Next Article in Journal
Accounting for Carbon Emissions from Fisheries in China and Analyzing the Decoupling Effect
Previous Article in Journal
Antiviral Effect and Metabolic Regularity of a Phenylpropanoid- Based Compound as Potential Immunopotentiator
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi

1
Animal Husbandry and Fisheries Research Center of Guangdong Haid Group Co., Ltd., Guangzhou 511400, China
2
Key Laboratory of Microecological Resources and Utilization in Breeding Industry, Ministry of Agriculture and Rural Affairs, Guangdong Haid Group Co., Ltd., Guangzhou 511400, China
3
Centre for Research on Environmental Ecology and Fish Nutrition of the Ministry of Agriculture and Rural Affairs, Shanghai Ocean University, Shanghai 201306, China
4
Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture and Rural Affairs, Shanghai Ocean University, Shanghai 201306, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Fishes 2025, 10(2), 78; https://doi.org/10.3390/fishes10020078
Submission received: 10 January 2025 / Revised: 7 February 2025 / Accepted: 11 February 2025 / Published: 15 February 2025
(This article belongs to the Section Nutrition and Feeding)

Abstract

Fish meal (FM) replacement is essential for sustainable aquaculture development. This study investigated the effects of FM replacement with poultry by-product meal (PBM) on growth performance, hepatic and intestinal health and ammonia nitrogen stress resistance in mandarin fish (Siniperca chuatsi). A 52-day feeding trial was conducted using PBM to replace fish meal at levels of 0%, 17.5%, 35.0%, 52.5% and 70.0%. The results showed that FM replacement with PBM did not influence growth performance in mandarin fish. Moderate PBM replacement (≤35.0%) did not harm liver health and enhanced the intestinal structure. However, excessive replacement (≥52.5%) caused hepatocyte damage, reduced antioxidant capacity and decreased survival under ammonia nitrogen stress. Notably, 70% PBM replacement led to severe hepatic lipid accumulation, inhibiting fatty acid β-oxidation and triglyceride hydrolysis pathways. Furthermore, high PBM levels (≥52.5%) also reduced intestinal muscularis thickness, downregulated tight junction proteins and induced inflammation. In conclusion, while PBM replacement does not hinder growth, maintaining levels below 35.0% (PBM ≤ 28.5%) is essential for preserving hepatic lipid metabolism, intestinal health and antioxidant defense in mandarin fish.
Key Contribution: This study contributes to investigating the effects of fish meal replacement with poultry by-product meal (PBM) on growth and health in mandarin fish, determines the PBM replacement level to maintain growth performance and health and highlights the adverse effects caused by excessive replacement.

1. Introduction

The mandarin fish (Siniperca chuatsi) is a valuable freshwater species in China, renowned for its delicate flesh and high nutritional value. As a carnivorous predator, mandarin fish naturally rely exclusively on live prey, which has historically posed significant challenges for large-scale aquaculture [1]. However, decades of selective breeding and advancements in artificial feed domestication techniques have successfully enabled mandarin fish to consistently accept commercial formulated feeds [2].
Fish meal (FM), widely regarded as the optimal protein source in aquafeeds, is valued for its high protein content, balanced amino acid profile, excellent nutrient digestibility and absence of anti-nutritional factors, all of which promote the health and rapid growth of farmed fish and shrimp [3]. However, the increasing scale of aquaculture, global climate change and overfishing reduce FM availability. This limits the ability to meet market demands and keeps prices elevated [4]. Consequently, developing sustainable alternative protein sources to replace FM has become a critical focus in aquaculture research [3].
Poultry by-product meal (PBM) is derived from by-products generated during poultry processing, such as heads, feet, blood, trimmings, undeveloped eggs and viscera [4]. Due to its high nutritional value, good digestibility and well-balanced amino acid profile, it is usually compared to FM [5]. In addition, PBM is considered a promising alternative protein source in aquafeeds for its wide availability and cost-effectiveness [6]. Research has demonstrated PBM’s successful application in various aquatic species, including largemouth bass (Micropterus salmoides), olive flounder (Paralichthys olivaceus), European sea bass (Dicentrarchus labrax), large yellow croaker (Larimichthys crocea) and coho salmon (Oncorhynchus kisutch). These studies indicated that the replacement of FM with PBM does not negatively affect growth performance or feed utilization in fishes, but high replacement levels often result in hepatic lipid accumulation, intestinal morphological changes and abnormal regulation of immune factors [7,8,9,10,11]. Despite most studies focusing on growth and health, research on the molecular mechanisms of PBM’s influence on growth, metabolism, immunity and antioxidant pathways remains limited. Additionally, strategies to address potential nutritional deficiencies associated with PBM remain underexplored.
In current commercial diets for mandarin fish in China, fish meal (FM) accounts for over 50% of the total feed content, and the cost per ton of feed exceeds USD 1400. The reduction in FM usage in mandarin fish diets holds significant long-term importance for sustainability. However, research on protein source replacement in mandarin fish feed is still insufficient.
This study aims to evaluate the effects of partial FM replacement with PBM on growth performance and the underlying health mechanisms in mandarin fish. These findings enhance PBM’s application potential, reduce reliance on marine resources and lower feed costs by approximately 8–10% (USD 120–140 per ton) with 35% FM replacement (personal observation). Additionally, this study will provide scientific support for the effect of PBM quality and chemical composition on survival, growth, metabolism and physiological responses in fish.

2. Materials and Methods

2.1. Feed Formulation

A basal diet containing 500 g/kg steam-dried FM and 105 g/kg PBM as primary ingredients was formulated. Based on this formulation, PBM was used to replace 0%, 17.5%, 35%, 52.5% and 70% of the FM. These FM replacement levels were selected based on previous studies involving fish meal replacement in other carnivorous fish species and aligned with industry benchmarks for feed formulation [7,8,10]. Crystalline amino acids were added to ensure consistent levels of lysine, methionine and threonine across all diets, while soybean oil was added to maintain consistent lipid levels. Five isonitrogenous and isolipidic floating extruded diets were prepared and designated as PF0, PF17.5, PF35.0, PF52.5 and PF70.0, with PBM inclusion levels of 105, 195, 285, 375.1 and 465.1 g/kg of feed, respectively. The formulations and proximate compositions of the experimental diets are provided in Table 1. Amino acid contents are detailed in Table S1, while the fatty acid composition is shown in Table 2. All feed ingredients were supplied by Qingyuan Hailong Biotechnology Co., Ltd., Qingyuan, China. The ingredients were finely ground to pass through an 80-mesh sieve at Guangzhou Rongchuan Feed Co., Ltd., Guangzhou, China, homogenized through stepwise dilution and processed into floating extruded pellets with a diameter of 4.56 ± 0.12 mm and a length of 14.08 ± 0.36 mm.

2.2. Experimental Fish and Daily Management

Juvenile mandarin fish were sourced from the Haid Group Guangzhou Dixuan Experimental Base. Following a 4-week acclimation period, fish with an initial body weight of 34.0 ± 0.26 g and stable feed intake were randomly divided into five groups, with three replicates per group and 300 fish per replicate, and fed the five experimental diets. The experiment was conducted in pond-based net cages, with a total of 15 cages (one replicate per cage). Each cage measured 3 m (length) × 2 m (width) × 2 m (depth), with a pond water depth of 2.2 m and a pond area of 3000 m2. The pond was covered with plastic film to minimize heat loss and help maintain a stable water temperature, using disinfected river water as the water source. During the 52-day feeding trial, fish were fed to apparent satiation twice daily (06:00 and 18:30). Feed intake, feed residues, mortality and dead fish weight were recorded. Water quality parameters were monitored daily: temperature (18–26 °C), salinity (3–4), ammonia nitrogen (<0.2 mg/L), nitrite (<0.05 mg/L), pH (7.9–8.2) and dissolved oxygen (>5.0 mg/L).

2.3. Sample Collection

After the in vivo trial, fish were fasted for 24 h. The number and total weight of mandarin fish in each cage were recorded after the fish were weighed and counted. Six fish were randomly selected from each net cage (n = 6) and anesthetized using MS-222 (50 mg/L). Body length and body weight were measured, and blood was collected via caudal vein puncture. The blood samples were left to stand at 4 °C for 1 h and then centrifuged at 4000 r/min for 10 min at 4 °C, and the supernatant was collected for further analysis. The brain, liver, gonads, stomach, intestines, intestinal contents and dorsal muscle (from both sides above the lateral line) were dissected. Visceral mass weight, liver weight, mesenteric fat weight and gonad weight were recorded. Growth indices, including the weight gain rate (WGR), survival rate (SR), specific growth rate (SGR), feeding rate (FR) and feed conversion ratio (FCR), were calculated (n = 3). Physiological indices, including the intraperitoneal fat ratio (IPF), viscerosomatic index (VSI), hepatosomatic index (HSI) and gonadosomatic index (GSI), were also determined (n = 18). RNA samples from the brain, liver and midgut (n = 6 per tissue type), along with intestinal contents, were flash-frozen in liquid nitrogen and stored at −80 °C. Tissue samples for histology (n = 6 per group) were fixed in 4% paraformaldehyde and stored at 4 °C. Serum and tissue enzyme activity samples were stored at −20 °C. Additionally, two fish per net cage (n = 6 per group) were randomly selected for whole-body composition analysis.

2.4. Acute Ammonia Nitrogen Stress Trial

Following the aquaculture trial, a preliminary experiment determined the 24 h median lethal concentration (24 h LC50) of ammonia nitrogen for mandarin fish to be approximately 250 mg/L. The ammonia nitrogen stress solution was prepared by dissolving the appropriate amount of ammonium chloride. The experiment consisted of three replicates, with 36 fish per group (12 fish randomly selected from each net cage) placed in 300 L water tanks with an ammonia nitrogen concentration of 250 mg/L. The water used was aerated tap water, with the temperature controlled at 21.0 ± 0.5 °C and pH maintained at 7.8 ± 0.1. A total of 180 fish were used, and the stress trial lasted for 24 h. During the trial, dissolved oxygen was maintained at sufficient levels, and dead fish were promptly removed from the tanks. At the end of the trial, the mortality rate was recorded for each group. Fish were anesthetized with MS-222 (50 mg/L), and blood and gill filaments were collected for the measurement of enzyme activity indicators. Sample preservation followed the same methods as previously described.

2.5. Nutritional Composition Analysis

The moisture, crude protein and crude lipid contents of the muscle, liver and whole fish were determined using AOAC methods [12]. The moisture content was measured using the constant-temperature drying method at 105 °C. The crude protein content was analyzed by the Kjeldahl method, and the crude lipid content was measured using the chloroform–methanol extraction method. Each measurement was conducted in triplicate.
The amino acid content in the feed was determined using acid hydrolysis, as described in previous studies [13]. Total lipids in the feed were extracted using the chloroform–methanol method. After methylation, the fatty acid composition was analyzed by gas chromatography (7890A, Agilent Technologies, Santa Clara, CA, USA) coupled with mass spectrometry (5975A, Agilent Technologies, Santa Clara, CA, USA) [13].

2.6. Biochemical Indicators and Enzyme Activity Analysis

Serum parameters, including total protein (TP), total triglycerides (TGs), cholesterol (CHO), high-density lipoprotein (HDL), low-density lipoprotein (LDL), alanine aminotransferase (ALT) and aspartate aminotransferase (AST), were analyzed using an automatic biochemical analyzer (Abbott Aeroset Analyzer, Abbott Laboratories, Chicago, Illinois, USA) at Zhongnan Hospital of Wuhan University (Wuhan, China). Liver ALT and AST and both liver and serum superoxide dismutase (SOD), glutathione peroxidase (GPx), catalase (CAT) and malondialdehyde (MDA) were determined using commercial assay kits provided by Nanjing Jiancheng Bioengineering Institute (Nanjing, China), following the manufacturer’s instructions. All measurements were performed with three replicates per group.

2.7. Histological Analysis

Liver and posterior intestinal samples were collected from six randomly selected fish per group for histological analysis. Tissues were fixed in a 4% paraformaldehyde solution for 24 h, dehydrated through a graded ethanol series and embedded in paraffin. Sections were cut into 5 μm thick slices using a rotary microtome and stained with hematoxylin and eosin (H&E) for histological examination [14]. For Oil Red O staining, liver samples were frozen in liquid nitrogen, stored at −80 °C and sectioned into 8 μm thick slices using a cryostat [15]. The dried slides were washed one to two times in 70% ethanol and stained with Oil Red O solution for 5 min. After staining, the sections were observed under a light microscope, and three random fields of view per sample were selected for analysis. Images of H&E- and Oil Red O-stained sections were analyzed using ImageJ 1.45 software National Institutes of Health, Bethesda, MD, USA). Quantitative measurements included the relative area of lipid droplets, intestinal muscularis thickness and villus height. At least three samples per group were analyzed for each staining method and tissue type.

2.8. RNA Extraction and Quantitative Real-Time PCR Analysis

Brain, liver and midgut tissues were collected from six fish per group for gene expression analysis, with three replicates performed for each group. Total RNA was extracted using Trizol reagent (TaKaRa, Tokyo, Japan), and its concentration and quality (A260/A280 > 2.0) were confirmed with an Eppendorf Biophotometer Plus. Following genomic DNA removal, RNA was reverse-transcribed into cDNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa, Tokyo, Japan), as previously described [16]. RT-qPCR, using ribosomal protein L13a (rpl13a) as the reference gene, was performed with the primers listed in Table 3. Amplification was carried out on a Mastercycler EP Realplex (Eppendorf, Hamburg, Germany) under standard conditions. Relative gene expression levels were calculated using the 2−ΔΔCt method [17].

2.9. Calculations and Statistical Methods

The growth performance, feed utilization and morphometric indices of mandarin fish were calculated using the following formulas:
Weight Gain Rate (WGR, %): WGR = [(Final body weight − Initial body weight)/Initial body weight] × 100.
Survival Rate (SR, %): SR = (Final fish number/Initial fish number) × 100.
Specific Growth Rate (SGR, %/day): SGR = [100 × (ln(Final body weight) − ln(Initial body weight))]/days.
Feeding Ratio (FR, %/day): FR = [Total feed intake/((Final body weight + Initial body weight)/2 × days)] × 100.
Feed Conversion Ratio (FCR): FCR = Feed intake/Weight gain.
Intraperitoneal Fat Ratio (IPF, %): IPF = (Intraperitoneal fat weight/Whole body weight) × 100.
Viscerosomatic Index (VSI, %): VSI = (Visceral weight/Whole body weight) × 100.
Hepatosomatic Index (HSI, %): HSI = (Liver weight/Whole body weight) × 100.
Gonadosomatic Index (GSI, %): GSI = (Gonad weight/Whole body weight) × 100.
Statistical Analysis: Data were analyzed using SPSS 25.0 (SPSS, Michigan Avenue, Chicago, IL, USA). Prior to analysis, normality was tested using the Shapiro–Wilk test, and homogeneity of variance was verified with Levene’s test. One-way ANOVA followed by Duncan’s multiple range test was performed, with p < 0.05 considered statistically significant. When normality and homogeneity were not achieved, the Kruskal–Wallis test was used.

3. Results

3.1. Growth Performance and Morphometric Indices

Table 4 presents the growth performance and morphometric indices of mandarin fish across all treatment groups. After 52 days of feeding with diets containing different levels of PBM as a replacement for FM, there were no significant differences among groups in the FBW, WGR, SR, SGR and FCR (p > 0.05). The feeding rate (FR) exhibited an initial increase followed by a decline, with the PF17.5 and PF35.0 groups showing significantly higher FRs compared to the PF70.0 group (p < 0.05). For the morphometric indices, the PF70.0 group demonstrated a significantly higher VSI, HSI and GSI than all other groups (p < 0.05).

3.2. Whole-Body and Hepatic Nutrient Composition

FM replacement with PBM changed the nutrient composition of the whole fish and liver, as presented in Table 5. In the whole fish, the crude protein content exhibited a quadratic trend and reached the highest level in the PF52.5 group (p < 0.05), but then decreased rapidly in the PF70 group. The crude lipid content remained consistent across the PF0 to PF52.5 groups (p > 0.05) but showed a sharp and significant increase in the PF70 group (p < 0.05).
In the liver, the moisture content followed a downward quadratic trend: the PF35.0 and PF52.5 groups showed significantly higher moisture contents than the PF0 group, while the PF70.0 group displayed significantly lower values compared to the PF0 group (p < 0.05). Furthermore, the crude protein content in the PF70.0 group was significantly lower than that of the other groups (p < 0.05), whereas the crude lipid content was significantly higher than that of the other groups (p < 0.05).

3.3. Appetite-Related Gene Expression in the Brain of Mandarin Fish

As shown in Figure 1, neuropeptide Y (npy) expression levels in brain tissue were significantly elevated across all replacement groups compared to the PF0 group, with the highest expression observed in the PF17.5 group (p < 0.05). In contrast, pro-opiomelanocortin (pomc) expression was significantly upregulated in the PF52.5 and PF70.0 groups relative to the PF0 group (p < 0.05).

3.4. Serum Components

The serum biochemical indices of mandarin fish are presented in Table 6. Compared to PF0, serum TP levels significantly increased in the high-PBM-replacement groups (p < 0.05). Similarly, T-AOC increased consistently with higher PBM levels, showing significant differences among all groups (p < 0.05).
In lipid metabolism, triglyceride (TG) and cholesterol (CHO) levels displayed U-shaped dose–response relationships with PBM replacement (quadratic trend p < 0.05). The lowest concentrations were observed in the PF35.0 group, whereas the PF70.0 group showed the highest values, with significant differences between the PF70.0 and PF0 groups (p < 0.05). The PF70 group exhibited significantly reduced HDL levels compared to the PF0 group (p < 0.05), while LDL contents were elevated in both the PF52.5 and PF70 groups relative to the PF0 group (p < 0.05). Consequently, the HDL/LDL ratio decreased significantly as PBM replacement levels increased (p < 0.05).
Serum ALT levels were significantly higher in the PF52.5 and PF70 groups, and AST levels were elevated in the PF70 group compared to the PF0 group (p < 0.05).

3.5. Liver Biochemical Indicators

The hepatic antioxidant capacity indices and transaminase activity showed significant differences among the groups (Table 7). PBM replacement enhanced antioxidant enzyme activities. The levels of GPx and SOD activities were significantly elevated in all PBM replacement groups compared to the PF0 group (p < 0.05). Additionally, CAT levels in the PF17.5 and PF70.0 groups were significantly higher than those in the PF0 group (p < 0.05). MDA, a lipid peroxidation product, was significantly lower in the PF70.0 group compared to the PF0 group (p < 0.05).
In hepatic transaminase activity, compared to the PF0 group, serum alanine aminotransferase (ALT) levels were significantly higher in the PF52.5 and PF70.0 groups (p < 0.05). Similarly, serum aspartate aminotransferase (AST) levels showed fluctuations up and down and reached the highest level in the PF52.5 group (p < 0.05).

3.6. Liver Histology

The H&E staining of liver tissue (Figure 2) revealed hepatocyte changes across the treatment groups. In the PF0 and PF17.5 groups, hepatocytes exhibited normal morphology, with rounded cell membranes, large circular nuclei and well-defined cell boundaries. However, as the PBM replacement level increased, beginning with the PF35.0 group, the hepatocyte staining intensity became darker, cell boundaries grew indistinct and the degree of hepatocyte vacuolation and nuclear displacement progressively increased.
The Oil Red O staining results (Figure 3) showed a dose-dependent increase in hepatic lipid droplets, with the PF70.0 group showing significantly larger lipid droplet areas than the other groups (p < 0.05).

3.7. Gene Expression in the Liver of Mandarin Fish

In the liver (Figure 4), mechanistic target of rapamycin kinase (mtor) expression was significantly upregulated in the PF35.0, PF52.5 and PF70.0 groups compared to the PF0 group (p < 0.05). Ribosomal protein S6 kinase (s6k) expression was the highest in the PF35.0 group and the lowest in the PF70.0 group relative to the PF0 group (p < 0.05). AMP-activated protein kinase (ampk) expression showed no significant differences across the replacement groups compared to PF0 (p > 0.05), but the PF17.5 group exhibited significantly higher levels than the PF52.5 and PF70.0 groups (p < 0.05). No significant differences were observed in protein kinase B (akt) expression among the groups (p > 0.05). In contrast, forkhead box O1 (foxo1) expression was significantly elevated in the PF70.0 group compared to the other groups (p < 0.05), with no significant differences observed among the other groups.
For lipid synthesis-related genes (Figure 5), including acetyl-CoA carboxylase 1 (acc1), fatty acid synthase (fas) and sterol regulatory element-binding protein 1 (srebp1), no significant differences were detected among the groups (p > 0.05). Lipoprotein lipase (lpl) expression was significantly higher in the PF70.0 group compared to the PF0 group, while no significant differences were observed among the other groups (p > 0.05). Hormone-sensitive lipase (hsl) expression increased sharply from the PF0 to PF35 groups, then decreased in the PF52.5 group and rebounded in the PF70 group, where it was significantly higher than in the PF0 group (p < 0.05). Fatty acid β-oxidation genes, peroxisome proliferator-activated receptor alpha (ppar-α) and carnitine palmitoyltransferase 1 (cpt1), were significantly downregulated in all replacement groups compared to the PF0 group (p < 0.05).

3.8. Hindgut Histology

The H&E staining and statistical analysis of the hindgut (Figure 6 and Table 8) demonstrated significant changes in intestinal morphology due to the FM being replaced by PBM. The PF17.5 and PF35.0 groups exhibited significantly higher intestinal muscular layer thicknesses compared to the PF0 group (p < 0.05), whereas the PF52.5 and PF70.0 groups showed a significant reduction (p < 0.05). Similarly, compared to the PF0 group, the number of intestinal villi in the PF17.5 and PF35.0 groups significantly increased (p < 0.05). Additionally, the villus length in the PF35.0 group was also significantly longer than in the PF0 group (p < 0.05).

3.9. Gene Expression in the Midgut of Mandarin Fish

In the midgut (Figure 7), the highest expression of the tight junction protein gene occludin was observed in the PF17.5 group, and the lowest expression was observed in the PF70 group; no significant difference was found between the other groups. Zonula occludens-1 (zo-1) expression was significantly downregulated when the PBM replacement level exceeded 35% (p < 0.05).
For inflammation-related genes, tumor necrosis factor-alpha (tnf-α) expression was significantly upregulated in the PF17.5 group compared to the PF0 group, whereas the PF35.0 and PF70.0 groups exhibited significantly lower expression than the PF0 group (p < 0.05). In the PF17.5 group, interleukin 1 beta (il-1β) and NF-κB p65 (p65) exhibited significantly higher expressions than in the other groups. Meanwhile, no significant difference was found between the other groups (p < 0.05).

3.10. Acute Ammonia Nitrogen Stress Response

As presented in Table 9, after 24 h of acute ammonia nitrogen stress, the survival rates of fish in the PF52.5 and PF70.0 groups were significantly lower than those in the PF0 group (p < 0.05). Serum MDA levels showed no significant differences among the groups (p > 0.05). However, serum CAT and GPx activities were significantly reduced in the PBM replacement groups compared to the PF0 group (p < 0.05). In contrast, serum SOD activity increased significantly with the increase in PBM replacement levels, and the SOD value in the PF70.0 group was significantly higher than that in the PF0 group (p < 0.05). Serum ALT and AST values showed the same trend as SOD (p < 0.05). In the gill, Na+/K+ ATPase activity increased progressively with higher PBM replacement levels and showed a significant upward trend (p < 0.05).

4. Discussion

4.1. Seventy Percent of Fish Meal Replaced with PBM Has No Adverse Effect on the Growth of Mandarin Fish

In this study, up to 70% of FM replaced with PBM did not significantly affect the survival rate, SGR or FCR, indicating that growth performance was not compromised in mandarin fish. Similar findings have been reported in tilapia (Oreochromis niloticus) [18], barramundi (Lates calcarifer) [19] and gilthead seabream (Sparus aurata) [20], where 50–100% of FM replacement with animal by-product meal under an appropriate nutritional balance did not significantly reduce growth performance.
The HSI and VSI are important physiological indicators for evaluating the health and metabolic status of aquatic animals, with an elevated HSI or increased liver-to-body ratio potentially reflecting enhanced metabolic activity or nutrient storage, but also possibly indicating underlying issues such as inflammation or fatty liver disease [21]. In this study, significant increases in the HSI and VSI were observed at the 70% PBM replacement level. This suggests that although excessive PBM replacement does not directly reduce growth performance, it may increase the metabolic burden on visceral organs in mandarin fish due to specific components in PBM. A potential explanation for this metabolic burden is the low levels of EFAs, particularly HUFAs, in PBM-based diets. These deficiencies appear to contribute to hepatic lipid accumulation, necessitating an elevated metabolic workload for nutrient metabolism, assimilation and homeostatic regulation, ultimately leading to an elevated HSI and VSI [22]. Additionally, the GSI in the PF70.0 group was significantly higher than that in the PF0 group, suggesting accelerated gonadal development at high PBM replacement levels. During juvenile stages, energy allocation typically prioritizes somatic growth over gonadal development [23]. This phenomenon may be directly related to the high levels of cholesterol and steroid-like compounds in PBM used in the diet [24]. These compounds, which are known to regulate steroid hormone synthesis and reproductive development, may stimulate premature gonadal development and maturation [25]. As observed in other species, premature gonadal development at high replacement levels in mandarin fish may redirect energy from somatic growth to reproduction, potentially reducing long-term growth rates and feed efficiency, as reported in Tachysurus fulvidraco [26].
Changes in feeding behavior and appetite-regulating genes were also observed at different replacement levels. Previous studies suggest that partial FM substitution can modulate feeding behavior in aquatic species, potentially through palatability or nutrient balance effects [27]. In this study, the biphasic feeding response (peak at PF35.0, decline at PF70.0) in mandarin fish, despite the non-significant differences from PF0, may be linked to protein source-driven modulation of appetite-regulating genes. At the gene expression level, moderate replacement upregulated npy, an appetite-stimulating factor. In contrast, excessive replacement significantly upregulated pomc, an appetite-suppressing factor. These dynamic changes in npy and pomc expression may be attributed to the high levels of saturated fatty acids, cholesterol and steroid compounds in PBM, which can enhance feed palatability [24]. Additionally, these changes are influenced by multiple factors, such as energy status and hunger signaling pathways [28]. In this study, further analysis revealed that hepatic ampk expression peaked in the PF17.5 group and then significantly decreased at higher replacement levels (PF52.5 and PF70.0), suggesting that the organism is in a high-energy state at elevated replacement levels. This energy surplus might upregulate pomc expression, suppressing appetite and antagonizing npy expression [29], ultimately influencing the feeding rate.
In terms of the nutrient composition and metabolic responses, the whole-body crude protein content initially increased and then decreased at high replacement levels, while the crude lipid content significantly increased in the PF70.0 group. This indicates that moderate replacement promotes protein deposition, whereas excessive replacement may induce metabolic shifts toward lipid accumulation, disrupting the nutritional equilibrium. At moderate replacement levels, the higher proportion of monounsaturated fatty acids (MUFAs) in the diet might serve as a more efficient energy source compared to saturated fatty acids (SFAs) and polyunsaturated fatty acids (PUFAs) in comparison to the PF0 group, potentially sparing amino acids from being oxidized for energy and thus supporting protein deposition [30]. However, at excessive replacement levels, the diet’s increased proportion of SFAs and decreased levels of HUFAs could influence lipid metabolism [31]. The reduction in HUFAs may limit their role in promoting lipid oxidation and regulating lipid synthesis, while a high SFA content might be less efficiently metabolized, potentially favoring lipid storage and contributing to hepatic lipid accumulation and metabolic imbalance [31]. Serum TP levels were significantly elevated in the high-replacement groups, indicating hepatic nutrient reserves were not compromised [32]. However, in the PF70.0 group, the hepatic moisture and crude protein contents reduced, along with an increase in the lipid content and HSI, suggesting that excessive PBM replacement burdens the liver and may impair its function over time.
At the molecular level, the mtor/s6k pathway plays a central role in sensing nutrient and energy signals to regulate protein synthesis [33]. Akt, the upstream regulator of mtor, showed no significant changes, but mtor expression was significantly upregulated at high replacement levels, possibly due to the suppression of ampk expression in the high-energy state. Moderate replacement enhanced s6k expression, promoting protein synthesis and cellular growth, leading to an increase in whole-body crude protein levels. However, excessive replacement inhibited s6k expression, disrupting the metabolic balance and resulting in a decrease in protein deposition. Overall, moderate PBM replacement activated the mtor/s6k pathway, improving nutrient utilization and metabolic capacity, thereby sustaining normal growth performance in mandarin fish.

4.2. Excessive Replacement Induces Hepatic Lipid Accumulation and Liver Damage in Mandarin Fish

Histological analysis revealed significant negative effects of excessive PBM replacement on hepatic health in mandarin fish. Oil Red O staining and quantification of the relative lipid droplet area showed that high replacement levels significantly promoted hepatic lipid accumulation. H&E staining further confirmed these changes while indicating evident liver damage. These findings suggest that excessive replacement disrupts the metabolic balance, resulting in hepatic lipid accumulation and subsequent liver damage. Such metabolic disruption may also interfere with amino acid metabolism, further exacerbating hepatic dysfunction.
Changes in transaminase activity provided biochemical evidence for these observations. Transaminases, such as ALT and AST, are essential for hepatic amino acid metabolism. Normally, these enzymes are predominantly localized in the hepatocytes, with minimal concentrations detected in the bloodstream [34]. However, when hepatocyte integrity is compromised, these enzymes are released into the circulation. An increase in the hepatic AST/ALT ratio indicates active amino acid metabolism and anabolic processes, whereas a decline suggests enhanced protein catabolism [35]. In this study, PBM replacement levels exceeding 52.5% significantly increased hepatic ALT and AST activities, with a marked decrease in the AST/ALT ratio. This implies that excessive PBM replacement promotes protein breakdown while inhibiting anabolic processes, ultimately reducing protein deposition. Moreover, the significant elevation of serum ALT and AST levels further confirmed liver damage induced by excessive poultry by-product meal replacement. Concurrently, serum lipid metabolism indicators showed that high replacement levels significantly increased TG and CHO levels while reducing the HDL/LDL ratio [36]. This disruption in the lipid metabolic balance suggests an elevated risk of fatty liver and metabolic disorders.
At the molecular regulatory level, foxo1 plays a critical role in regulating cell growth, apoptosis, autophagy and metabolism. The foxo1 gene is typically activated under conditions of nutrient deprivation, energy restriction or oxidative stress to alleviate metabolic pressure [37]. In this study, the diet in the PF70.0 group exhibited the lowest PUFA content, which may weaken the negative feedback regulation of foxo1 by the PPAR signaling pathway [38], resulting in the upregulation of foxo1 expression. Aberrant activation of foxo1 might exacerbate cellular autophagy and apoptosis, ultimately leading to hepatocyte damage. This aligns with findings in other fish species, such as juvenile largemouth bass [39], gilthead seabream [40] and rainbow trout (Oncorhynchus mykiss) [41], where excessive PBM replacement increased hepatic lipid accumulation and caused liver damage. However, research indicates that substituting fish meal with chicken meal has no adverse effects on Nile tilapia hepatic health, likely attributed to differences in feed formulation and species-specific dietary requirements [42].
Furthermore, the specific regulatory mechanisms of hepatic lipid metabolism also elucidated the causes of lipid accumulation. In fatty acid synthesis, the expression of acc1 and fas and their regulator, srebp1, showed no significant changes [43]. This indicated that the lipid synthesis pathway was not affected. However, at high PBM replacement levels, the expression of hsl was significantly downregulated, inhibiting the breakdown and utilization of triglycerides in adipose tissue [44]. The upregulation of lpl expression suggests that lipid transport in the plasma remained unaffected [45]. Meanwhile, the reduced levels of HUFAs in the feed may have further suppressed fatty acid β-oxidation by downregulating ppar-α and its downstream target cpt1, which facilitates fatty acid transport into mitochondria for oxidation [46].
These changes ultimately weakened fatty acid oxidation and utilization, leading to incomplete lipid breakdown and excessive hepatic lipid accumulation. This resulted in fatty liver-like lesions and structural and functional damage to hepatocytes. Given the observed inhibition of β-oxidation and the disruption of lipid catabolism, targeted remediation should focus on reactivating dormant metabolic pathways. Specifically, supplementing the diet with omega-3 PUFAs could help compensate for impaired mitochondrial fat utilization, while the addition of conjugated bile acids may enhance luminal emulsification and peroxisomal processing of lipid substrates, thereby providing dual entry points for restoring metabolic flux [47,48].
Inhibition of the fatty acid β-oxidation pathway can overload mitochondria, leading to damage of the mitochondrial respiratory chain complexes and electron leakage from the electron transport chain, which generates reactive oxygen species (ROS) [49]. In this study, the significant increases in hepatic CAT, SOD and GPx activities, along with elevated serum T-AOC, might represent a compensatory response to oxidative stress. The upregulation of antioxidant enzymes enhances free radical scavenging to mitigate oxidative damage. MDA, a by-product of unsaturated fatty acid peroxidation, primarily arises from the breakdown of PUFAs [50]. Compared to the PF0 group, the PF70.0 group showed both the lowest dietary PUFA content and significant suppression of hsl expression. These factors may synergistically reduce hepatic free fatty acid availability, thereby decreasing lipid peroxidation and resulting in the significantly lower MDA levels observed in PF70.0. Similar findings have been reported in other studies. For example, 25% of fish meal replaced with poultry by-product meal significantly increased total glutathione levels, T-AOC, and CAT and SOD activities in Eriocheir sinensis [51]. Similarly, 50% of FM replaced with PBM enhanced hepatic SOD and CAT activities while reducing MDA levels in largemouth bass [52].

4.3. Moderate Replacement Improves Intestinal Structure, While Excessive Replacement Impairs Intestinal Health

Moderate PBM replacement significantly improved the intestinal structure of mandarin fish. H&E staining of the hindgut revealed that moderate PBM replacement increased the villus height, villus number and muscularis thickness, thereby enhancing nutrient absorption efficiency. However, excessive replacement reversed these improvements, with reductions in the villus height and muscularis thickness leading to impaired nutrient absorption and weakened barrier integrity, which could potentially lead to compromised nutrient uptake and growth performance over the long term. These structural changes may be attributed to an imbalance of amino acids in the diet, possibly triggered by an incorrect ratio when replacing FM, consistent with previous studies [53,54]. Specifically, the reduction in HUFAs, such as EPA and DHA, which are critical for maintaining cellular membrane integrity and reducing inflammation, and the increased proportion of SFAs may have negatively impacted intestinal function.
As we know, tight junction proteins, such as occludin and zonula occludens-1 (zo-1), play critical roles in maintaining intestinal barrier function. In this study, excessive replacement levels significantly downregulated the expression of these proteins, which might have been due to the reduced levels of HUFAs, which play a role in maintaining tight junction integrity and regulating permeability [55]. This downregulation may have increased intestinal permeability, allowing harmful substances to infiltrate the bloodstream and causing immune stress, further compromising intestinal barrier function.
The reduction in intestinal barrier integrity may have triggered immune activation and inflammatory responses. Pro-inflammatory cytokines such as tnf-α and il-1β exacerbate intestinal inflammation by activating immune cells, damaging mucosal tissues and increasing epithelial permeability [56]. The p65 signaling pathway, a central regulator of stress responses, controls the expression of genes involved in inflammation and immune defense [57]. The progressive reduction in PUFAs, particularly HUFAs, combined with an increase in SFAs, likely contributed to these inflammatory responses [58]. In particular, SFAs can exacerbate oxidative stress and activate inflammatory pathways such as toll-like receptor 4, further intensifying gut inflammation and compromising intestinal function [59]. In the present study, low PBM replacement levels, which reduced the dietary PUFA content, significantly upregulated the expression of tnf-α, il-1β and p65 in the midgut compared to the control group. This moderate immune activation may have helped the fish cope with stress. However, as PBM replacement levels increased further, the progressive reduction in PUFAs appeared to compromise intestinal barrier integrity, causing the gut to be predisposed to chronic inflammation [60]. At this point, the organism likely regulates excessive inflammation through negative feedback mechanisms, suppressing the overexpression of pro-inflammatory genes to prevent tissue damage [61]. While this response helps mitigate immediate damage, sustained chronic inflammation can have detrimental effects on the immune system, weakening the fish’s ability to effectively combat infections and increasing its susceptibility to disease [62].

4.4. Excessive Replacement Weakens the Antioxidant Defense Capacity Under Ammonia Nitrogen Stress, Reduces the Survival Rate and Exacerbates Liver Damage

Several studies have demonstrated that dietary protein sources can significantly influence the antioxidant capacity in fish. For example, excessive replacement of FM with soybean meal has been shown to induce oxidative stress and impair glutathione metabolism in largemouth bass [63]. Similarly, plant protein substitution can trigger oxidative stress in the liver of Atlantic salmon (Salmo salar) [64]. In aquaculture, ammonia nitrogen is a prevalent environmental pollutant that can induce oxidative stress, liver damage and ion-regulatory dysfunction at excessive levels in fish, and can even lead to death [65]. In this study, after 24 h of ammonia nitrogen stress, serum ALT and AST activities were significantly elevated in the high-PBM-replacement group, accompanied by a sharp decline in the survival rate. These findings indicated that excessive PBM replacement exacerbated liver damage and reduced the tolerance to ammonia nitrogen stress in mandarin fish.
PBM replacement significantly increased serum SOD levels in ammonia nitrogen stress, which aligned with the elevated hepatic SOD activity observed before stress exposure. However, CAT and GPx activities in the serum decreased after stress, which might have been due to the accumulation of excessive reactive oxygen species (ROS) during the 24 h ammonia nitrogen stress period. SOD primarily converts superoxide anions (O2) into hydrogen peroxide (H2O2), but the reduction in CAT and GPx activities impaired the timely breakdown of H2O2, resulting in its accumulation [66]. The buildup of H2O2 can cause oxidative modifications to proteins, disrupt the structural and active sites of CAT and GPx, further impair their activities, weaken the antioxidant defense system and exacerbate oxidative damage [67]. As the redox imbalance intensifies, oxidative stress may worsen, potentially triggering apoptosis or necrosis, further aggravating cellular damage. Interestingly, serum MDA levels remained unaltered in this study; possibly, the short duration of ammonia nitrogen stress was insufficient for detectable lipid peroxidation. In addition, Na+/K+-ATPase activity in gill tissue significantly increased under high PBM replacement levels, indicating a greater ionic regulatory burden. Similar results were also observed in studies on largemouth bass [68]. This suggests that an acute ammonia nitrogen stress-induced elevation of ion transport enzyme activity in mandarin fish, while critical for rapid osmotic regulation [39], may exacerbate oxidative damage through sustained ATP overconsumption and electron leakage in ionocytes.

5. Conclusions

Up to 70% of FM replaced with PBM did not influence growth performance in mandarin fish. However, high levels of PBM replacement (≥52.5%) led to hepatic lipid accumulation, liver damage, reduced intestinal permeability, intestinal inflammation and decreased stress resistance, which may be attributed to the deficiency of PUFAs in the feed. Considering these factors, the PBM replacement level should not exceed 35%. Future research should focus on optimizing feed formulations by incorporating alternative lipid sources, increasing the essential fatty acid content or enhancing lipid utilization through additives to further improve the PBM replacement ratio while ensuring the health and growth performance of mandarin fish.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes10020078/s1, Table S1: Amino Acid Content of Experimental Diets (% on an Air-Dry Basis); Table S2: Fatty Acid Composition of Experimental Diets (Percentage of Total Fatty Acid Mass).

Author Contributions

Conceptualization, L.W. and B.Y.; methodology, S.T., H.M. and L.W.; software, H.M.; validation, X.Q., B.Y. and L.W.; formal analysis, S.T. and H.M.; investigation, S.T. and H.M.; resources, S.T.; data curation, S.T. and H.M.; writing—original draft preparation, H.M.; writing—review and editing, S.T. and X.H.; visualization, H.M.; supervision, X.H., B.Y., X.Z. and L.W; project administration, X.Q.; funding acquisition, S.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Panyu Innovation and Entrepreneurship Leading Team Project, funded by the Panyu District Government of Guangzhou, China (2021-R01-4).

Institutional Review Board Statement

The experimental procedures were performed in strict accordance with the Management Rule of Laboratory Animals (Chinese Order No. 676 of the State Council, revised 1 March 2017). This study was conducted in accordance with the local legislation and institutional requirements.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author due to restrictions based on proprietary limitations, funding agency requirements and confidentiality agreements. Specifically, the funder requires that the data generated in this study remain confidential to protect proprietary information. However, in compliance with academic transparency and ethical guidelines, the authors are willing to provide access to the data as much as possible, provided it does not violate the funder’s requirements or confidentiality agreements. Data sharing will be considered after a thorough review of the request and under the condition that a data sharing agreement is signed to ensure proper use of the information.

Conflicts of Interest

Authors Shulin Tang, Lei Wang, Biao Yun, Xuan Zhu and Xueqiao Qian were employed by Guangdong Haid Group Co., Ltd. Authors Huanchao Ma and Xueming Hua were affiliated with Shanghai Ocean University. The authors declare that this study received funding from the Panyu Innovation and Entrepreneurship Leading Team Project (2021-R01-4). The funder had the following involvement in the study: sample collection, supervision, project administration and funding acquisition.

References

  1. Wang, J.; Liang, X.-F.; He, S.; Li, J.; Huang, K.; Zhang, Y.-P.; Huang, D. Lipid deposition pattern and adaptive strategy in response to dietary fat in Chinese perch (Siniperca chuatsi). Nutr. Metab. 2018, 15, 77. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, Y.; Liang, X.F.; He, S.; Wang, J.; Li, L.; Zhang, Z.; Li, J.; Chen, X.; Li, L.; Alam, M.S. Metabolic responses of Chinese perch (Siniperca chuatsi) to different levels of dietary carbohydrate. Fish Physiol. Biochem. 2021, 47, 1449–1465. [Google Scholar] [CrossRef] [PubMed]
  3. Hussain, S.M.; Khurram, F.; Naeem, A.; Hussain Shah, S.Z.; Sarker, P.K.; Naeem, E.; Arsalan, M.Z.-U.-H.; Riaz, D.; Yousaf, Z.; Faisal, M. A review on the prospects and potentials of fishmeal replacement with different animal protein sources. Int. Aquat. Res. 2024, 16, 7–16. [Google Scholar]
  4. Boateng, A.G.; Zhao, J.; Zhao, J.; Xu, H.; Li, H.; Zhao, M.; Xu, Q.; Liu, C.; Qin, J. Effects of Replacement of Fish Meal with Poultry By-Product Meal (PBM) on Growth Performance, Digestive Enzyme, and Immunity of Giant River Prawn (Macrobrachium rosenbergii). Aquac. Res. 2023, 2023, 7500596. [Google Scholar] [CrossRef]
  5. Chaklader, M.R.; Howieson, J.; Fotedar, R. Growth, hepatic health, mucosal barrier status and immunity of juvenile barramundi, Lates calcarifer fed poultry by-product meal supplemented with full-fat or defatted Hermetia illucens larval meal. Aquaculture 2021, 543, 737026. [Google Scholar] [CrossRef]
  6. Chaklader, M.R.; Chung, W.H.; Howieson, J.; Fotedar, R. A Mixture of Full-Fat and Defatted Hermetia illucens Larvae and Poultry By-Products as Sustainable Protein Sources Improved Fillet Quality Traits in Farmed Barramundi, Lates calcarifer. Foods 2023, 12, 362. [Google Scholar] [CrossRef] [PubMed]
  7. Gu, J.; Zhang, Q.; Huang, D.; Zhang, L.; Chen, X.; Wang, Y.; Liang, H.; Ren, M. Effects of partial substitution of enzymatic hydrolysate of poultry by-product meal for fishmeal on the growth performance, hepatic health, antioxidant capacity, and immunity of juvenile largemouth bass (Micropterus salmoides). Aquac. Rep. 2024, 35, 101990. [Google Scholar] [CrossRef]
  8. Islam, M.R.; Cho, S.H.; Kim, T. Inclusion Effect of Various Levels of Jack Mackerel Meal in Olive Flounder (Paralichthys olivaceus) Diets Substituting 50% Fish Meal with Duck By-Product Meal on Growth and Feed Utilization. Animals 2024, 14, 2184. [Google Scholar] [CrossRef]
  9. Marzouk, Y.; Gaber, M.M.; Ahmad, I.; Ahmed, I.; El Basuini, M.F.; Zaki, M.A.; Nour, A.-E.M.; Labib, E.M.H.; Khalil, H.S. Impacts of poultry by-product meal substituting fishmeal on growth efficiency, body composition, liver, and intestine morphology of European sea bass, Dicentrarchus labrax. Food Chem. X 2024, 23, 101569. [Google Scholar] [CrossRef] [PubMed]
  10. Wang, X.; Luo, H.; Zheng, Y.; Wang, D.; Wang, Y.; Zhang, W.; Chen, Z.; Chen, X.; Shao, J. Effects of poultry by-product meal replacing fish meal on growth performance, feed utilization, intestinal morphology and microbiota communities in juvenile large yellow croaker (Larimichthys crocea). Aquac. Rep. 2023, 30, 101547. [Google Scholar] [CrossRef]
  11. Yi, C.; Huang, D.; Yu, H.; Gu, J.; Liang, H.; Ren, M. Enzymatically Hydrolyzed Poultry By-Product Supplementation, Instead of Fishmeal, Alone Improves the Quality of Largemouth Bass (Micropterus salmoides) Back Muscle without Compromising Growth. Foods 2023, 12, 3485. [Google Scholar] [CrossRef]
  12. AOAC International. Official Methods of Analysis of AOAC International; AOAC International: Gaithersburg, MD, USA, 2000. [Google Scholar]
  13. Ma, Y.; Li, M.; Xie, D.; Chen, S.; Dong, Y.; Wang, M.; Zhang, G.; Zhang, M.; Chen, H.; Ye, R. Fishmeal can be replaced with a high proportion of terrestrial protein in the diet of the carnivorous marine teleost (Trachinotus ovatus). Aquaculture 2020, 519, 734910. [Google Scholar] [CrossRef]
  14. Betancor, M.; Sprague, M.; Sayanova, O.; Usher, S.; Campbell, P.; Napier, J.A.; Caballero, M.J.; Tocher, D.R. Evaluation of a high-EPA oil from transgenic Camelina sativa in feeds for Atlantic salmon (Salmo salar L.): Effects on tissue fatty acid composition, histology and gene expression. Aquaculture 2015, 444, 1–12. [Google Scholar] [CrossRef] [PubMed]
  15. Wei, C.-C.; Wu, K.; Gao, Y.; Zhang, L.-H.; Li, D.-D.; Luo, Z. Magnesium reduces hepatic lipid accumulation in yellow catfish (Pelteobagrus fulvidraco) and modulates lipogenesis and lipolysis via PPARA, JAK-STAT, and AMPK pathways in hepatocytes. J. Nutr. 2017, 147, 1070–1078. [Google Scholar] [CrossRef] [PubMed]
  16. Zhang, Z.; Ran, C.; Ding, Q.-w.; Liu, H.-l.; Xie, M.-x.; Yang, Y.-l.; Xie, Y.-d.; Gao, C.-c.; Zhang, H.-l.; Zhou, Z.-g. Ability of prebiotic polysaccharides to activate a HIF1α-antimicrobial peptide axis determines liver injury risk in zebrafish. Commun. Biol. 2019, 2, 274. [Google Scholar] [CrossRef]
  17. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  18. Sathishkumar, G.; Felix, N.; Prabu, E. Effects of dietary protein substitution of fish meal with bioprocessed poultry by-product meal on growth performances, nutrient utilization, whole-body composition and haemato-biochemical responses of GIFT tilapia reared in floating cages. Aquac. Res. 2021, 52, 5407–5418. [Google Scholar] [CrossRef]
  19. Chaklader, M.R.; Howieson, J.; Foysal, M.J.; Fotedar, R. Transformation of fish waste protein to Hermetia illucens protein improves the efficacy of poultry by-products in the culture of juvenile barramundi, Lates calcarifer. Sci. Total Environ. 2021, 796, 149045. [Google Scholar] [CrossRef]
  20. Moutinho, S.; Martínez-Llorens, S.; Tomás-Vidal, A.; Jover-Cerdá, M.; Oliva-Teles, A.; Peres, H. Meat and bone meal as partial replacement for fish meal in diets for gilthead seabream (Sparus aurata) juveniles: Growth, feed efficiency, amino acid utilization, and economic efficiency. Aquaculture 2017, 468, 271–277. [Google Scholar] [CrossRef]
  21. Gisbert, E.; Ortiz-Delgado, J.B.; Sarasquete, C. Nutritional cellular biomarkers in early life stages of fish. Histol. Histopathol. 2008, 23, 1525–1539. [Google Scholar]
  22. Hayashi, Y.; Shimamura, A.; Ishikawa, T.; Fujiwara, Y.; Ichi, I. FADS2 inhibition in essential fatty acid deficiency induces hepatic lipid accumulation via impairment of very low-density lipoprotein (VLDL) secretion. Biochem. Biophys. Res. Commun. 2018, 496, 549–555. [Google Scholar] [CrossRef] [PubMed]
  23. Roff, D.A. An allocation model of growth and reproduction in fish. Can. J. Fish. Aquat. Sci. 1983, 40, 1395–1404. [Google Scholar] [CrossRef]
  24. Najafabadi, H.J.; Moghaddam, H.N.; Pourreza, J.; Shahroudi, F.E.; Golian, A. Determination of chemical composition, mineral contents, and protein quality of poultry by-product meal. Int. J. Poult. Sci. 2007, 6, 875–882. [Google Scholar] [CrossRef][Green Version]
  25. Payne, A.H.; Hales, D.B. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr. Rev. 2004, 25, 947–970. [Google Scholar] [CrossRef] [PubMed]
  26. Wang, L.-Y.; Qi, P.-P.; Chen, M.; Yuan, Y.-C.; Shen, Z.-G.; Fan, Q.-X. Effects of sex steroid hormones on sexual size dimorphism in yellow catfish (Tachysurus fulvidraco). Acta Hydrobiol. Sin. 2020, 44, 379–388. [Google Scholar]
  27. Baek, S.I.; Jeong, H.S.; Cho, S.H. Replacement effect of fish meal by plant protein sources in olive flounder (Paralichthys olivaceus) feeds with an addition of jack mackerel meal on growth, feed availability, and biochemical composition. Aquac. Nutr. 2023, 2023, 7965258. [Google Scholar] [CrossRef] [PubMed]
  28. Assan, D.; Mustapha, U.F.; Chen, H.; Li, Z.; Peng, Y.; Li, G. The roles of neuropeptide Y (Npy) and peptide YY (Pyy) in teleost food intake: A mini review. Life 2021, 11, 547. [Google Scholar] [CrossRef]
  29. Liu, M.; Alimov, A.; Wang, H.; Frank, J.A.; Katz, W.; Xu, M.; Ke, Z.-J.; Luo, J. Thiamine deficiency induces anorexia by inhibiting hypothalamic AMPK. Neuroscience 2014, 267, 102–113. [Google Scholar] [CrossRef]
  30. Sheashea, M.; Xiao, J.; Farag, M.A. MUFA in metabolic syndrome and associated risk factors: Is MUFA the opposite side of the PUFA coin? Food Funct. 2021, 12, 12221–12234. [Google Scholar] [CrossRef] [PubMed]
  31. Mata-Sotres, J.A.; Marques, V.H.; Barba, D.; Braga, A.; Araújo, B.; Viana, M.T.; Rombenso, A.N. Increasing dietary SFA: MUFA ratio with low levels of LC-PUFA affected lipid metabolism, tissue fatty acid profile and growth of juvenile California Yellowtail (Seriola dorsalis). Aquaculture 2021, 543, 737011. [Google Scholar] [CrossRef]
  32. Coeurdacier, J.-L.; Dutto, G.; Gasset, E.; Blancheton, J.-P. Is total serum protein a good indicator for welfare in reared sea bass (Dicentrarchus labrax)? Aquat. Living Resour. 2011, 24, 121–127. [Google Scholar] [CrossRef]
  33. Sabatini, D.M. Twenty-five years of mTOR: Uncovering the link from nutrients to growth. Proc. Natl. Acad. Sci. USA 2017, 114, 11818–11825. [Google Scholar] [CrossRef]
  34. Rahman, A.N.A.; Mohamed, A.A.-R.; Dahran, N.; Farag, M.F.; Alqahtani, L.S.; Nassan, M.A.; AlThobaiti, S.A.; El-Naseery, N.I. Appraisal of sub-chronic exposure to lambada-cyhalothrin and/or methomyl on the behavior and hepato-renal functioning in Oreochromis niloticus: Supportive role of taurine-supplemented feed. Aquat. Toxicol. 2022, 250, 106257. [Google Scholar] [CrossRef] [PubMed]
  35. Duan, P.; Zhang, L.; Wang, J.; Li, B. The effects of new protein sources substitute fishmeal on the amino acid compositions of juvenile starry flounder (Platichthys stellatus). Oceanol. Limnol. Sin. 2011, 42, 229–236. [Google Scholar]
  36. Zou, Y.; Zhong, L.; Hu, C.; Zhong, M.; Peng, N.; Sheng, G. LDL/HDL cholesterol ratio is associated with new-onset NAFLD in Chinese non-obese people with normal lipids: A 5-year longitudinal cohort study. Lipids Health Dis. 2021, 20, 28. [Google Scholar] [CrossRef]
  37. Peng, S.; Li, W.; Hou, N.; Huang, N. A review of FoxO1-regulated metabolic diseases and related drug discoveries. Cells 2020, 9, 184. [Google Scholar] [CrossRef]
  38. Selvaraj, R.K.; Shanmugasundaram, R.; Klasing, K.C. Effects of dietary lutein and PUFA on PPAR and RXR isomer expression in chickens during an inflammatory response. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2010, 157, 198–203. [Google Scholar] [CrossRef]
  39. Wright, P.A.; Wood, C.M. A new paradigm for ammonia excretion in aquatic animals: Role of Rhesus (Rh) glycoproteins. J. Exp. Biol. 2009, 212, 2303–2312. [Google Scholar] [CrossRef] [PubMed]
  40. Psofakis, P.; Meziti, A.; Berillis, P.; Mente, E.; Kormas, K.A.; Karapanagiotidis, I.T. Effects of dietary fishmeal replacement by poultry by-product meal and hydrolyzed feather meal on liver and intestinal histomorphology and on intestinal microbiota of gilthead seabream (Sparus aurata). Appl. Sci. 2021, 11, 8806. [Google Scholar] [CrossRef]
  41. Keramat Amirkolaie, A.; Shahsavari, M.; Hedayatyfard, M. Full replacement of fishmeal by poultry by–product meal in rainbow trout, Oncorhynchus mykiss (Walbaum, 1972) diet. Iran. J. Fish. Sci. 2014, 13, 1069–1081. [Google Scholar]
  42. Aydin, B.; GÜMÜŞ, E.; BALCI, B. Effect of dietary fish meal replacement by poultry by-product meal on muscle fatty acid composition and liver histology of fry of Nile tilapia, Oreochromis niloticus (Actinopterygii: Perciformes: Cichlidae). Acta Ichthyol. Pisc. 2015, 45, 343–351. [Google Scholar] [CrossRef]
  43. Xu, S.; Chen, T.; Dong, L.; Li, T.; Xue, H.; Gao, B.; Ding, X.; Wang, H.; Li, H. Fatty acid synthase promotes breast cancer metastasis by mediating changes in fatty acid metabolism. Oncol. Lett. 2021, 21, 27. [Google Scholar] [CrossRef]
  44. Althaher, A.R. An Overview of Hormone-Sensitive Lipase (HSL). Sci. World J. 2022, 2022, 1964684. [Google Scholar] [CrossRef] [PubMed]
  45. Huang, Y.; Chen, L.; Li, L.; Qi, Y.; Tong, H.; Wu, H.; Xu, J.; Leng, L.; Cheema, S.; Sun, G. Downregulation of adipose LPL by PAR2 contributes to the development of hypertriglyceridemia. JCI Insight 2024, 9, e173240. [Google Scholar] [CrossRef]
  46. Ngo, J.; Choi, D.W.; Stanley, I.A.; Stiles, L.; Molina, A.J.; Chen, P.H.; Lako, A.; Sung, I.C.H.; Goswami, R.; Kim, M. Mitochondrial morphology controls fatty acid utilization by changing CPT1 sensitivity to malonyl-CoA. EMBO J. 2023, 42, e111901. [Google Scholar] [CrossRef]
  47. Xu, J.; Li, X.; Yao, X.; Xie, S.; Chi, S.; Zhang, S.; Cao, J.; Tan, B. Protective effects of bile acids against hepatic lipid accumulation in hybrid grouper fed a high-lipid diet. Front. Nutr. 2022, 9, 813249. [Google Scholar] [CrossRef]
  48. Okada, L.S.d.R.R.; Oliveira, C.P.; Stefano, J.T.; Nogueira, M.A.; da Silva, I.D.C.G.; Cordeiro, F.B.; Alves, V.A.F.; Torrinhas, R.S.; Carrilho, F.J.; Puri, P. Omega-3 PUFA modulate lipogenesis, ER stress, and mitochondrial dysfunction markers in NASH–proteomic and lipidomic insight. Clin. Nutr. 2018, 37, 1474–1484. [Google Scholar] [CrossRef]
  49. Malik, A.N.; Simões, I.C.; Rosa, H.S.; Khan, S.; Karkucinska-Wieckowska, A.; Wieckowski, M.R. A diet induced maladaptive increase in hepatic mitochondrial DNA precedes OXPHOS defects and may contribute to non-alcoholic fatty liver disease. Cells 2019, 8, 1222. [Google Scholar] [CrossRef]
  50. Tsikas, D. Assessment of lipid peroxidation by measuring malondialdehyde (MDA) and relatives in biological samples: Analytical and biological challenges. Anal. Biochem. 2017, 524, 13–30. [Google Scholar] [CrossRef] [PubMed]
  51. Chang, E.; Zhang, X.; Xu, J.; Wu, Y.; Guo, X.; Fu, L.; Xing, X.; Dong, X.; Wang, A.; Miao, S. Effects of Replacement of Fish Meal by Chicken Meal Combined with Egg Meal on Growth, Digestive Ability and Antioxidant Capacity of Eriocheir sinensis. Chin. J. Anim. Nutr. 2024, 36, 6631–6642. (In Chinese) [Google Scholar]
  52. Wu, J.; Liao, R.; Kuang, W.; Sun, H.; Chen, Y.; Tan, B.; Lin, S. Effects of replacing fish meal with domestic poultry by-product meal on growth, liver health and intestinal barrier of Micropterus salmoides. J. Fish. China 2023, 47, 109605. [Google Scholar]
  53. Linh, N.V.; Lubis, A.R.; Dinh-Hung, N.; Wannavijit, S.; Montha, N.; Fontana, C.M.; Lengkidworraphiphat, P.; Srinual, O.; Jung, W.-K.; Paolucci, M. Effects of shrimp shell-derived chitosan on growth, immunity, intestinal morphology, and gene expression of nile tilapia (Oreochromis niloticus) reared in a biofloc system. Mar. Drugs 2024, 22, 150. [Google Scholar] [CrossRef] [PubMed]
  54. Wang, K.-z.; Jiang, W.-d.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.-y.; Tang, L.; Zhang, Y.-a.; Zhou, X.-q.; Feng, L. Gossypol reduced the intestinal amino acid absorption capacity of young grass carp (Ctenopharyngodon idella). Aquaculture 2018, 492, 46–58. [Google Scholar] [CrossRef]
  55. Calder, P.C. Omega-3 polyunsaturated fatty acids and inflammatory processes: Nutrition or pharmacology? Br. J. Clin. Pharmacol. 2013, 75, 645–662. [Google Scholar] [CrossRef] [PubMed]
  56. Lopez-Castejon, G.; Brough, D. Understanding the mechanism of IL-1β secretion. Cytokine Growth Factor Rev. 2011, 22, 189–195. [Google Scholar] [CrossRef] [PubMed]
  57. Atreya, I.; Atreya, R.; Neurath, M. NF-κB in inflammatory bowel disease. J. Intern. Med. 2008, 263, 591–596. [Google Scholar] [CrossRef] [PubMed]
  58. Geay, F.; Mellery, J.; Tinti, E.; Douxfils, J.; Larondelle, Y.; Mandiki, S.; Kestemont, P. Effects of dietary linseed oil on innate immune system of Eurasian perch and disease resistance after exposure to Aeromonas salmonicida achromogen. Fish Shellfish Immunol. 2015, 47, 782–796. [Google Scholar] [CrossRef]
  59. Rocha, D.; Caldas, A.; Oliveira, L.; Bressan, J.; Hermsdorff, H. Saturated fatty acids trigger TLR4-mediated inflammatory response. Atherosclerosis 2016, 244, 211–215. [Google Scholar] [CrossRef]
  60. Caplan, M.S.; Russell, T.; Xiao, Y.; Amer, M.; Kaup, S.; Jilling, T. Effect of polyunsaturated fatty acid (PUFA) supplementation on intestinal inflammation and necrotizing enterocolitis (NEC) in a neonatal rat model. Pediatr. Res. 2001, 49, 647–652. [Google Scholar] [CrossRef] [PubMed]
  61. Yoshimura, A.; Mori, H.; Ohishi, M.; Aki, D.; Hanada, T. Negative regulation of cytokine signaling influences inflammation. Curr. Opin. Immunol. 2003, 15, 704–708. [Google Scholar] [CrossRef]
  62. Dai, C.; Zheng, J.; Qi, L.; Deng, P.; Wu, M.; Li, L.; Yuan, J. Chronic stress boosts systemic inflammation and compromises antiviral innate immunity in Carassius gibel. Front. Immunol. 2023, 14, 1105156. [Google Scholar] [CrossRef] [PubMed]
  63. Chen, Q.; Wang, C.; Sun, Y.; Chen, Y.; Chen, S.; Han, T.; Wang, J. Excessive Substitution of Fish Meal with Fermented Soybean Meal Induces Oxidative Stress by Impairing Glutathione Metabolism in Largemouth Bass (Micropterus salmoides). Antioxidants 2023, 12, 2096. [Google Scholar] [CrossRef]
  64. Carletto, D.; Furtado, F.; Zhang, J.; Asimakopoulos, A.G.; Eggen, M.; Verstege, G.C.; Faggio, C.; Mota, V.C.; Lazado, C.C. Mode of application of peracetic acid-based disinfectants has a minimal influence on the antioxidant defences and mucosal structures of atlantic salmon (Salmo salar) parr. Front. Physiol. 2022, 13, 900593. [Google Scholar] [CrossRef] [PubMed]
  65. Xu, Z.; Cao, J.; Qin, X.; Qiu, W.; Mei, J.; Xie, J. Toxic effects on bioaccumulation, hematological parameters, oxidative stress, immune responses and tissue structure in fish exposed to ammonia nitrogen: A review. Animals 2021, 11, 3304. [Google Scholar] [CrossRef]
  66. Wang, Y.; Branicky, R.; Noë, A.; Hekimi, S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J. Cell Biol. 2018, 217, 1915–1928. [Google Scholar] [CrossRef]
  67. Halliwell, B.; Gutteridge, J.M. Free Radicals in Biology and Medicine; Oxford University Press: New York, NY, USA, 2015. [Google Scholar]
  68. Egnew, N.; Renukdas, N.; Ramena, Y.; Yadav, A.K.; Kelly, A.M.; Lochmann, R.T.; Sinha, A.K. Physiological insights into largemouth bass (Micropterus salmoides) survival during long-term exposure to high environmental ammonia. Aquat. Toxicol. 2019, 207, 72–82. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Relative expression of appetite-related genes (A,B) in the brain of mandarin fish. (A) NPY = neuropeptide Y (npy); (B) POMC = pro-opiomelanocortin (pomc). Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Figure 1. Relative expression of appetite-related genes (A,B) in the brain of mandarin fish. (A) NPY = neuropeptide Y (npy); (B) POMC = pro-opiomelanocortin (pomc). Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Fishes 10 00078 g001
Figure 2. H&E-stained liver sections of mandarin fish. Nu, nucleus; Va, vacuole.
Figure 2. H&E-stained liver sections of mandarin fish. Nu, nucleus; Va, vacuole.
Fishes 10 00078 g002
Figure 3. Oil Red O-stained liver sections of mandarin fish. Ld, lipid droplet; Nu, nucleus; Va, vacuolization. Values are presented as mean ± SE (n = 12). Values in the same row with different letters indicate significant differences (p < 0.05).
Figure 3. Oil Red O-stained liver sections of mandarin fish. Ld, lipid droplet; Nu, nucleus; Va, vacuolization. Values are presented as mean ± SE (n = 12). Values in the same row with different letters indicate significant differences (p < 0.05).
Fishes 10 00078 g003
Figure 4. Relative expression of growth- and protein synthesis-related genes (AC), energy-sensing gene (D) and autophagy-related gene (E) in liver of mandarin fish. (A) MTOR = mechanistic target of rapamycin kinase (mtor); (B) S6K = ribosomal protein S6 kinase (s6k); (C) AKT = protein kinase B (akt); (D) AMPK = AMP-activated protein kinase (ampk); (E) FOXO1 = forkhead box O1 (foxo1). Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Figure 4. Relative expression of growth- and protein synthesis-related genes (AC), energy-sensing gene (D) and autophagy-related gene (E) in liver of mandarin fish. (A) MTOR = mechanistic target of rapamycin kinase (mtor); (B) S6K = ribosomal protein S6 kinase (s6k); (C) AKT = protein kinase B (akt); (D) AMPK = AMP-activated protein kinase (ampk); (E) FOXO1 = forkhead box O1 (foxo1). Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Fishes 10 00078 g004
Figure 5. Relative expression of lipid metabolism-related genes in the liver of mandarin fish. (A) ACC1 = acetyl-CoA carboxylase 1 (acc1); (B) FAS = fatty acid synthase (fas); (C) SREBP1 = sterol regulatory element-binding protein 1 (srebp1); (D) LPL = lipoprotein lipase (lpl); (E) HSL = hormone-sensitive lipase (hsl); (F) PPAR-α = peroxisome proliferator-activated receptor alpha (ppar-α); (G) CPT1 = carnitine palmitoyltransferase 1 (cpt1). Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Figure 5. Relative expression of lipid metabolism-related genes in the liver of mandarin fish. (A) ACC1 = acetyl-CoA carboxylase 1 (acc1); (B) FAS = fatty acid synthase (fas); (C) SREBP1 = sterol regulatory element-binding protein 1 (srebp1); (D) LPL = lipoprotein lipase (lpl); (E) HSL = hormone-sensitive lipase (hsl); (F) PPAR-α = peroxisome proliferator-activated receptor alpha (ppar-α); (G) CPT1 = carnitine palmitoyltransferase 1 (cpt1). Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Fishes 10 00078 g005
Figure 6. H&E-stained hindgut sections of mandarin fish.
Figure 6. H&E-stained hindgut sections of mandarin fish.
Fishes 10 00078 g006
Figure 7. Relative expression of tight junction protein-related genes (A,B) and inflammation-related genes (CE) in the mid-intestine of juvenile mandarin fish. (A) OCCLUDIN = occludin; (B) ZO-1 = zonula occludens-1 (zo-1); (C) TNF-α = tumor necrosis factor-α (tnf-α); (D) IL-1β = interleukin 1-β (il-1β); (E) P65 = NF-κB p65 (p65). Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Figure 7. Relative expression of tight junction protein-related genes (A,B) and inflammation-related genes (CE) in the mid-intestine of juvenile mandarin fish. (A) OCCLUDIN = occludin; (B) ZO-1 = zonula occludens-1 (zo-1); (C) TNF-α = tumor necrosis factor-α (tnf-α); (D) IL-1β = interleukin 1-β (il-1β); (E) P65 = NF-κB p65 (p65). Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Fishes 10 00078 g007
Table 1. Experimental diet formulation and nutrient composition (on an air-dry basis).
Table 1. Experimental diet formulation and nutrient composition (on an air-dry basis).
Ingredients (g kg−1 Diet)PF0PF17.5PF35.0PF52.5PF70.0
Steam-dried fish meal 1500.0412.5325.0237.5150.0
Vietnamese pansa fish meal8080808080
Poultry by-product meal 2105195285375.1465.1
Spray-dried porcine blood cell protein powder3030303030
Antarctic krill powder2020202020
Cottonseed protein6060606060
Cassava starch 3100100.4100.8101.2101.6
Soybean oil5041.633.124.716.2
Monocalcium phosphate1515151515
Microcrystalline cellulose05.511.116.522.1
Sodium chloride11111
Choline chloride (60%)44444
Ethoxyquin0.10.10.10.10.1
Propionic acid (50%)0.70.70.70.70.7
Vitamin premix 42020202020
Trace element premix 43.63.63.63.63.6
Rice hull powder10.68.87.15.53.8
Lysine01.22.43.54.7
Methionine00.50.91.41.8
Threonine00.10.20.20.3
Total1000.01000.01000.01000.01000.0
Nutritional levels
Crude protein (%)55.8455.5355.5955.0755.10
Crude lipid (%)12.5012.4512.3212.2312.11
Starch (%)9.569.389.829.529.90
1 Steam-dried fish meal (FM) containing 67.1% crude protein and 7.57% crude fat, made from anchovy (Engraulis ringens), processed by crushing, steaming, pressing, drying, cooling and packaging; origin: Lima, Peru, Tecnología de Alimentos S.A., 2023. 2 Poultry by-product meal (PBM) containing 65.96% crude protein and 16.71% crude fat, made from white feather broiler chicken carcasses (Gallus gallus domesticus), processed through crushing, steaming, oil pressing, drying and pulverizing; origin: Baldwin, United States, American Proteins Inc., 2023. 3 Cassava starch contains 0.12% crude protein and 0% crude fat. 4 The vitamin premix and trace element premix were supplied by Qingyuan Hailong Biotechnology Co., Ltd., Qingyuan, China.
Table 2. Fatty acid composition of experimental diets (percentage of total fatty acid mass) (the complete fatty acid composition of the diets is shown in Table S2).
Table 2. Fatty acid composition of experimental diets (percentage of total fatty acid mass) (the complete fatty acid composition of the diets is shown in Table S2).
Fatty AcidPF0PF17.5PF35.0PF52.5PF70.0
C18:1n-924.125.72829.632.6
C18:2n-628.929.326.424.422.4
C18:3n-33.383.322.762.391.88
C18:3n-60.1010.10.1280.1420.164
C20:4n-60.340.3220.3380.3450.347
C20:5n-33.492.822.3321.22
C22:6n-33.262.62.061.761.03
Others6.35.515.134.754.01
ΣSFAs 125.76425.88327.75428.97330.463
ΣMUFAs 228.21629.86932.76834.75938.201
ΣPUFAs 339.73538.73534.33831.38627.422
ΣC18 461.33163.3662.54862.00262.864
Σn-3 510.138.747.156.154.13
Σn-6 629.44829.83827.00425.03823.085
Σn-3 HUFAs 710.138.747.156.154.13
Σn-6 HUFA 80.5480.5380.6040.6380.685
ΣEFAs 939.0338.0433.5530.5526.53
The proportion of a specific fatty acid (%) = (Peak area of the specific fatty acid/Total peak area of all fatty acids) × 100. 1 ΣSFAs (saturated fatty acids) comprised C12:0, C14:0, C15:0,C16:0, C17:0, C18:0, C20:0, C22:0 and C24:0. 2 ΣMUFAs (monounsaturated fatty acids) comprised C14:1, C16:1, C18:1, C20:1, C22:1 and C24:1. 3 ΣPUFAs (polyunsaturated fatty acids) comprised C18:2n-6, C18:3n-3, C18:3n-6, C20:3n-9, C20:3n-6, C20:4n-6, C20:5n-3 and C22:6n-3. 4 ΣC18 (C18 fatty acids) comprised C18:0, C18:1n-9, C18:2n-6, C18:3n-3 and C18:3n-6. 5 Σn-3 fatty acids comprised C18:3n-3, C20:5n-3 and C22:6n-3. 6 Σn-6 fatty acids comprised C18:2n-6, C20:3n-6, C20:4n-6 and C22:2n-6. 7 Σn-3 HUFAs (highly unsaturated fatty acids) comprised C20:5n-3 and C22:6n-3. 8 Σn-6 HUFA comprised C20:4n-6. 9 ΣEFAs (essential fatty acids) comprised C18:2n-6, C18:3n-3, C20:5n-3 and C22:6n-3.
Table 3. Primer pairs for real-time quantitative PCR.
Table 3. Primer pairs for real-time quantitative PCR.
GeneForward (F)Reverse (R)Genbank Codes
rpl13aCACCCTATGACAAGAGGAAGCTGTGCCAGACGCCCAAGXM_044166826.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044166826.1
(accessed on 2 February 2025)
npyGTTGAAGGAAAGCACAGACAGCTCATAGAGGTAAAAGGGGXM_044172804.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044172804.1
(accessed on 2 February 2025)
pomcGTGTCATCCTCGTTACTGCGCGACGCTCCTATTCAATXM_044168860.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044168860.1
(accessed on 2 February 2025)
mtorGCATCAACGAGAGCACCACGCTTCAAAATTCATAACCGXM_044211706.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044211706.1
(accessed on 2 February 2025)
s6kCCTTCAAACCTTTCCTGCAATCATTTAACTGGGCTGAGAGGTGXM_044166943.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044166943.1
(accessed on 2 February 2025)
ampkGGGATGCAAACCAAGATGACAGACCCAGAGCGGAGAXM_044175461.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044175461.1
(accessed on 2 February 2025)
atkTGAATTCCTGTCCAGGTAACCACTTCACTCAGCCCTGTGAAGGXM_044165539.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044165539.1
(accessed on 2 February 2025)
foxo1AAAGCTCCTGGTGGATGCTGTCTTTGTGGCCCTTCCTCTGXM_044223788.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044223788.1
(accessed on 2 February 2025)
srebp1CTCCCTCCTTTCTGTCGGCTCTCATTTGCTGGCAGTCGTGGXM_044180668.1
https://www.ncbi.nlm.nih.gov/nuccore/XM_044180668.1
(accessed on 2 February 2025)
fasATGGAAATCACCCCTGTAATCTTCTTATCTGACTACGGAATGAATCGXM_044177556.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044177556.1
(accessed on 2 February 2025)
acc1TATGCCCACTTACCCAAATGCTGCCACCATACCAATCTCGTTXM_044221959.1
https://www.ncbi.nlm.nih.gov/nuccore/XM_044221959.1
(accessed on 2 February 2025)
ppar-αGGGTGTGCTCAGACAAGGCTGTTGCGGTTCTTCTTTTGGATXM_044194385.1
https://www.ncbi.nlm.nih.gov/nuccore/XM_044194385.1
(accessed on 2 February 2025)
cpt1ATGGTGTATTGGCTGGAGTCTCTGTGTGGTAGGTTTTCCTTGATXM_044192900.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044192900.1
(accessed on 2 February 2025)
hslACAAACGCCTGGGAATGGTTGTGGTCCGCCCTGAAGAAXM_044208783.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044208783.1
(accessed on 2 February 2025)
lplTTACCCCAATGGAGGCACTTCGGACCTTGTTGATGTTGTAGXM_044199514.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044199514.1
(accessed on 2 February 2025)
il-1βTGACTGACAGCAAGAAGAGGTTGTGGCAAGACAGGTAGAGXM_044173729.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044173729.1
(accessed on 2 February 2025)
tnf-αGAACGATGACGCCAAGAAGGGCAAACACACCAAAXM_044208266.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044208266.1
(accessed on 2 February 2025)
p65ACCACTAAGACCCACCCACAAACTCCTCCTCCCACAXM_044184929.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044184929.1
(accessed on 2 February 2025)
occludinAGATTGCTGGTCTGTGTGATAGTTGGTGCTTTCGTCXM_044199086.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044199086.1
(accessed on 2 February 2025)
zo-1GGATAGTGGAATCGGACGTGTTTTGGGGAGGGTGTAXM_044201318.1
https://www.ncbi.nlm.nih.gov/nucleotide/XM_044201318.1
(accessed on 2 February 2025)
Table 4. Effects of poultry by-product meal (PBM) replacement on growth performance and morphometric parameters of mandarin fish.
Table 4. Effects of poultry by-product meal (PBM) replacement on growth performance and morphometric parameters of mandarin fish.
ItemsPF0PF17.5PF35.0PF52.5PF70.0
IBW (g)33.57 ± 0.2833.54 ± 0.0433.22 ± 0.0833.44 ± 0.2433.61 ± 0.13
FBW (g)138.63 ± 5.31141.79 ± 5.56132.89 ± 2.20134.6 ± 1.60138.83 ± 3.36
WGR (%)312.84 ± 13.48322.73 ± 16.89300.02 ± 7.13302.52 ± 6.65313.01 ± 8.82
SR (%)96.56 ± 0.4497.00 ± 1.0298.00 ± 0.1997.78 ± 0.2998.00 ± 0.19
SGR (%)2.83 ± 0.072.88 ± 0.082.77 ± 0.032.79 ± 0.032.84 ± 0.04
FR (%)2.70 ± 0.05 ab2.78 ± 0.09 b2.79 ± 0.05 b2.71 ± 0.05 ab2.58 ± 0.03 a
FCR (%)1.14 ± 0.041.16 ± 0.071.16 ± 0.031.15 ± 0.031.07 ± 0.02
VSI (%)7.95 ± 0.48 ab8.36 ± 0.16 bc7.73 ± 0.14 ab7.29 ± 0.14 a8.98 ± 0.18 c
HSI (%)1.21 ± 0.05 a1.55 ± 0.03 c1.27 ± 0.03 a1.33 ± 0.04 ab1.44 ± 0.01 bc
IPF (%)0.78 ± 0.070.84 ± 0.090.80 ± 0.090.79 ± 0.070.80 ± 0.08
GSI (%)1.14 ± 0.13 a1.23 ± 0.09 a1.03 ± 0.11 a0.95 ± 0.07 a2.27 ± 0.12 b
Values are presented as mean ± SE. IBW, initial body weight; FBW, final body weight; WGR, weight gain rate; SGR, specific growth rate; FR, feeding ratio; FCR, feed conversion ratio (n = 3); VSI, viscerosomatic index; HSI, hepatosomatic index; IPF, intraperitoneal fat rate (n = 18). Values in the same row with different letters indicate significant differences (p < 0.05).
Table 5. Effects of FM replacement with PBM on whole-body and hepatic nutrient composition of mandarin fish.
Table 5. Effects of FM replacement with PBM on whole-body and hepatic nutrient composition of mandarin fish.
ItemsPF0PF17.5PF35.0PF52.5PF70.0
Whole fish
Moisture (%)74.89 ± 0.5173.78 ± 0.0774.74 ± 0.6274.15 ± 0.5074.7 ± 0.62
Crude protein (%)16.85 ± 0.14 a17.15 ± 0.18 ab17.45 ± 0.05 b17.53 ± 0.06 b16.98 ± 0.19 a
Crude lipid (%)1.29 ± 0.02 a1.65 ± 0.12 ab1.54 ± 0.17 ab1.37 ± 0.06 a1.82 ± 0.20 b
Liver
Moisture (%)69.54 ± 0.13 b69.92 ± 0.25 b70.95 ± 0.10 c70.85 ± 0.11 c68.01 ± 0.38 a
Crude protein (%)14.17 ± 0.25 b14.38 ± 0.37 b14.53 ± 0.03 b14.45 ± 0.22 b12.70 ± 0.27 a
Crude lipid (%)3.8 ± 0.05 a4.64 ± 0.28 ab5.28 ± 0.56 b4.81 ± 0.29 ab8.68 ± 0.33 c
Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Table 6. Effects of FM replacement with PBM on serum biochemical indices of mandarin fish.
Table 6. Effects of FM replacement with PBM on serum biochemical indices of mandarin fish.
ItemsPF0PF17.5PF35.0PF52.5PF70.0
TP (g/L)26.98 ± 0.82 a35.10 ± 2.97 b34.82 ± 2.81 b40.92 ± 0.71 bc46.23 ± 0.54 c
T-AOC (mmol/L)0.34 ± 0.002 a0.42 ± 0.001 b0.46 ± 0.003 c0.59 ± 0.002 d0.66 ± 0.001 e
TG (mmol/L)2.09 ± 0.04 c1.75 ± 0.18 b1.16 ± 0.07 a1.61 ± 0.05 b2.75 ± 0.09 d
CHO (mmol/L)2.32 ± 0.12 ab2.45 ± 0.14 b1.92 ± 0.17 a3.46 ± 0.04 c4.51 ± 0.21 d
HDL (mmol/L)1.20 ± 0.05 c1.10 ± 0.06 bc1.01 ± 0.06 ab1.25 ± 0.02 c0.87 ± 0.04 a
LDL (mmol/L)0.82 ± 0.05 a1.24 ± 0.16 b0.81 ± 0.07 a2.20 ± 0.16 c3.31 ± 0.13 d
HDL/LDL value1.47 ± 0.04 d1.17 ± 0.04 c1.26 ± 0.09 c0.57 ± 0.04 b0.26 ± 0.02 a
ALT (U/L)5.82 ± 0.58 a7.08 ± 0.53 a5.83 ± 0.39 a9.14 ± 0.08 b11.74 ± 0.72 c
AST (U/L)31.19 ± 0.80 a33.87 ± 2.47 ab30.59 ± 4.25 a31.39 ± 0.91 a40.69 ± 0.89 b
Values are presented as mean ± SE (n = 3). TP, total protein; T-AOC, total antioxidant capacity; TG, triglyceride; CHO, total cholesterol; HDL, high-density lipoprotein; LDL, low-density lipoprotein; ALT, alanine aminotransferase; AST, aspartate aminotransferase. Values in the same row with different letters indicate significant differences (p < 0.05).
Table 7. Effects of PBM replacement on the liver biochemical parameters of mandarin fish.
Table 7. Effects of PBM replacement on the liver biochemical parameters of mandarin fish.
ItemsPF0PF17.5PF35.0PF52.5PF70.0
GPX (U/mg prot)118.49 ± 8.46 a181.81 ± 6.55 c150.3 ± 7.21 b157.48 ± 6.57 b171.44 ± 5.21 bc
SOD (U/mg prot)288.03 ± 12.78 a367.27 ± 15.22 b339.92 ± 17.64 b351.22 ± 20.02 b348.07 ± 12.86 b
CAT (U/mg prot)2.34 ± 0.17 a3.01 ± 0.12 b2.54 ± 0.23 ab2.41 ± 0.25 ab3.03 ± 0.08 b
MDA (nmol/mg prot)0.064 ± 0.007 b0.068 ± 0.004 b0.063 ± 0.002 b0.065 ± 0.003 b0.049 ± 0.005 a
ALT (U/g prot)23.82 ± 0.97 a23.14 ± 0.62 a22.51 ± 1.74 a38.57 ± 1.05 c32.84 ± 1.36 b
AST (U/g prot)86.4 ± 7.42 b71.65 ± 3.21 a81.63 ± 1.55 a107.76 ± 3.76 c71.79 ± 1.26 ab
AST/ALT value3.53 ± 0.53 c3.29 ± 0.16 bc4.10 ± 0.16 c2.47 ± 0.30 ab2.17 ± 0.11 a
Values are presented as mean ± SE (n = 3). GPx, glutathione peroxidase; SOD, superoxide dismutase; CAT, catalase; MDA, malondialdehyde; ALT, alanine aminotransferase; AST, aspartate aminotransferase. Values in the same row with different letters indicate significant differences (p < 0.05).
Table 8. Effects of FM replacement with PBM on hindgut morphological indices of mandarin fish.
Table 8. Effects of FM replacement with PBM on hindgut morphological indices of mandarin fish.
ItemsPF0PF17.5PF35.0PF52.5PF70.0
Muscularis Thickness (µm)107.19 ± 6.54 b161.53 ± 11.32 c153.88 ± 5.63 c84.17 ± 3.11 a85.07 ± 6.69 a
Villus Number34.71 ± 1.08 a39.80 ± 1.07 b45.00 ± 1.95 c34.29 ± 1.29 a36.00 ± 1.00 ab
Villus Height (µm)702.05 ± 24.86 bc773.97 ± 27.57 c891.1 ± 27.33 d593.84 ± 23.12 a674.66 ± 24.62 b
Values are presented as mean ± SE (n = 3). Values in the same row with different letters indicate significant differences (p < 0.05).
Table 9. Effects of PBM replacement on acute ammonia nitrogen stress response in mandarin fish.
Table 9. Effects of PBM replacement on acute ammonia nitrogen stress response in mandarin fish.
ItemsPF0PF17.5PF35.0PF52.5PF70.0
SR (%)97.22 ± 2.78 c97.22 ± 2.78 c91.67 ± 4.81 c44.44 ± 5.56 b13.89 ± 2.78 a
Serum
MDA (mmol/L)6.57 ± 0.606.24 ± 0.286.89 ± 0.396.78 ± 0.196.89 ± 0.39
CAT (U/L)781.21 ± 43.31 b526.92 ± 33.5 a557.32 ± 60.38 a545.72 ± 68.54 a629.74 ± 49.22 ab
GPx (U/L)255.94 ± 23.93 c134.24 ± 9.01 ab100.69 ± 17.29 a135.06 ± 6.76 ab163.08 ± 21.00 b
SOD (U/L)2303.3 ± 82.03 a2614.89 ± 193.72 ab2571.19 ± 189.48 ab2898.86 ± 294.85 ab3013.81 ± 195.8 b
ALT (U/L)31.00 ± 4.74 a41.76 ± 5.88 ab63.26 ± 9.36 bc65.05 ± 10.18 bc87.46 ± 11.44 c
AST (U/L)31.33 ± 0.89 a34.41 ± 2.36 a44.19 ± 1.36 ab51.9 ± 4.40 b91 ± 10.44 c
Gill
Na+/K+ ATPase (U/g)23.41 ± 7.30 a47.47 ± 8.87 b36.42 ± 5.48 ab53.73 ± 4.72 b133.63 ± 7.61 c
Values are presented as mean ± SE (n = 3). SR, survival rate. Values in the same row with different letters indicate significant differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tang, S.; Ma, H.; Hua, X.; Wang, L.; Yun, B.; Zhu, X.; Qian, X. Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi. Fishes 2025, 10, 78. https://doi.org/10.3390/fishes10020078

AMA Style

Tang S, Ma H, Hua X, Wang L, Yun B, Zhu X, Qian X. Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi. Fishes. 2025; 10(2):78. https://doi.org/10.3390/fishes10020078

Chicago/Turabian Style

Tang, Shulin, Huanchao Ma, Xueming Hua, Lei Wang, Biao Yun, Xuan Zhu, and Xueqiao Qian. 2025. "Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi" Fishes 10, no. 2: 78. https://doi.org/10.3390/fishes10020078

APA Style

Tang, S., Ma, H., Hua, X., Wang, L., Yun, B., Zhu, X., & Qian, X. (2025). Effects of Fish Meal Replacement with Poultry By-Product Meal on Growth Performance, Lipid Metabolism, Hepatic–Intestinal Health and Ammonia Nitrogen Stress in Siniperca chuatsi. Fishes, 10(2), 78. https://doi.org/10.3390/fishes10020078

Article Metrics

Back to TopTop