A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci
Abstract
1. Introduction
2. Materials and Equipment
- Deionized H2O;
- Tryptic soy broth (TSB), agar technical (BD, Difco, USA);
- Defibrinated horse blood (Liofilchem, Italy);
- Antibiotics, glycerol, ethanol (Sigma-Aldrich, USA);
- Filter 0.2 µm (Minisart, Sartorius, Germany);
- Petri dishes, tubes, serological pipets, microtubes, micropipette tips, cotton swabs, toothpicks, syringes (Sarstedt, Germany);
- Laboratory glassware (Schott, UK);
- Incubators (KW Apparecchi Scientifici, Italy);
- Spectronic GENESYS 200 spectrophotometer (Thermo Scientific, USA);
- Heat block (FALC Instruments, Italy);
- White light transilluminator;
- VAPOUR-Line autoclave (VWR Avantor, USA).
3. Methods
3.1. Preparation of Media
- Liquid medium: Dissolve 30 g of TSB dehydrated medium in 1 L of deionized H2O and autoclave at 121 °C for 15 min (see Note 1). Add the appropriate antibiotics at the following concentrations when required: 3 µg mL−1 chloramphenicol, 0.5 µg mL−1 erythromycin, 500 µg mL−1 kanamycin, 10 µg mL−1 novobiocin, 100 µg mL−1 spectinomycin, 500 µg mL−1 streptomycin, 5 µg mL−1 tetracycline, 25 µg mL−1 fusidic acid, 25 µg mL−1 rifampicin.
- Solid medium: Add 1.5% agar to TSB liquid medium and autoclave at 121 °C for 15 min. Equilibrate TSA (TSB and agar) at 48 °C for 20 min. Add 5% defibrinated horse blood and the appropriate antibiotics at the concentrations reported in step 1 when required. Mix and pour 25 mL in each Petri dish. Leave to solidify for 20 min, dry at 42 °C for 30 min and store at 4 °C.
- Antibiotics such as kanamycin, novobiocin, spectinomycin, or streptomycin are resuspended in deionized H2O, sterilized by filtration with a 0.2 µm filter; chloramphenicol, erythromycin, tetracycline, and fusidic acid are resuspended in absolute ethanol; rifampicin is resuspended in methanol. Stock solutions are as follows: 10 mg mL−1 chloramphenicol, 2.5 mg mL−1 erythromycin, 100 mg mL−1 kanamycin, 10 mg mL−1 novobiocin, 50 mg mL−1 spectinomycin, 100 mg mL−1 streptomycin, 5 mg mL−1 tetracycline, 5 mg mL−1 fusidic acid, 25 mg mL−1 rifampicin. Antibiotics are stored in 1 mL aliquots at −20 °C (see Note 2).
- Glycerol is diluted two-fold (50%) in TSB.
3.2. Pre-Mating Preparation of Cells
- Thaw frozen starter cultures at 37 °C.
- Pre-warm TSB at 37 °C.
- Dilute frozen cultures 100 fold in TSB containing antibiotics and incubate at 37 °C.
- Grow donor and recipient cells separately until late exponential phase.
- Record the OD590 on a semi-log paper.
- Draw the growth curve and determine the duplication time.
- Freeze 2 mL mating starter cells at OD590 = 0.8 (approximately 5 × 108 CFU mL−1) in 10% glycerol (see Note 3).
3.3. Plate Mating
- Thaw frozen mating starter cultures (see Note 4).
- Mix 1:10 donor cells (100 µL) and recipient cells (900 µL) in a 1.5 mL microtube (see Note 5).
- Centrifuge the mixed cells at room temperature for 15 min at 3000 × g.
- Discard supernatant and resuspend the pelleted cells in 0.1 mL of TSB.
- Plate mixture on a blood-agar plate and incubate at 37 °C for 4 hours in a 5% CO2 enriched atmosphere.
- Harvest cells by scraping from the plate with a cotton swab and dissolve in a 1 mL of TSB/Glycerol 10%.
- Freeze mating samples at −70 °C (see Note 6).
3.4. Multilayer Plating
- Prepare TSA medium and equilibrate at 48 °C for 20 min.
- Pour a 17 mL base layer of TSA in Petri dishes and let the medium solidify.
- Dispense 2 mL of TSB supplemented with 10% horse blood in 5 mL slip-cap tubes.
- Put 13 mL slip-cap tubes into a heat block at 48 °C and distribute 6 ml of TSA per tube.
- Add appropriately diluted mating reactions into the 2 mL-TSB-containing tube (see Note 7).
- Combine 6 ml of TSA with the 2 mL of TSB blood cells, shake, and pour onto plate.
- Let the medium solidify, incubate at 37 °C for 90 min (phenotypic expression).
- Add an 8 ml third layer of TSA containing the appropriate antibiotics (see Note 8).
- Let the medium solidify, then incubate at 37 °C overnight (see Note 9).
- Score transconjugant cells, calculate conjugation efficiency as transconjugant per donor cells.
3.5. Genetic Analysis of Transconjugants
- Fit blood-agar plates on grids of the transilluminator device (see Note 10).
- Pick single colony isolates from conjugation plates by using sterile toothpicks and transfer to the plates placed on the illuminated grid.
- Incubate at 37 °C overnight in a 5% CO2 enriched atmosphere.
- Check the phenotypes of transconjugants (see Note 11).
- Isolate transconjugants from the genetic analysis plates on new plates containing the appropriate antibiotic.
- Incubate at 37 °C overnight in a 5% CO2 enriched atmosphere.
- Grow single colony isolates in TSB containing the appropriate antibiotic.
- Freeze transconjugant starter cultures (in exponential phase, OD590 = 0.2–0.3) in 10% glycerol at −70 °C.
4. Notes
- Other media, such as brain heart infusion (BHI) (Oxoid, UK) for streptococci and enterococci can be used. For Bacillus subtilis the Luria–Bertani (LB) medium (BD, Difco) was used.
- Due to light sensitivity, wrap the microtubes containing novobiocin, tetracycline, and rifampicin antibiotics in aluminum foil. Antibiotics may be stored at −20 °C for extended periods. When preparing antibiotic solutions wear protective clothing, gloves, and eye/face protection.
- Disposable frozen mating starter cells can be stored at −70°C for extended periods. The use of donor and recipient cells at a concentration of approximately 5 × 108 CFU mL−1 is mandatory
- Alternatively, fresh donor and recipient cell cultures may be used.
- Donor cells (100 µL) and recipient cells (900 µL) are also processed separately with the same procedure and included as controls for the conjugation experiment. The 1/10 donor/recipient cell ratio is mandatory.
- Mating reactions can be frozen at –70 °C and plated later. Comparable numbers of transconjugants can be obtained from fresh or frozen mating reactions.
- Dilutions are routinely plated as follows: 10−1 and 10−2 of the conjugation mixture for transconjugants selection, 10−6 and 10−7 for donor cells counts, 10−7 and 10−8 for recipient cells counts.
- We constructed new Streptococcus pneumoniae strains, FP10 and FP11, to be used as standard conjugation recipients to transfer MGEs from the original encapsulated clinical isolates. These strains: (i) lack the capsule, (ii) contain a deletion in the comC gene for competence stimulating peptide (CSP) and are impaired in natural competence for genetic transformation, and (iii) harbor the str-41 (FP10) and the nov-1 (FP11) point mutations conferring resistance to streptomycin and novobiocin, respectively. The absence of the polysaccharide capsule on the bacterial surface increases the efficiency of ICEs conjugal transfer [9]. The impairment in natural competence for genetic transformation allows us to rule out the contribution of transformation to the genetic exchange during conjugation (F. Iannelli and G. Pozzi, unpublished). The availability of two strains with different resistance markers allows transconjugants selection and to transfer the genetic elements from transconjugants again. Plating of the mating reactions includes: (i) plates containing both antibiotics for the resistance marker of the donor genetic element and for the chromosomal resistance marker of recipient strain; (ii) plates containing antibiotic for the resistance marker of the genetic element of the donor strain; and (iii) plates containing antibiotic for the chromosomal resistance marker of recipient strain. Appropriate antibiotics are added to this 8 ml TSA layer at the following concentrations: 5 µg mL-1 chloramphenicol, 1 µg mL−1 erythromycin, 1000 µg mL−1 kanamycin, 10 µg mL−1 novobiocin, 400 µg mL−1 spectinomycin, 1000 µg mL−1 streptomycin, 5 µg mL−1 tetracycline, 25 µg mL−1 fusidic acid, 25 µg mL−1 rifampicin. The multilayer plating allows: (i) a slow diffusion of the antibiotics in the agar layer containing bacteria, (ii) the visualization of the colony’s three-dimensional structure, (iii) a better count of the colonies since the plate is transparent and colonies are generally larger than when spread on a plate, and (iv) the prevention of contact with ambient air favoring the growth of fastidious bacteria.
- Incubation can be extended to 48 h if required.
- At this stage, carefully check the phenotype of the colonies in order to exclude isolation of spontaneous mutants or colonies which might grow even in the absence of any genotype conferring resistance. We built a transilluminating box apparatus equipped with an inner white light illuminating an upper plexiglass cover. An overhead transparency plotted with petri dish-size grids overlays the plexiglass. Blood-agar plates can be adjusted over the grids so that each plate is divided into a total of 100 sectors [10]. Plates used for the genetic analysis of transconjugants include: (i) a plate containing both antibiotics for the resistance marker of the donor genetic element and for the chromosomal resistance marker of the recipient strain; (ii) a plate containing the antibiotic for the resistance marker of the donor genetic element; (iii) a plate containing the antibiotic for the chromosomal resistance marker of recipient strain; and (iv) a plate containing no antibiotics. In the absence of a transilluminator device, naked eye observation is possible, constructing a grid using a Petri dish lid.
- Confirm the phenotypes of transconjugants by PCR genotyping using primers for the amplification of the ICE-chromosome junctions and for ICE internal region such as the resistance genes.
5. Results
6. Concluding Remarks
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Burrus, V.; Waldor, M.K. Shaping bacterial genomes with integrative and conjugative elements. Res. Microbiol. 2004, 155, 376–386. [Google Scholar] [CrossRef] [PubMed]
- Frost, L.; Leplae, R.; Summers, A.; Toussaint, A. Mobile genetic elements: The agents of open source evolution. Nat. Rev. Genet. 2005, 3, 722–732. [Google Scholar] [CrossRef] [PubMed]
- Santoro, F.; Iannelli, F.; Pozzi, G. Genomics and Genetics of Streptococcus pneumoniae. Microbiol. Spectr. 2019, 7. [Google Scholar] [CrossRef] [PubMed]
- Johnson, C.M.; Grossman, A.D. Integrative and Conjugative Elements (ICEs): What They Do and How They Work. Annu. Rev. Genet. 2015, 49, 577–601. [Google Scholar] [CrossRef] [PubMed]
- Santoro, F.; Romeo, A.; Pozzi, G.; Iannelli, F. Excision and Circularization of Integrative Conjugative Element Tn5253 of Strepto-coccus pneumoniae. Front. Microbiol. 2018, 9, 1779. [Google Scholar] [CrossRef] [PubMed]
- Santoro, F.; Vianna, M.E.; Roberts, A.P. Variation on a theme; an overview of the Tn916/Tn1545 family of mobile genetic elements in the oral and nasopharyngeal streptococci. Front. Microbiol. 2014, 5, 535. [Google Scholar] [CrossRef]
- Burrus, V.; Marrero, J.; Waldor, M.K. The current ICE age: Biology and evolution of SXT-related integrating conjugative elements. Plasmid 2006, 55, 173–183. [Google Scholar] [CrossRef] [PubMed]
- Ambroset, C.; Coluzzi, C.; Guédon, G.; Devignes, M.-D.; Loux, V.; Lacroix, T.; Payot, S.; Leblond-Bourget, N. New Insights into the Classification and Integration Specificity of Streptococcus Integrative Conjugative Elements through Extensive Genome Exploration. Front. Microbiol. 2016, 6, 1483. Available online: http://journal.frontiersin.org/Article/10.3389/fmicb.2015.01483/abstract (accessed on 21 July 2021). [CrossRef] [PubMed]
- Dahmane, N.; Robert, E.; Deschamps, J.; Meylheuc, T.; Delorme, C.; Briandet, R.; Leblond-Bourget, N.; Guédon, E.; Payot, S. Impact of Cell Surface Molecules on Conjugative Transfer of the Integrative and Conjugative Element ICE St3 of Streptococcus thermophilus. Appl. Environ. Microbiol. 2018, 84. [Google Scholar] [CrossRef] [PubMed]
- Iannelli, F.; Pozzi, G. Method for Introducing Specific and Unmarked Mutations into the Chromosome of Streptococcus pneumoniae. Mol. Biotechnol. 2004, 26, 81–86. [Google Scholar] [CrossRef]
- Santoro, F.; Oggioni, M.R.; Pozzi, G.; Iannelli, F. Nucleotide sequence and functional analysis of the tet (M)-carrying conjugative transposon Tn5251 of Streptococcus pneumoniae: Tn5251 of Streptococcus pneumoniae. FEMS Microbiol. Lett. 2010, 308, 150–158. [Google Scholar] [CrossRef] [PubMed]
- Iannelli, F.; Santoro, F.; Oggioni, M.R.; Pozzi, G. Nucleotide sequence analysis of integrative conjugative element Tn5253 of Strep-tococcus pneumoniae. Antimicrob. Agents Chemother. 2014, 58, 1235–1239. [Google Scholar] [CrossRef] [PubMed]
- Iannelli, F.; Santoro, F.; Santagati, M.; Docquier, J.-D.; Lazzeri, E.; Pastore, G.; Cassone, M.; Oggioni, M.R.; Rossolini, G.M.; Stefani, S.; et al. Type M Resistance to Macrolides Is Due to a Two-Gene Efflux Transport System of the ATP-Binding Cassette (ABC) Superfamily. Front. Microbiol. 2018, 9, 1670. [Google Scholar] [CrossRef] [PubMed]
- Iannelli, F.; Santagati, M.; Santoro, F.; Oggioni, M.R.; Stefani, S.; Pozzi, G. Nucleotide sequence of conjugative prophage Φ1207.3 (formerly Tn1207.3) carrying the mef(A)/msr(D) genes for efflux resistance to macrolides in Streptococcus pyogenes. Front. Microbiol. 2014, 5, 687. [Google Scholar] [CrossRef] [PubMed]
- Pozzi, G.; Iannelli, F.; Oggioni, M.R.; Santagati, M.; Stefani, S. Genetic Elements Carrying Macrolide Efflux Genes in Streptococci. Curr. Drug Target Infect. Disord. 2004, 4, 203–206. [Google Scholar] [CrossRef] [PubMed]
- Santagati, M.; Iannelli, F.; Cascone, C.; Campanile, F.; Oggioni, M.R.; Stefani, S.; Pozzi, G. The Novel Conjugative Transposon Tn1207.3 Carries the Macrolide Efflux Gene mef(A) in Streptococcus pyogenes. Microb. Drug Resist. 2003, 9, 243–247. [Google Scholar] [CrossRef] [PubMed]
- Provvedi, R.; Manganelli, R.; Pozzi, G. Characterization of conjugative transposon Tn5251 of Streptococcus pneumoniae. FEMS Microbiol. Lett. 1996, 135, 231–236. [Google Scholar] [CrossRef] [PubMed]

| Donor Strain (Properties) | ICE (Size) | Recipient Strain (Properties) | Transfer Frequency a | Genetic Analysis of Transconjugants(Primer Pairs) b | Ref. | |||
|---|---|---|---|---|---|---|---|---|
| attL–attTn | attR–attTn) | tet(M) | cat | |||||
| S. pneumoniae FR22 (FP10 transconjugant derivative, laboratory strain) | Tn5253 (65-kb) | S. pneumoniae FP11 (rough laboratory strain) | 1.6 × 10−4 ± 1.6 × 10−5 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF353-IF354 | [11] |
| S. pneumoniae FP47 (TIGR4 derivative, type 4 clinical strain) | 3.6 × 10−5 ± 1.7 × 10−6 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF353-IF354 | [11] | ||
| S. agalactiae H36B (Ib clinical strain) | 3.8 × 10−6 ± 5.3 × 10−7 | IF560-IF327 | IF328-IF561 | IF394-IF564 | IF353-IF354 | [11] | ||
| S. gordonii GP204 (V288 derivative, laboratory strain) | 2.5 × 10−5 ± 5.5 × 10−6 | IF512-IF327 | IF328-IF513 | IF394-IF564 | IF353-IF354 | [11] | ||
| S. pyogenes SF370 (M1 clinical strain) | 8.2 × 10−6 ± 7.5 × 10−7 | IF509-IF327 | IF328-IF510 | IF394-IF564 | IF353-IF354 | [11] | ||
| E. faecalis OG1RF (clinical strain) | 5.4 × 10−6 ± 5.5 × 10−7 | IF532-IF327 | IF328-IF525 | IF394-IF564 | IF353-IF354 | [11] | ||
| E. faecalis JH2-2 (clinical strain) | 8.6 × 10−7 ± 8.8 × 10−8 | IF532-IF327 | IF328-IF525 | IF394-IF564 | IF353-IF354 | [11] | ||
| S. pneumoniae 670-6B (type 6 clinical strain) | Tn5253-like (81-kb) | S. pneumoniae FP11 | 2.7 × 10−7 ± 8.1 × 10−8 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF353-IF354 | This study |
| S. pneumoniae ATCC700699 (type 23F clinical strain) | ICESp23FST81 (81-kb) | S. pneumoniae FP11 | 2.3 × 10−6 ± 1.0 × 10−6 | IF345-IF855 | IF327-IF347 | IF394-IF564 | IF353-IF354 | This study |
| S. pneumoniae FR58 (FP11 transconjugant derivative) | Tn5253 (65-kb) | S. pneumoniae FP58 (D39 derivative, type 2 clinical strain) | 1.9 × 10−5 ± 4.6 × 10−6 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF354-IF353 | [12] |
| S. pneumoniae HB394 (A66 derivative, type 3 clinical strain) | 4.4 × 10−7 ± 3.6 × 10−8 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF354-IF353 | [12] | ||
| S. pneumoniae FR55 (SP18-BS74 derivative, type 6 clinical strain) | 1.3 × 10−5 ± 2.8 × 10−6 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF354-IF353 | [12] | ||
| S. agalactiae FR67 (H36B transconjugant derivative) | Tn5253 (65-kb) | S. pneumoniae FP11 | 1.1 × 10−6 ± 3.5 × 10−7 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF354-IF353 | [12] |
| S. gordonii FR43 (GP204 transconjugant derivative) | Tn5253 (65-kb) | S. pneumoniae FP11 | 8.3 × 10−7 ± 2.9 × 10−7 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF354-IF353 | [12] |
| S. pyogenes FR40 (SF370 transconjugant derivative) | Tn5253 (65-kb) | S. pneumoniae FP11 | 6.7 × 10−3 ± 1.0 × 10−3 | IF325-IF327 | IF328-IF356 | IF394-IF564 | IF354-IF353 | [12] |
| S. pneumoniae FR22 | Tn5151 (18-kb) | S. pneumoniae FP47 | 1.5 × 10−6 ± 1.2 × 10−8 | IF394-IF564 | [11] | |||
| E. faecalis OG1RF | 5.4 × 10−6 ± 5.5 × 10−7 | IF394-IF564 | [11] | |||||
| E. faecalis JH2-2 | 8.6 × 10−7 ± 8.8 × 10−8 | IF394-IF564 | [11] | |||||
| S. gordonii FR70 (GP204 transconjugant derivative) | Tn5151 (18-kb) | S. pneumoniae FP11 | 3.1 × 10−7 ± 1.9 × 10−7 | IF394-IF564 | [11] | |||
| S. pyogenes FR71 (SF370 transconjugant derivative) | Tn5151 (18-kb) | S. pneumoniae FP11 | 3.3 × 10−5 ± 1.3 × 10−5 | IF394-IF564 | [11] | |||
| E. faecalis FR64 (OG1RF transconjugant derivative) | Tn5151 (18-kb) | S. gordonii GP204 | 4.8 × 10−5 ± 8.5 × 10−6 | IF394-IF564 | [11] | |||
| S. pyogenes SF370 | 9.1 × 10−7 ± 2.8 × 10−7 | IF394-IF564 | [11] | |||||
| E. faecalis OG1SS (clinical strain) | 1.3 × 10−6 ± 3.9 × 10−7 | IF394-IF564 | [11] | |||||
| B. subtilis 168 (laboratory strain) | 1.6 × 10−6 ± 5.1 × 10−7 | IF394-IF564 | [11] | |||||
| S. pneumoniae FR73 (FP47 transconjugant derivative) | Tn5151 (18-kb) | S. pneumoniae FP22 (rough D39 derivative ) | 2.6 × 10−8 ± 8.9 × 10−9 | IF394-IF564 | [11] | |||
| S. pneumoniae FP23 (rough TIGR4 derivative) | 1.2 × 10−7 ± 6.1 × 10−8 | IF394-IF564 | [11] | |||||
| S. pyogenes 2812A (clinical strain) | Φ1207.3 (53-kb) | S. pneumoniae FP10 | 3.8 × 10−5 ± 7.6 × 10−6 | IF281-IF127 | IF162-IF282 | This study | ||
| S. pneumoniae FR119 (FP10 transconjugant derivative) | Φ1207.3 (53-kb) | S. pyogenes SR300 (SF370 derivative strain) | 4.3 × 10−6 ± 1.1 × 10−6 | IF302-IF127 | IF162-IF303 | This study | ||
| Name | Sequence (5′ to 3′) | Target (Bacterial Species) | Direction |
|---|---|---|---|
| IF327 IF328 | CAATATAGCGTGATGATTGTAAT AGTGAGAATCAAATCAGAGGTT | 5’ end of Tn5253, Tn5253-like 3’ end of Tn5253, Tn5253-like | Reverse Forward |
| IF325 IF356 | ACAAGAACTGTTTGGACATCAT GACTAGATAGAGGCAAGCGT | Tn5253, Tn5253-like chromosomal integration site (S. pneumoniae) | Forward Reverse |
| IF560 IF561 | AACGAAACCTATCAGCGGAA TTTGGGTTTGTCTCCGACGA | Tn5253, Tn5253-like chromosomal integration site (S. agalactiae) | Forward Reverse |
| IF512 IF513 | TGCTTTAGGAGATGTTGAGTT ACCGCAGACTGTTCTTTAGA | Tn5253, Tn5253-like chromosomal integration site (S. gordonii) | Forward Reverse |
| IF509 IF510 | AAGTAGAAATGGCGAAGTGAA GACTAGAAAGTGGTAAGCGT | Tn5253, Tn5253-like chromosomal integration site (S. pyogenes) | Forward Reverse |
| IF532 IF525 | GCCTATGGGATTGCTACACC GGTTACGGGAAGAAAGCGGT | Tn5253, Tn5253-like chromosomal integration site (E. faecalis) | Forward Reverse |
| IF855 IF327 | ACCAAATTCCTGCCAGAGTTGA CAATATAGCGTGATGATTGTAAT | 5’ end of ICESp23FST81 3’ end of ICESp23FST81 | Reverse Forward |
| IF345 IF347 | ATGGTAATCATCTAAAAATGTCAC CACCAGCACTTGTTAAAGAAG | ICESp23FST81chromosomal integration site (S. pneumoniae) | Forward Reverse |
| IF394 IF564 | GCTATAGTATAAGCCATACTT GAAGTGACTTGTGCTCTGCT | Tn5253-family tet (M) resistance gene | Forward Reverse |
| IF354 IF353 | CATTCTCTGGTATTTGGACTC CTCTCCGTCGCTATTGTAAC | Tn5253-family cat resistance gene | Forward Reverse |
| IF127 IF162 | TGTTCTTCATCTACTACGACTG TGATGATTATATAAATTGTGAGTT | 5’ end of Φ1207.3 3’ end of Φ1207.3 | Reverse Forward |
| IF281 IF282 | AGGTGGTAAGGCAGAATC GCACCTTTGTTTGAGTCG | Φ1207.3 chromosomal integration site (S. pneumoniae) | Forward Reverse |
| IF302 IF303 | AATAGATGTAGGTGGGCG AGCTTTGGCAACCACTTC | Φ1207.3 chromosomal integration site (S. pyogenes) | Forward Reverse |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Iannelli, F.; Santoro, F.; Fox, V.; Pozzi, G. A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci. Methods Protoc. 2021, 4, 59. https://doi.org/10.3390/mps4030059
Iannelli F, Santoro F, Fox V, Pozzi G. A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci. Methods and Protocols. 2021; 4(3):59. https://doi.org/10.3390/mps4030059
Chicago/Turabian StyleIannelli, Francesco, Francesco Santoro, Valeria Fox, and Gianni Pozzi. 2021. "A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci" Methods and Protocols 4, no. 3: 59. https://doi.org/10.3390/mps4030059
APA StyleIannelli, F., Santoro, F., Fox, V., & Pozzi, G. (2021). A Mating Procedure for Genetic Transfer of Integrative and Conjugative Elements (ICEs) of Streptococci and Enterococci. Methods and Protocols, 4(3), 59. https://doi.org/10.3390/mps4030059

