yoshimura, A.; Mori, H.; Ohishi, M.; Aki, D.; Hanada, T. Negative regulation of cytokine signaling influences inflammation. Curr. Opin. Immunol. 2003, 15, 704–708. [Google Scholar] [CrossRef]
- Dai, C.; Zheng, J.; Qi, L.; Deng, P.; Wu, M.; Li, L.; Yuan, J. Chronic stress boosts systemic inflammation and compromises antiviral innate immunity in Carassius gibel. Front. Immunol. 2023, 14, 1105156. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.; Wang, C.; Sun, Y.; Chen, Y.; Chen, S.; Han, T.; Wang, J. Excessive Substitution of Fish Meal with Fermented Soybean Meal Induces Oxidative Stress by Impairing Glutathione Metabolism in Largemouth Bass (Micropterus salmoides). Antioxidants 2023, 12, 2096. [Google Scholar] [CrossRef]
- Carletto, D.; Furtado, F.; Zhang, J.; Asimakopoulos, A.G.; Eggen, M.; Verstege, G.C.; Faggio, C.; Mota, V.C.; Lazado, C.C. Mode of application of peracetic acid-based disinfectants has a minimal influence on the antioxidant defences and mucosal structures of atlantic salmon (Salmo salar) parr. Front. Physiol. 2022, 13, 900593. [Google Scholar] [CrossRef] [PubMed]
- Xu, Z.; Cao, J.; Qin, X.; Qiu, W.; Mei, J.; Xie, J. Toxic effects on bioaccumulation, hematological parameters, oxidative stress, immune responses and tissue structure in fish exposed to ammonia nitrogen: A review. Animals 2021, 11, 3304. [Google Scholar] [CrossRef]
- Wang, Y.; Branicky, R.; Noë, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef]
- Halliwell, B.; Gutteridge, J.M. Free Radicals in Biology and Medicine; Oxford University Press: New York, NY, USA, 2015. [Google Scholar]
- Egnew, N.; Renukdas, N.; Ramena, Y.; Yadav, A.K.; Kelly, A.M.; Lochmann, R.T.; Sinha, A.K. Physiological insights into largemouth bass (Micropterus salmoides) survival during long-term exposure to high environmental ammonia. Aquat. Toxicol. 2019, 207, 72–82. [Google Scholar] [CrossRef] [PubMed]
Ingredients (g kg−1 Diet) | PF0 | PF17.5 | PF35.0 | PF52.5 | PF70.0 |
---|---|---|---|---|---|
Steam-dried fish meal 1 | 500.0 | 412.5 | 325.0 | 237.5 | 150.0 |
Vietnamese pansa fish meal | 80 | 80 | 80 | 80 | 80 |
Poultry by-product meal 2 | 105 | 195 | 285 | 375.1 | 465.1 |
Spray-dried porcine blood cell protein powder | 30 | 30 | 30 | 30 | 30 |
Antarctic krill powder | 20 | 20 | 20 | 20 | 20 |
Cottonseed protein | 60 | 60 | 60 | 60 | 60 |
Cassava starch 3 | 100 | 100.4 | 100.8 | 101.2 | 101.6 |
Soybean oil | 50 | 41.6 | 33.1 | 24.7 | 16.2 |
Monocalcium phosphate | 15 | 15 | 15 | 15 | 15 |
Microcrystalline cellulose | 0 | 5.5 | 11.1 | 16.5 | 22.1 |
Sodium chloride | 1 | 1 | 1 | 1 | 1 |
Choline chloride (60%) | 4 | 4 | 4 | 4 | 4 |
Ethoxyquin | 0.1 | 0.1 | 0.1 | 0.1 | 0.1 |
Propionic acid (50%) | 0.7 | 0.7 | 0.7 | 0.7 | 0.7 |
Vitamin premix 4 | 20 | 20 | 20 | 20 | 20 |
Trace element premix 4 | 3.6 | 3.6 | 3.6 | 3.6 | 3.6 |
Rice hull powder | 10.6 | 8.8 | 7.1 | 5.5 | 3.8 |
Lysine | 0 | 1.2 | 2.4 | 3.5 | 4.7 |
Methionine | 0 | 0.5 | 0.9 | 1.4 | 1.8 |
Threonine | 0 | 0.1 | 0.2 | 0.2 | 0.3 |
Total | 1000.0 | 1000.0 | 1000.0 | 1000.0 | 1000.0 |
Nutritional levels | |||||
Crude protein (%) | 55.84 | 55.53 | 55.59 | 55.07 | 55.10 |
Crude lipid (%) | 12.50 | 12.45 | 12.32 | 12.23 | 12.11 |
Starch (%) | 9.56 | 9.38 | 9.82 | 9.52 | 9.90 |
Fatty Acid | PF0 | PF17.5 | PF35.0 | PF52.5 | PF70.0 |
---|---|---|---|---|---|
C18:1n-9 | 24.1 | 25.7 | 28 | 29.6 | 32.6 |
C18:2n-6 | 28.9 | 29.3 | 26.4 | 24.4 | 22.4 |
C18:3n-3 | 3.38 | 3.32 | 2.76 | 2.39 | 1.88 |
C18:3n-6 | 0.101 | 0.1 | 0.128 | 0.142 | 0.164 |
C20:4n-6 | 0.34 | 0.322 | 0.338 | 0.345 | 0.347 |
C20:5n-3 | 3.49 | 2.82 | 2.33 | 2 | 1.22 |
C22:6n-3 | 3.26 | 2.6 | 2.06 | 1.76 | 1.03 |
Others | 6.3 | 5.51 | 5.13 | 4.75 | 4.01 |
ΣSFAs 1 | 25.764 | 25.883 | 27.754 | 28.973 | 30.463 |
ΣMUFAs 2 | 28.216 | 29.869 | 32.768 | 34.759 | 38.201 |
ΣPUFAs 3 | 39.735 | 38.735 | 34.338 | 31.386 | 27.422 |
ΣC18 4 | 61.331 | 63.36 | 62.548 | 62.002 | 62.864 |
Σn-3 5 | 10.13 | 8.74 | 7.15 | 6.15 | 4.13 |
Σn-6 6 | 29.448 | 29.838 | 27.004 | 25.038 | 23.085 |
Σn-3 HUFAs 7 | 10.13 | 8.74 | 7.15 | 6.15 | 4.13 |
Σn-6 HUFA 8 | 0.548 | 0.538 | 0.604 | 0.638 | 0.685 |
ΣEFAs 9 | 39.03 | 38.04 | 33.55 | 30.55 | 26.53 |
Gene | Forward (F) | Reverse (R) | Genbank Codes |
---|---|---|---|
rpl13a | CACCCTATGACAAGAGGAAGC | TGTGCCAGACGCCCAAG | XM_044166826.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044166826.1 (accessed on 2 February 2025) |
npy | GTTGAAGGAAAGCACAGACA | GCTCATAGAGGTAAAAGGGG | XM_044172804.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044172804.1 (accessed on 2 February 2025) |
pomc | GTGTCATCCTCGTTACTGC | GCGACGCTCCTATTCAAT | XM_044168860.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044168860.1 (accessed on 2 February 2025) |
mtor | GCATCAACGAGAGCACCA | CGCTTCAAAATTCATAACCG | XM_044211706.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044211706.1 (accessed on 2 February 2025) |
s6k | CCTTCAAACCTTTCCTGCAATC | ATTTAACTGGGCTGAGAGGTG | XM_044166943.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044166943.1 (accessed on 2 February 2025) |
ampk | GGGATGCAAACCAAGATG | ACAGACCCAGAGCGGAGA | XM_044175461.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044175461.1 (accessed on 2 February 2025) |
atk | TGAATTCCTGTCCAGGTAACCAC | TTCACTCAGCCCTGTGAAGG | XM_044165539.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044165539.1 (accessed on 2 February 2025) |
foxo1 | AAAGCTCCTGGTGGATGCTG | TCTTTGTGGCCCTTCCTCTG | XM_044223788.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044223788.1 (accessed on 2 February 2025) |
srebp1 | CTCCCTCCTTTCTGTCGGCTC | TCATTTGCTGGCAGTCGTGG | XM_044180668.1 https://www.ncbi.nlm.nih.gov/nuccore/XM_044180668.1 (accessed on 2 February 2025) |
fas | ATGGAAATCACCCCTGTAATCTT | CTTATCTGACTACGGAATGAATCG | XM_044177556.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044177556.1 (accessed on 2 February 2025) |
acc1 | TATGCCCACTTACCCAAATGC | TGCCACCATACCAATCTCGTT | XM_044221959.1 https://www.ncbi.nlm.nih.gov/nuccore/XM_044221959.1 (accessed on 2 February 2025) |
ppar-α | GGGTGTGCTCAGACAAGGCT | GTTGCGGTTCTTCTTTTGGAT | XM_044194385.1 https://www.ncbi.nlm.nih.gov/nuccore/XM_044194385.1 (accessed on 2 February 2025) |
cpt1 | ATGGTGTATTGGCTGGAGTCT | CTGTGTGGTAGGTTTTCCTTGAT | XM_044192900.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044192900.1 (accessed on 2 February 2025) |
hsl | ACAAACGCCTGGGAATGGT | TGTGGTCCGCCCTGAAGAA | XM_044208783.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044208783.1 (accessed on 2 February 2025) |
lpl | TTACCCCAATGGAGGCACTT | CGGACCTTGTTGATGTTGTAG | XM_044199514.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044199514.1 (accessed on 2 February 2025) |
il-1β | TGACTGACAGCAAGAAGAGG | TTGTGGCAAGACAGGTAGAG | XM_044173729.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044173729.1 (accessed on 2 February 2025) |
tnf-α | GAACGATGACGCCAAGA | AGGGCAAACACACCAAA | XM_044208266.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044208266.1 (accessed on 2 February 2025) |
p65 | ACCACTAAGACCCACCCA | CAAACTCCTCCTCCCACA | XM_044184929.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044184929.1 (accessed on 2 February 2025) |
occludin | AGATTGCTGGTCTGTGTG | ATAGTTGGTGCTTTCGTC | XM_044199086.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044199086.1 (accessed on 2 February 2025) |
zo-1 | GGATAGTGGAATCGGACG | TGTTTTGGGGAGGGTGTA | XM_044201318.1 https://www.ncbi.nlm.nih.gov/nucleotide/XM_044201318.1 (accessed on 2 February 2025) |
Items | PF0 | PF17.5 | PF35.0 | PF52.5 | PF70.0 |
---|---|---|---|---|---|
IBW (g) | 33.57 ± 0.28 | 33.54 ± 0.04 | 33.22 ± 0.08 | 33.44 ± 0.24 | 33.61 ± 0.13 |
FBW (g) | 138.63 ± 5.31 | 141.79 ± 5.56 | 132.89 ± 2.20 | 134.6 ± 1.60 | 138.83 ± 3.36 |
WGR (%) | 312.84 ± 13.48 | 322.73 ± 16.89 | 300.02 ± 7.13 | 302.52 ± 6.65 | 313.01 ± 8.82 |
SR (%) | 96.56 ± 0.44 | 97.00 ± 1.02 | 98.00 ± 0.19 | 97.78 ± 0.29 | 98.00 ± 0.19 |
SGR (%) | 2.83 ± 0.07 | 2.88 ± 0.08 | 2.77 ± 0.03 | 2.79 ± 0.03 | 2.84 ± 0.04 |
FR (%) | 2.70 ± 0.05 ab | 2.78 ± 0.09 b | 2.79 ± 0.05 b | 2.71 ± 0.05 ab | 2.58 ± 0.03 a |
FCR (%) | 1.14 ± 0.04 | 1.16 ± 0.07 | 1.16 ± 0.03 | 1.15 ± 0.03 | 1.07 ± 0.02 |
VSI (%) | 7.95 ± 0.48 ab | 8.36 ± 0.16 bc | 7.73 ± 0.14 ab | 7.29 ± 0.14 a | 8.98 ± 0.18 c |
HSI (%) | 1.21 ± 0.05 a | 1.55 ± 0.03 c | 1.27 ± 0.03 a | 1.33 ± 0.04 ab | 1.44 ± 0.01 bc |
IPF (%) | 0.78 ± 0.07 | 0.84 ± 0.09 | 0.80 ± 0.09 | 0.79 ± 0.07 | 0.80 ± 0.08 |
GSI (%) | 1.14 ± 0.13 a | 1.23 ± 0.09 a | 1.03 ± 0.11 a | 0.95 ± 0.07 a | 2.27 ± 0.12 b |
Items | PF0 | PF17.5 | PF35.0 | PF52.5 | PF70.0 |
---|---|---|---|---|---|
Whole fish | |||||
Moisture (%) | 74.89 ± 0.51 | 73.78 ± 0.07 | 74.74 ± 0.62 | 74.15 ± 0.50 | 74.7 ± 0.62 |
Crude protein (%) | 16.85 ± 0.14 a | 17.15 ± 0.18 ab | 17.45 ± 0.05 b | 17.53 ± 0.06 b | 16.98 ± 0.19 a |
Crude lipid (%) | 1.29 ± 0.02 a | 1.65 ± 0.12 ab | 1.54 ± 0.17 ab | 1.37 ± 0.06 a | 1.82 ± 0.20 b |
Liver | |||||
Moisture (%) | 69.54 ± 0.13 b | 69.92 ± 0.25 b | 70.95 ± 0.10 c | 70.85 ± 0.11 c | 68.01 ± 0.38 a |
Crude protein (%) | 14.17 ± 0.25 b | 14.38 ± 0.37 b | 14.53 ± 0.03 b | 14.45 ± 0.22 b | 12.70 ± 0.27 a |
Crude lipid (%) | 3.8 ± 0.05 a | 4.64 ± 0.28 ab | 5.28 ± 0.56 b | 4.81 ± 0.29 ab | 8.68 ± 0.33 c |
Items | PF0 | PF17.5 | PF35.0 | PF52.5 | PF70.0 |
---|---|---|---|---|---|
TP (g/L) | 26.98 ± 0.82 a | 35.10 ± 2.97 b | 34.82 ± 2.81 b | 40.92 ± 0.71 bc | 46.23 ± 0.54 c |
T-AOC (mmol/L) | 0.34 ± 0.002 a | 0.42 ± 0.001 b | 0.46 ± 0.003 c | 0.59 ± 0.002 d | 0.66 ± 0.001 e |
TG (mmol/L) | 2.09 ± 0.04 c | 1.75 ± 0.18 b | 1.16 ± 0.07 a | 1.61 ± 0.05 b | 2.75 ± 0.09 d |
CHO (mmol/L) | 2.32 ± 0.12 ab | 2.45 ± 0.14 b | 1.92 ± 0.17 a | 3.46 ± 0.04 c | 4.51 ± 0.21 d |
HDL (mmol/L) | 1.20 ± 0.05 c | 1.10 ± 0.06 bc | 1.01 ± 0.06 ab | 1.25 ± 0.02 c | 0.87 ± 0.04 a |
LDL (mmol/L) | 0.82 ± 0.05 a | 1.24 ± 0.16 b | 0.81 ± 0.07 a | 2.20 ± 0.16 c | 3.31 ± 0.13 d |
HDL/LDL value | 1.47 ± 0.04 d | 1.17 ± 0.04 c | 1.26 ± 0.09 c | 0.57 ± 0.04 b | 0.26 ± 0.02 a |
ALT (U/L) | 5.82 ± 0.58 a | 7.08 ± 0.53 a | 5.83 ± 0.39 a | 9.14 ± 0.08 b | 11.74 ± 0.72 c |
AST (U/L) | 31.19 ± 0.80 a | 33.87 ± 2.47 ab | 30.59 ± 4.25 a | 31.39 ± 0.91 a | 40.69 ± 0.89 b |
Items | PF0 | PF17.5 | PF35.0 | PF52.5 | PF70.0 |
---|---|---|---|---|---|
GPX (U/mg prot) | 118.49 ± 8.46 a | 181.81 ± 6.55 c | 150.3 ± 7.21 b | 157.48 ± 6.57 b | 171.44 ± 5.21 bc |
SOD (U/mg prot) | 288.03 ± 12.78 a | 367.27 ± 15.22 b | 339.92 ± 17.64 b | 351.22 ± 20.02 b | 348.07 ± 12.86 b |
CAT (U/mg prot) | 2.34 ± 0.17 a | 3.01 ± 0.12 b | 2.54 ± 0.23 ab | 2.41 ± 0.25 ab | 3.03 ± 0.08 b |
MDA (nmol/mg prot) | 0.064 ± 0.007 b | 0.068 ± 0.004 b | 0.063 ± 0.002 b | 0.065 ± 0.003 b | 0.049 ± 0.005 a |
ALT (U/g prot) | 23.82 ± 0.97 a | 23.14 ± 0.62 a | 22.51 ± 1.74 a | 38.57 ± 1.05 c | 32.84 ± 1.36 b |
AST (U/g prot) | 86.4 ± 7.42 b | 71.65 ± 3.21 a | 81.63 ± 1.55 a | 107.76 ± 3.76 c | 71.79 ± 1.26 ab |
AST/ALT value | 3.53 ± 0.53 c | 3.29 ± 0.16 bc | 4.10 ± 0.16 c | 2.47 ± 0.30 ab | 2.17 ± 0.11 a |
Items | PF0 | PF17.5 | PF35.0 | PF52.5 | PF70.0 |
---|---|---|---|---|---|
Muscularis Thickness (µm) | 107.19 ± 6.54 b | 161.53 ± 11.32 c | 153.88 ± 5.63 c | 84.17 ± 3.11 a | 85.07 ± 6.69 a |
Villus Number | 34.71 ± 1.08 a | 39.80 ± 1.07 b | 45.00 ± 1.95 c | 34.29 ± 1.29 a | 36.00 ± 1.00 ab |
Villus Height (µm) | 702.05 ± 24.86 bc | 773.97 ± 27.57 c | 891.1 ± 27.33 d | 593.84 ± 23.12 a | 674.66 ± 24.62 b |
Items | PF0 | PF17.5 | PF35.0 | PF52.5 | PF70.0 |
---|---|---|---|---|---|
SR (%) | 97.22 ± 2.78 c | 97.22 ± 2.78 c | 91.67 ± 4.81 c | 44.44 ± 5.56 b | 13.89 ± 2.78 a |
Serum | |||||
MDA (mmol/L) | 6.57 ± 0.60 | 6.24 ± 0.28 | 6.89 ± 0.39 | 6.78 ± 0.19 | 6.89 ± 0.39 |
CAT (U/L) | 781.21 ± 43.31 b | 526.92 ± 33.5 a | 557.32 ± 60.38 a | 545.72 ± 68.54 a | 629.74 ± 49.22 ab |
GPx (U/L) | 255.94 ± 23.93 c | 134.24 ± 9.01 ab | 100.69 ± 17.29 a | 135.06 ± 6.76 ab | 163.08 ± 21.00 b |
SOD (U/L) | 2303.3 ± 82.03 a | 2614.89 ± 193.72 ab | 2571.19 ± 189.48 ab | 2898.86 ± 294.85 ab | 3013.81 ± 195.8 b |
ALT (U/L) | 31.00 ± 4.74 a | 41.76 ± 5.88 ab | 63.26 ± 9.36 bc | 65.05 ± 10.18 bc | 87.46 ± 11.44 c |
AST (U/L) | 31.33 ± 0.89 a | 34.41 ± 2.36 a | 44.19 ± 1.36 ab | 51.9 ± 4.40 b | 91 ± 10.44 c |
Gill | |||||
Na+/K+ ATPase (U/g) | 23.41 ± 7.30 a | 47.47 ± 8.87 b | 36.42 ± 5.48 ab | 53.73 ± 4.72 b | 133.63 ± 7.61 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, S.; Ma, H.; Hua, X.; Wang, L.; Yun, B.; Zhu, X.; Qian, X. Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi. Fishes 2025, 10, 78. https://doi.org/10.3390/fishes10020078
Tang S, Ma H, Hua X, Wang L, Yun B, Zhu X, Qian X. Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi. Fishes. 2025; 10(2):78. https://doi.org/10.3390/fishes10020078
Chicago/Turabian StyleTang, Shulin, Huanchao Ma, Xueming Hua, Lei Wang, Biao Yun, Xuan Zhu, and Xueqiao Qian. 2025. "Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi" Fishes 10, no. 2: 78. https://doi.org/10.3390/fishes10020078
APA StyleTang, S., Ma, H., Hua, X., Wang, L., Yun, B., Zhu, X., & Qian, X. (2025). Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi. Fishes, 10(2), 78. https://doi.org/10.3390/fishes10020078