Next Article in Journal
Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi
Previous Article in Journal
Effects of Chicken By-Product Meal as a Fish Meal Replacer in Diets With or Without Jack Mackerel Meal Inclusion: Growth and Feed Availability for Rockfish (Sebastes schlegeli)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator

1
Zhejiang Provincial Key Laboratory of Aquatic Resources Conservation and Development, Key Laboratory of Aquatic Animal Genetic Breeding and Nutrition, CAFS, College of Life Sciences, Huzhou University, Huzhou 313000, China
2
Jiangsu Province Engineering Research Center for Marine Bio-resources Sustainable Utilization, College of Oceanography, Hohai University, Nanjing 210024, China
3
Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Meishan Campus, Ningbo University, Ningbo 315832, China
4
School of Chemistry & Chemical Engineering, Zhoukou Normal University, Zhoukou 466001, China
*
Author to whom correspondence should be addressed.
Fishes 2025, 10(2), 77; https://doi.org/10.3390/fishes10020077
Submission received: 21 December 2024 / Revised: 9 February 2025 / Accepted: 11 February 2025 / Published: 15 February 2025
(This article belongs to the Section Nutrition and Feeding)

Abstract

Spring viremia of carp virus (SVCV) is a significant pathogen that has notably hindered the advancement of cyprinid aquaculture in recent years. Infections caused by SVCV are often associated with substantial economic losses due to the absence of effective treatment options. Previous reports indicated that N-(4-methyl-2-oxo-2H-chromen-7-yl) benzenesulfonamide (N6) exhibits inhibitory effects on SVCV proliferation. This study aims to comprehensively evaluate the anti-SVCV effects of N6 using healthy young carp as the experimental model. The research investigates the antiviral activity of this compound in vivo, the immune response of interferon (IFN)-related genes, its impact on the horizontal transmission of SVCV, and histopathological changes. The results indicate that N6 significantly inhibits SVCV infectivity and apoptosis in EPC cells in vitro. Furthermore, while N6 reduced horizontal transmission of SVCV in a static cohabitation challenge model, the N6-treated SVCV-infected group showed a nearly 3-fold decrease in viral load compared to the control group, it did not completely prevent transmission at established antiviral dosages. Histopathological analysis of the affected fish revealed that N6 effectively mitigated tissue damage induced by SVCV. Additionally, the up-regulation of six IFN-related genes suggests that N6 may indirectly activate IFNs to facilitate the clearance of SVCV in the kidney and spleen, as demonstrated by quantitative reverse transcription polymerase chain reaction (qRT-PCR). These findings provide a foundation for further investigations into the mechanisms by which N6 acts against SVCV and may aid in the development of novel anti-SVCV therapeutics.
Key Contribution: (1) N6 can effectively reduce the horizontal spread of SVCV. (2) N6 interfering with SVCV infection in common carp is attributed to enhancement of the IFN response. (3) HE staining showed that N6 may be able to attenuate symptoms in SVCV-infected fish.

1. Introduction

In 2022, world aquaculture production achieved a record high of 130.9 million tonnes, representing a 6.6 percent increase from 2020. This total includes 94.4 million tonnes of aquatic animals, with Asia contributing 91.4 percent to the overall production volume [1]. Notably, for the first time in history, the aquaculture production of animal species (51 percent) surpassed that of capture fisheries [1]. Despite these advancements, the aquaculture sector now faces significant challenges due to infectious diseases. Pathogens, including bacteria [2], viruses [3], and parasites [4], adversely impact the health of farmed aquatic animals, leading to substantial economic repercussions.
Spring viremia of carp (SVC) is an infectious disease that poses a significant threat to carp species, attributed to the spring viremia of carp virus (SVCV). Given its highly infectious nature in naïve susceptible fish populations, it generally affects juvenile fishes with a mortality rate of up to 90% [5]. SVCV is classified among the top ten notifiable fish pathogens by the World Organization for Animal Health [6]. Outbreaks have been documented in both wild and farmed fish across various life stages, although juveniles of less than one year of age exhibit greater susceptibility [7,8]. Clinical signs observed in affected fish include slow swimming and diminished excitability, whereas pathological manifestations encompass internal hemorrhage, peritonitis, and visceral hemorrhage spots [9]. Notably, common carp and koi are recognized as the species most prone to SVCV infections, experiencing the highest mortality rates [10]. Therefore, it is imperative to develop effective antiviral strategies to mitigate SVCV outbreaks.
Natural products represent a significant reservoir for drug discovery [11]. Since ancient times, numerous herbs have been utilized for the prevention and treatment of viral infections, leading to extensive studies on their active antiviral constituents [12,13]. Consequently, the exploration of natural products to identify drug candidates that bolster immunity and inhibit viral activity is a promising area of research. Phenylpropanoid compounds, which are among the principal phenolic acids found in plants, exhibit a range of biological activities, including antioxidant, antimicrobial, and antiviral properties [14,15,16]. Tubulin binding, reverse transcriptase inhibition, integrase inhibition, and topoisomerase inhibition are included as the reported mechanisms of antiviral activities [17]. Given the challenges associated with the complete chemical synthesis of phenylpropanoids, chemically modified phenylpropanoids are poised to play a crucial role in the development of new pharmaceuticals due to their practicality, high efficiency, and cost-effectiveness. By analyzing the action characteristics of various substituents, researchers can refine the design of more rational and effective compounds [18].
In previous studies, a series of phenylpropanoid derivatives were synthesized through chemical modification [19,20,21,22,23], demonstrating significant antiviral activity in preliminary in vitro screening. Among them, N6 (N-(4-methyl-2-oxo-2H-chromen-7-yl) benzenesulfonamide) was more prominent, with an in vitro viral inhibition rate of more than 90%. Aquaculture environments present unique challenges, as pathogens, including SVCV, are transmitted via water, which is transparent to light. In the current study, we demonstrate that N6 effectively inhibits both SVCV infection and horizontal transmission, exhibiting a prolonged inhibitory half-life in aquaculture settings. Additionally, we provide initial evidence that N6 may stimulate an innate immune response in the common carp host. The findings presented herein offer valuable insights for the potential application of N6 in the aquaculture industry.

2. Materials and Methods

2.1. Fish, Cells, and Virus

A total of 800 common carp were obtained from Anying Aquatic Breeding Center (Ankang, China). The fish, with a mean body weight of 3.56 ± 0.23 g and a length of 5.15 ± 0.38 cm, were meticulously screened and maintained in a static water aquaculture system at 18 °C. A subset of the fish was randomly selected for virus-free examination according to the protocol outlined by Koutná et al. (2003) [24].
EPC cells were obtained from the Laboratory of Biochemistry and Molecular Biology, School of Marine Sciences, Ningbo University (Ningbo, China), and maintained in Medium 199 (Hyclone, Logan, UT, USA) containing 10% fetal bovine serum (FBS; Every Green, Hangzhou, China) (M199-10), penicillin (100 IU/mL), and streptomycin (0.1 mg/mL). The SVCV strain (0504) was isolated from common carp [25] and kindly provided by Doc Lei Liu (State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-products, Ningbo University, Ningbo, China).

2.2. In Vitro Inhibition

EPC cells were seeded at 1 × 10^5 cells/well in six-well plates. EPC cells were incubated with SVCV (10^4 × TCID50/mL) and 25 mg/L N6 at 25 °C for 24 h and 48 h. After incubation, apoptosis was assessed using flow cytometry with Annexin V/Propidium iodide (PI) staining (Beyotime, Haimen, China), according to the manufacturer’s instructions. Annexin V is a Ca2+-dependent phospholipid binding protein with a molecular weight of 35–36 kD that binds to phosphatidylserine (PS) with high affinity. Apoptosis was detected by flow cytometry or fluorescence microscopy using Annexin V labeled with fluorescein (FITC, Alexa Fluor488, etc.) as a probe. Propidine iodide (PI) is a nucleic acid dye that cannot penetrate intact cell membranes, but in late apoptotic and necrotic cells, PI can penetrate the cell membrane and stain the nucleus red. Annexin V in combination with PI can therefore be used to detect early and late apoptotic cells in a cell population. Fluorescence intensity was measured with a MACSQuant 10 Analyzer, and at least 20,000 cells were counted per treatment.

2.3. Horizontal Transmission

Common carp were intraperitoneally injected with 10^4 × TCID50/mL SVCV (donor fish) or M199 (mock) and maintained in a flow-through system. After 24 h infection, three donor fish were transferred into each challenge container (quiet UV-sterilized water) or injected with 50 μg/mL N6 (0.2% DMSO). The recipient fish were treated with 50 μg/mL N6 for injection (0.2% DMSO) in each challenge container. Following 72 h of cohabitation (housing infected fish with un-infected fish), the sampled fish were euthanized in the laboratory through washrag soaked with MS-222 (tricaine methanesulfonate) (Sigma, Ronkonkoma, NY, USA) and frozen at −80 °C. The expression of SVCV N protein was detected by RT-qPCR analysis.

2.4. In Vivo Inhibition

Common carp were randomly selected and placed into four aquaria containing UV-sterilized water at 15 °C. Fish were intraperitoneally injected with 20 μL of 10^4 × TCID50/mL SVCV. After 12 h, infected fish were treated with 50 mg/L N6 via intraperitoneal injection to evaluate the viral load [18]. Three fish from each treatment group were sampled at 24, 48, and 96 h post-treatment and frozen at –80 °C for RNA and protein extraction. Static water with aeration was used during exposure, and fish were euthanized using 40 μg/mL MS-222. Kidney and spleen tissues were immediately frozen in liquid nitrogen for RNA isolation.

2.5. RNA Extraction

Total RNA was extracted and purified using TRIzol (Solarbio). The fish actin gene was used as an internal control. RT-qPCR was performed on a StepOne Real-Time PCR System (Applied Biosystems; Foster, CA, USA) in a 15 μL reaction volume. Primers used in the experiment are listed in Table 1.

2.6. Histopathology

On days 4 and 7 after infection with the virus and drug treatment, spleens and kidneys were taken from fish in each group and fixed in 4% paraformaldehyde, and tissue slices were stained and observed with reference to the previous article [20].

2.7. High-Performance Liquid Chromatography (HPLC)

N6 was analyzed using high-performance liquid chromatography (HPLC) with a gradient elution of acetonitrile and water, at a flow rate of 1 mL/min. UV detection was performed at 254 nm, with an injection volume of 20 μL and column temperature set to 25 °C.

2.8. Statistical Analysis

Relative mRNA expressions were calculated using the 2−△△Ct method, with △△Ct = (Ct, target gene − Ct, reference gene) − (Ct, target gene − Ct, reference gene) as control [26]. Statistical analysis was performed using two-tailed Student’s t-tests, with p < 0.05 considered significant (single asterisk) and p < 0.01 considered highly significant (double asterisks). Statistical analysis was performed with SPSS 24.0 (IBM, New York, NY, USA) using one-way ANOVA. For biochemical analyses in virus copy numbers and immune gene expression, statistical comparisons on the measured variables among treatments were investigated by Tukey’s post hoc test. The level of p < 0.05 was considered significant and all values expressed as mean ± standard error (SD).

3. Results

3.1. Anti-Apoptotic Effect of N6 on SVCV-Infected Cells

As shown in Figure 1, apoptosis in SVCV-infected cells treated with N6 was assessed by measuring the percentage of live and apoptotic cells using Annexin V/PI staining. The data indicated that the percentage of viable/live cells in the SVCV-infected group was significantly lower compared to the N6-SVCV-treated group. After 24 h of SVCV infection in EPC cells, 29.35% of the cells underwent apoptosis. SVCV-induced apoptosis was significantly inhibited after N6 treatments, and the apoptosis rates were reduced to 18.18% (Figure 1A). However, an apoptosis rate of 78% was achieved at 48 h of SVCV treatment. N6 treatments were reduced to 21.40% (Figure 1B). The results indicated that N6 could significantly inhibit SVCV-induced apoptosis in EPC cells.

3.2. N6 Reduced Horizontal Transmission of SVCV

Based on the results of in vitro and in vivo inhibition by following previous studies [19], we hypothesize that N6 may serve as an effective antiviral agent in aquaculture by inhibiting viral horizontal transmission. The main mode of transmission of SVCV is horizontal transmission, with dead and sick fish, nets, and contaminated water being the main sources of transmission. The virus can be transmitted to healthy individuals through the excretions of diseased fish and secretions from various organs. Modeling the effects of drugs on the horizontal transmission of viruses under natural conditions will help to systematically and comprehensively evaluate the actual antiviral effects of drugs. The experimental design of the horizontal transmission of SVCV by N6 is shown in Figure 2. The results showed a significant reduction in the viral load in the recipient fish using the drugs compared to the group using only DMSO. In comparison, the N6-treated SVCV-infected group showed a nearly 3-fold decrease in viral load compared to the control group (Figure 2). The results indicate that when fish were treated with N6, the horizontal transmission of SVCV levels was significantly reduced.

3.3. Antiviral Responses of Common Carp Under N6-Treatment

The relative expression changes in IFN-related genes in SVCV- and N6-treated fish are shown in Figure 3. It was found that all the genes were up-regulated to different degrees after virus infection, especially ISG15 expression, which was three times higher than that of the control group in the spleen and kidney at 24 h. In addition, RIG expression was more significantly up-regulated in the spleen and kidney after N6 treatment. In addition, the up-regulation of the genes was more significant after N6 treatment, and the changes in RIG expression in the spleen and kidney at 24 h were 15 times higher than those in the control group compared with the virus group. As a foreign invader, the virus triggered the fish innate immunity at the beginning of the infection, which led to the up-regulation of the expression of the relevant interferon genes, and with time, this activation changed to an inhibitory effect, which was also more favorable to the proliferation and spread of the virus. In the results, it can be seen that the IFN-related genes in the tissues were obviously suppressed at 96 h post-infection, especially the IFN gene, which was down-regulated 4-fold in the kidney compared with the control group. At the same time, the relevant genes in the drug group were still highly expressed. Therefore, we can conclude that N6 can play an antiviral role by regulating the expression of carp innate immunity genes.

3.4. Histopathology

To further assess the impact of N6 on viral infection in fish, histopathological analysis was conducted. Tissue examination of common carp infected with SVCV and treated with N6 revealed notable changes. HE staining results indicated a significant increase in the severity of pathological alterations at 4 and 7 days post-infection (dpi). After N6 treatment of SVCV-infected juvenile carp, the spleen and kidney tissues were stained and observed under the microscope, and the results are shown in Figure 4. SVCV infection could cause obvious carp tissue damage, which was manifested by increased interstitial space and inflammatory cell infiltration (red circle and arrow) in the spleen tissue and vacuolization (green arrow) in the kidney tissue. However, compared with the virus group, the spleen and kidney tissues after N6 treatment did not show obvious pathological changes, and the morphology was closer to that of the control group. The results indicated that N6 could effectively improve the tissue damage caused by SVCV infection and showed good antiviral activity in vivo.

3.5. Metabolism of N6

The spectrum of N6 standard solution is shown in Figure 5A. A single dose of 10 μg/fish of N6 was intraperitoneally injected into young carp at a water temperature of 15 ℃, and the pharmacokinetic parameters of N6 in the kidney, spleen, intestines, and muscle tissues of carp were obtained by using DAS 2.0 pharmacokinetic software for data processing. Calculations showed that the N6 in the four tissues conformed to the two-compartment open model of primary absorption. In the analysis of the kidney, spleen, intestine, and muscle, the peak times of N6 in the four tissues were 10 h, 8 h, 10 h, and 6 h, respectively; the peak concentrations of N6 were 6.55 mg·L−1, 1.23 mg·L−1, 0.52 mg·L−1, and 0.76 mg·L−1, respectively (Figure 5B). The difference in the half-life of N6 between the spleen and the kidney were obvious, indicating that the decreasing rate of N6 concentration was different. Beyond that, in the intestines and muscles, as non-metabolizing organs, the half-life (t1/2α) of the intestines was larger, indicating a slower rate of drug metabolism.

4. Discussion

In general, normal apoptotic processes are necessary for the development and metabolism of the organism and help to maintain the homeostatic properties of tissues. When viruses infect host cells, they often need to utilize the material and energy systems within the host cells to accomplish their own proliferation and replication, and in this process, viruses can trigger severe apoptosis and produce typical morphological changes in apoptosis [27]. For example, the PEDV epidemic strain JS2013 induced apoptosis in Vero cells and produced large numbers of apoptotic vesicles [28]. The cytoskeleton plays an important role in virus-induced apoptosis. The results showed that microtubules and microfilaments were gradually disrupted and depolymerized during virus-induced apoptosis, and the cytoskeletal fiber system gradually disintegrated [29]. Consistent with previous studies [30,31], the proportion of apoptotic cells was significantly reduced by Annexin V-FITC/PI in flow cytometry, indicating that N6 has a better anti-apoptotic effect, which also confirms the antiviral activity of compound N6.
Over the years, extensive research has focused on the discovery of antiviral drugs against SVCV; however, few of these potential candidates have been characterized in animal models to assess their applicability in aquaculture [32]. Combined with the previous in vitro antiviral activity data, the in vivo antiviral activity assay was carried out. Compared with the previous concentrations of C4 and D5 in the injection situation, N6 greatly reduced its in vivo toxicity. At the same time, N6 demonstrated a remarkable in vivo antiviral effect. Since SVCV mainly proliferates in the spleen and kidney of fish [33], sampling and analyzing the spleen and kidney will help us to determine the relevant effects of the drugs on SVCV and fish. In addition, the main mode of transmission of SVCV is horizontal transmission, and diseased fish, nets, and contaminated water are the main infectious sources of transmission, and the virus can be transmitted to healthy individuals through the excretions of diseased fish and secretions from various organs. Simulating the effects of drugs on the horizontal transmission of viruses under natural conditions can help to systematically and comprehensively evaluate the actual antiviral effects of drugs. The results of horizontal transmission experiments demonstrated a significant reduction in virus levels in recipient fish using the drug compared to fish using only DMSO, with a nearly 3-fold decrease in the virus compared to the control group. However, it is regrettable that N6 did not completely block the horizontal transmission of SVCV.
Interferon is a substance released by host cells after exposure to pathogens and immune stimulants. The mammalian-like follicle-stimulating hormone interferon plays a crucial role in the host innate immune response, stimulating the expression of numerous IFN-stimulated genes that disrupt viral transcription, translation, assembly, and release [34]. The innate immune system represents the first line of defense against various pathogens, with its response to SVCV primarily mediated by type I interferons and interferon-induced proteins (e.g., Vig1, ISG15, ADAR, PKR, and Mx1), which exert antiviral effects during the intermediate and late stages of infection [35,36,37]. It is generally accepted that IFNs in fish are produced and secreted as early warning proteins in most types of infected cells, which then trigger immune signaling against viral pathogens via interferon binding to specific cell surface receptors [38,39,40]. As a member of the RLR family, RIG-I plays an important role in the virus-induced innate immune defense of teleostean by binding to viral RNA through the helicase structural domain and to the mitochondrial antiviral signaling protein (MAVS) [41]. In this study, it was found that six IFN-related genes were up-regulated to varying degrees after virus infection, especially changes in ISG15 expression, with the spleen and kidney reaching 3-fold the expression values of the control group at 24 h. In addition, the up-regulation of each gene was more significant after N6 treatment. The changes in RIG expression were 15 times higher in the spleen and kidney at 24 h compared with the virus group. As a foreign invader, the virus triggered the fish innate immunity at the beginning of the infection, which led to the up-regulation of the expression of the relevant interferon genes, and with time, this activation changed to an inhibitory effect, which was also more favorable to the proliferation and spread of the virus. In the results, it can be seen that the interferon genes in the tissues were obviously suppressed at 96 h post-infection, especially the IFN gene, which was down-regulated about 4-fold in the kidney compared with the control group. At the same time, the relevant genes in the drug group were still highly expressed.

5. Conclusions

The phenylpropanoid compounds have excellent antiviral activity in vivo, which not only significantly reduces the horizontal transmission of SVCV but also effectively regulates the host’s antiviral immune response.

Author Contributions

D.S. contributed to resources and writing—original draft preparation. Z.Z. and L.L. contributed to the methodology and supervision. X.C. and G.L. contributed to data curation and validation. X.T. and Q.S. contributed to software. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Program for the Natural Science Foundation of China (32303057), the China Postdoctoral Science Foundation (2022M720995), the Natural Science Foundation of Zhejiang Province (ZCLQ24C1901), and the Natural Science Foundation of Huzhou (2023YZ13).

Institutional Review Board Statement

The study was approved by the Medical Ethics Committee of Huzhou University (approval code: 2025021601; approval date: 16 February 2025).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting the findings of this study are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. FAO. The State of World Fisheries and Aquaculture; FAO: Rome, Italy, 2024. [Google Scholar]
  2. Toranzo, A.E.; Magariños, B.; Romalde, J.L. A review of the main bacterial fish diseases in mariculture systems. Aquaculture 2005, 246, 37–61. [Google Scholar] [CrossRef]
  3. Crane, M.; Hyatt, A. Viruses of fish: An overview of significant pathogens. Viruses 2011, 3, 2025–2046. [Google Scholar] [CrossRef]
  4. Alvarez-Pellitero, P. Fish immunity and parasite infections: From innate immunity to immunoprophylactic prospects. Vet. Immunol. Immunop. 2008, 126, 171–198. [Google Scholar] [CrossRef] [PubMed]
  5. Baudouy, A.; Danton, M.; Merle, G. SVCV infection of Carp (author’s transl). Ann. Rech. Vet. 1980, 11, 245–249. [Google Scholar]
  6. OIE. Aquatic Animal Health Code, Chapter 1.3. Diseases Listed by the OIE. 2024. Available online: https://www.woah.org/en/what-we-do/standards/codes-and-manuals/aquatic-code-online-access/?id=169&L=1&htmfile=chapitre_diseases_listed.htm (accessed on 20 December 2024).
  7. Veselý, T.; Pokorová, D.; Reschová, S.; Piačková, V. Experimental infection of common carp (Cyprinus carpio) with spring viremia of carp virus. In Proceedings of the Ninth International Symposium on Viruses of Lower Vertebrates, Malaga, Spain, 1–4 October 2014; pp. 213–214. [Google Scholar]
  8. Emmenegger, E.J.; Sanders, G.E.; Conway, C.M.; Binkowski, F.P.; Winton, J.R.; Kurath, G. Experimental infection of six North American fish species with the North Carolina strain of spring viremia of carp virus. Aquaculture 2016, 450, 273–282. [Google Scholar] [CrossRef]
  9. Teng, Y.; Liu, H.; Lv, J.Q.; Fan, W.H.; Zhang, Q.Y.; Qin, Q.W. Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China. Arch. Virol. 2007, 152, 1457–1465. [Google Scholar] [CrossRef]
  10. Fijan, N. Spring viraemia of carp and other viral diseases and agents of warm water fish. In Fish Diseases and Disorders; Woo, P.T.K., Bruno, D.W., Eds.; CAB International: London, UK, 1999; Volume 3, pp. 177–244. [Google Scholar]
  11. Newman, D.J.; Cragg, G.M. Natural products as sources of new drugs from 1981 to 2014. J. Nat. Prod. 2016, 79, 629–661. [Google Scholar] [CrossRef]
  12. Yarovaya, O.I.; Salakhutdinov, N.F. Mono- and sesquiterpenes as a starting platform for the development of antiviral drugs. Russ. Chem. Rev. 2021, 90, 488–510. [Google Scholar] [CrossRef]
  13. Ge, H.; Wang, Y.F.; Xu, J.; Gu, Q.; Liu, H.B.; Xiao, P.G.; Zhou, J.; Liu, Y.; Yang, Z.; Su, H. Anti-influenza agents from Traditional Chinese Medicine. Nat. Prod. Rep. 2010, 27, 1758–1780. [Google Scholar] [CrossRef]
  14. Natella, F.; Nardini, M.; Di Felice, M.; Scaccini, C. Benzoic and cinnamic acid derivatives as antioxidants: Structure activity relation. J. Agr. Food Chem. 1999, 47, 1453–1459. [Google Scholar] [CrossRef] [PubMed]
  15. Hu, Y.; Liu, L.; Li, B.Y.; Shen, Y.F.; Wang, G.X.; Zhu, B. Synthesis of arctigenin derivatives against infectious hematopoietic necrosis virus. Eur. J. Med. 2019, 163, 183–194. [Google Scholar] [CrossRef]
  16. Kashman, Y.; Gustafson, K.R.; Fuller, R.W.; Cardellina, J.H.I.; Mcmahon, J.B.; Currens, M.J.; Buckheit, R.W.J.; Hughes, S.H.; Cragg, G.M.; Boyd, M.R. Cheminform abstract: HIV inhibitory natural products. Part 7. The calanolides, a novel HIV-inhibitory class of coumarin derivatives from the tropical rainforest tree, Calophyllum lanigerum. J. Med. Chem. 1992, 35, 2735–2743. [Google Scholar] [CrossRef]
  17. Charlton James, L. Antiviral Activity of Lignans. J. Nat. Prod. 1998, 61, 1447–1451. [Google Scholar] [CrossRef] [PubMed]
  18. Antonelli, A.C.; Zhang, Y.; Golub, L.M.; Johnson, F.; Simon, S.R. Inhibition of anthrax lethal factor by curcumin and chemically modiffed curcumin derivatives. J. Enzym. Inhib. Med. Ch. 2014, 29, 663–669. [Google Scholar] [CrossRef]
  19. Song, D.W.; Liu, L.; Shan, L.P.; Qiu, T.X.; Chen, J.; Chen, J.P. Rhabdoviral clearance effect of a phenylpropanoid medicine against spring viraemia of carp virus infection in vitro and in vivo. Aquaculture 2020, 526, 735412. [Google Scholar] [CrossRef]
  20. Song, D.W.; Liu, L.; Fu, X.Y.; Liu, G.L.; Hu, Y.; Chen, J. Immune responses and protective efffcacy on 4-(2-methoxyphenyl)-3,4-dihydro-2H-chromeno [4,3-d] pyrimidine-2,5 (1H)-dione against spring viremia of carp virus in vivo. Aquaculture 2021, 540, 736694. [Google Scholar] [CrossRef]
  21. Qiu, T.X.; Wang, H.; Hu, Y.; Shan, L.P.; Liu, G.L.; Liu, L.; Zhang, X.; Chen, J. Inhibition of fish rhabdovirus demonstrates application prospect of two methylimidazole phenylpropanoid-based small molecules in aquaculture. Aquaculture 2024, 595, 741636. [Google Scholar] [CrossRef]
  22. Liu, L.; Shan, L.P.; Xue, M.Y.; Lu, J.F.; Hu, Y.; Liu, G.L.; Chen, J. Potential application of antiviral coumarin in aquaculture against IHNV infection by reducing viral adhesion to the epithelial cell surface. Antivir. Res. 2021, 195, 105192. [Google Scholar] [CrossRef] [PubMed]
  23. Shan, L.P.; Zhou, Y.; Yan, M.C.; Liu, L.; Chen, J.; Chen, J.P. A novel antiviral coumarin derivative as a potential agent against WSSV infection in shrimp seedling culture. Virus Res. 2021, 297, 198387. [Google Scholar] [CrossRef]
  24. Koutna’, M.; Veselý, T.; Psikal, I.; Hůlova’, J. Identiffcation of spring viraemia of carp virus (SVCV) by combined RT-PCR and nested PCR. Dis. Aquat. Org. 2003, 55, 229–235. [Google Scholar] [CrossRef]
  25. Chen, Z.Y.; Liu, H.; Li, Z.Q.; Wang, M.; Zhang, Q.Y. Detection of viral pathogen from diseased common carp (Cyprinus carpio) by infectious tests. J. Fish. Sci. China 2006, 13, 617–623. [Google Scholar]
  26. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  27. Roulston, A.; Marcellus, R.C.; Branton, P.E. Viruses and apoptosis. Annual. Rev. Microbiol. 1999, 53, 577–628. [Google Scholar] [CrossRef]
  28. Liang, R.; Song, H.X.; Huang, J.L.; Fei, R.M.; Zhang, J.Q. PEDV epidemic strain JS2013 induced apoptosis of Vero cell. J. Nanjing Agric. Univ. 2021, 44, 514–520. [Google Scholar]
  29. Suleva, P.C.; Manuel, O.V.; Patricia, D.; La, C.O.; Marina, V.P. Dynamic reorganization of the cytoskeleton during apoptosis: The two coffins hypothesis. Int. J. Mol. Sci. 2017, 18, 2393. [Google Scholar] [CrossRef] [PubMed]
  30. Liu, L.; Hu, Y.; Shen, Y.F.; Wang, G.X.; Zhu, B. Evaluation on antiviral activity of coumarin derivatives against spring viraemia of carp virus in epithelioma papulosum cyprini cells. Antivir. Res. 2017, 144, 173–185. [Google Scholar] [CrossRef]
  31. Liu, L.; Song, D.W.; Liu, G.L.; Shan, L.P.; Qiu, T.X.; Chen, J. Hydroxycoumarin efffciently inhibits spring viraemia of carp virus infection in vitro and in vivo. Zool. Res. 2020, 41, 395–409. [Google Scholar] [CrossRef]
  32. Chen, C.; Shen, Y.F.; Hu, Y.; Liu, L.; Chen, W.C.; Wang, G.X.; Zhu, B. Highly efficient inhibition of spring viraemia of carp virus replication in vitro mediated by bavachin, a major constituent of psoralea corlifonia Lynn. Virus Res. 2018, 255, 24–35. [Google Scholar] [CrossRef]
  33. Xiao, Y.; Shao, L.; Zhang, C.; An, W. Genomic evidence of homologous recombination in spring viremia of carp virus: A negatively single stranded RNA virus. Virus Res. 2014, 189, 271–279. [Google Scholar] [CrossRef] [PubMed]
  34. Zou, J.; Secombes, C.J. Teleost fish interferons and their role in immunity. Dev. Comp. Immunol. 2011, 35, 1376–1387. [Google Scholar] [CrossRef] [PubMed]
  35. Forlanza, M.; Dias, J.D.; Vesel, T. Transcription of signal-3 cytokines, IL-12 and IFNα/β, coincides with the timing of CD8α/β up-regulation during viral infection of common carp (Cyprinus carpio L.). Mol. Immunol. 2008, 45, 1531–1547. [Google Scholar] [CrossRef] [PubMed]
  36. Adamek, M.A.; Rakus, K.; Chyb, J.A.; Brogden, G.; Huebner, A.; Irnazarow, I.; Steinhagen, D. Interferon type I responses to virus infections in carp cells: In vitro studies on Cyprinid herpesvirus 3 and Rhabdovirus carpio infections. Fish Shellfish Immun. 2012, 33, 482–493. [Google Scholar] [CrossRef] [PubMed]
  37. Qiu, T.X.; Song, D.W.; Shan, L.P.; Liu, G.L.; Liu, L. Potential prospect of a therapeutic agent against spring viraemia of carp virus in aquaculture. Aquaculture 2020, 515, 734558. [Google Scholar] [CrossRef]
  38. Rodriguez, J.; Li, T.; Xu, Y.R.; Sun, Y.Y.; Zhu, C.L. Role of apoptosis-inducing factor in perinatal hypoxic-ischemic brain injury. Neural Regen. Res. 2020, 16, 205–213. [Google Scholar]
  39. Tafalla, C.; Sanchez, E.; Lorenzen, N.; DeWitte-Orr, S.J.; Bols, N.C. Effects of viral hemorrhagic septicemia virus (VHSV) on the rainbow trout (Oncorhynchus mykiss) monocyte cell line RTS-11. Mol. Immunol. 2008, 45, 1439–1448. [Google Scholar] [CrossRef]
  40. Lopez, M.A.; Roca, F.J.; Meseguer, J.; Mulerol, V. New insights into the evolution of IFNs: Zebrafish group II IFNs induce a rapid and transient expression of IFN-dependent genes and display powerful antiviral activities. J. Immunol. 2009, 182, 3440–3449. [Google Scholar] [CrossRef]
  41. Kawai, T.; Takahashi, K.; Sato, S.; Coban, C.; Akira, S. IPS-1, an adaptor triggering RIG-I and MDA5 mediated type I interferon induction. Nat. Immunol. 2005, 6, 981–988. [Google Scholar] [CrossRef]
Figure 1. N6 reduces SVCV-induced apoptosis in EPC cells. The percentage of apoptotic cells was assessed by Annexin V/PI staining at 24 h (A) and 48 h (B) post-infection.
Figure 1. N6 reduces SVCV-induced apoptosis in EPC cells. The percentage of apoptotic cells was assessed by Annexin V/PI staining at 24 h (A) and 48 h (B) post-infection.
Fishes 10 00077 g001
Figure 2. Inhibition of N6 on the horizontal transmission of SVCV. (A) Schematic representation of the experimental design. (B) Donor fish were injected with SVCV, and a significant reduction in viral load was observed in N6-treated recipient fish compared to DMSO-treated controls. Each sample was analyzed in triplicate and normalized to 18S. Data are presented as the mean ± SD of three replicates. Statistical significance was determined using Student’s t-test (two-tailed, assuming equal variances). Significant differences between control and exposure groups are indicated by ** p < 0.01.
Figure 2. Inhibition of N6 on the horizontal transmission of SVCV. (A) Schematic representation of the experimental design. (B) Donor fish were injected with SVCV, and a significant reduction in viral load was observed in N6-treated recipient fish compared to DMSO-treated controls. Each sample was analyzed in triplicate and normalized to 18S. Data are presented as the mean ± SD of three replicates. Statistical significance was determined using Student’s t-test (two-tailed, assuming equal variances). Significant differences between control and exposure groups are indicated by ** p < 0.01.
Fishes 10 00077 g002
Figure 3. Antiviral responses in the kidney and spleen were enhanced in SVCV-infected fish treated with N6. Relative RNA levels of IFN-related genes were quantified by RT-qPCR in fish samples at 1, 2, and 4 days post-treatment. Each sample was analyzed in triplicate and normalized to 18S RNA. Data are presented as means (±SEM) of three replicates per treatment. Means with different letters are significantly different (p < 0.05).
Figure 3. Antiviral responses in the kidney and spleen were enhanced in SVCV-infected fish treated with N6. Relative RNA levels of IFN-related genes were quantified by RT-qPCR in fish samples at 1, 2, and 4 days post-treatment. Each sample was analyzed in triplicate and normalized to 18S RNA. Data are presented as means (±SEM) of three replicates per treatment. Means with different letters are significantly different (p < 0.05).
Fishes 10 00077 g003
Figure 4. Histopathological analysis of HE staining of spleen and kidney after 4 and 7 days of treatment.
Figure 4. Histopathological analysis of HE staining of spleen and kidney after 4 and 7 days of treatment.
Fishes 10 00077 g004
Figure 5. Body metabolism of N6. (A) Typical UPLC chromatograms for N6 standard solution. (B) The drug concentration–time curve of N6 in kidney, spleen, intestinal, and muscle.
Figure 5. Body metabolism of N6. (A) Typical UPLC chromatograms for N6 standard solution. (B) The drug concentration–time curve of N6 in kidney, spleen, intestinal, and muscle.
Fishes 10 00077 g005aFishes 10 00077 g005b
Table 1. Primers used for the analysis of gene expression by qPCR [21].
Table 1. Primers used for the analysis of gene expression by qPCR [21].
Primer Sequences (from 5′to 3′)
SVCV nucleoprotein (N)ForwardAACAGCGCGTCTTACATGC
ReverseCTAAGGCGTAAGCCATCAGC
RIG-IForwardAAACTGTGACTTAGACGAGGCT
ReverseGTTGCTGCTCATCAGCATGT
Mx1ForwardATGAATCCTGGAAGCCCTC
ReverseGAACTTCGGGAAGAATTTGC
ISG15ForwardAAGCCATATTCAGCGAAGC
ReverseAACCGTTATCGGCAGACAG
MAVSForwardTCACACTCACTGATAGGGAAGAG
ReverseTAGCTCTCATCTCATTAGCCAGT
IRF3ForwardGGAGACCACTCTGTTTGGAAG
ReverseCGGCATCGTTCTTGTTGTC
IFN1ForwardACCAAACCCAAATGTGGACGTG
ReverseCCACTCATTTCCCGAAGCAGA
Fish actinForwardGATGATGAAATTGCCGCACTG
ReverseACCAACCATGACACCCTGATGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Song, D.; Cai, X.; Shao, Q.; Tong, X.; Zhao, Z.; Liu, L.; Liu, G. Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator. Fishes 2025, 10, 77. https://doi.org/10.3390/fishes10020077

AMA Style

Song D, Cai X, Shao Q, Tong X, Zhao Z, Liu L, Liu G. Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator. Fishes. 2025; 10(2):77. https://doi.org/10.3390/fishes10020077

Chicago/Turabian Style

Song, Dawei, Xue Cai, Qianhao Shao, Xinhui Tong, Zhe Zhao, Lei Liu, and Guanglu Liu. 2025. "Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator" Fishes 10, no. 2: 77. https://doi.org/10.3390/fishes10020077

APA Style

Song, D., Cai, X., Shao, Q., Tong, X., Zhao, Z., Liu, L., & Liu, G. (2025). Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator. Fishes, 10(2), 77. https://doi.org/10.3390/fishes10020077

Article Metrics

Back to TopTop