Next Article in Journal
Riverside Landslide Susceptibility Overview: Leveraging Artificial Neural Networks and Machine Learning in Accordance with the United Nations (UN) Sustainable Development Goals
Next Article in Special Issue
Age and Growth of Hedinichthys yarkandensis (Day, 1877) in the Hotan River
Previous Article in Journal
Surrogate-Based Multiobjective Optimization of Detention Pond Volume in Sponge City
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Acute Thermal Stress Reduces Skeletal Muscle Growth and Quality in Gibel Carp (Carassius gibelio)

1
College of Fisheries, Hubei Hongshan Laboratory, Huazhong Agricultural University, Wuhan 430070, China
2
Engineering Research Center of Green Development for Conventional Aquatic Biological Industry in the Yangtze River Economic Belt, Ministry of Education, Wuhan 430070, China
3
Hubei Provincial Engineering Laboratory for Pond Aquaculture, Wuhan 430070, China
4
College of Life Sciences and Technology, Tarim University, Alar 843300, China
*
Authors to whom correspondence should be addressed.
Water 2023, 15(15), 2706; https://doi.org/10.3390/w15152706
Submission received: 2 June 2023 / Revised: 22 July 2023 / Accepted: 24 July 2023 / Published: 27 July 2023
(This article belongs to the Special Issue Effect of Aquatic Environment on Fish Ecology II)

Abstract

An acute elevation in temperature impacts fish physiology and in turn causes an alteration in growth performance. This study investigated the effect of acute thermal stress on skeletal muscle growth and quality in gibel carp (Carassius gibelio). The gibel carp were randomly assigned to three temperature treatments, 20 °C, 26 °C, and 32 °C, for 168 h. The muscular quality characteristics and the expressions of the genes related to muscle growth were assessed at 0 h, 1 h, 12 h, 24 h, 72 h, and 168 h. The muscle nutrient content was significantly higher in the 20 °C treatment, and the muscle was more tender and elastic. The gene expression levels of the MRFs family were significantly upregulated and then gradually decreased after 1 h. The expression level of MSTN-2 was increased in the 32 °C treatment at 168 h, in support of the slow growth rate under acute thermal stress. It is implied that gibel carp could adapt to acute thermal stress to a certain extent. Acute thermal stress, however, eventually led to a decrease in muscle growth rate and quality.

1. Introduction

A persistent and global issue is the rise in global water temperature brought on by the greenhouse effect [1]. Fish often face the dilemma of acute thermal stress, particularly during transport and seasonal changes. This can have negative impacts on their immune system, antioxidant capacity, muscle mass, and growth performance due to the drastic changes in their external environment [2,3,4].
It is universally acknowledged that fish muscle quality is influenced by a variety of inherent or external factors, such as the available nutrients, enzymes, genetics, climate, predators and so on [5,6,7,8,9]. Among them, stressors from the exogenous environment are often difficult to avoid during a period of factory farming or an experiment. As ectotherms, most fish live in waters with seasonal variations and, when the weather in their habitat changes suddenly and the water temperature exceeds their tolerance ability, it will have adverse consequences for the development, growth, reproduction, metabolism, and behaviour of the fish, and even lead to death [10,11,12,13,14]. In a cold stress study of Epinephelus coioides, both crude protein and crude fat deposition in muscle were found to be significantly reduced [15]. Some studies in zebrafish embryos found that acute extreme temperature treatment, whether low or high temperature, resulted in reduced aerobic performance and thermal sensitivity and a switch in muscle fibre type [16,17]. In a breeding trial with a heat stressor, it was found that the growth performance of Cyprinus carpio was significantly reduced after 60 days [18]. Cyprznus carpzo L. had the smoothest heart rate and metabolic frequency at 19.0 °C and, in the rest of the temperature conditions, both warming and cooling, sharp changes in heart rate and metabolic frequency were exhibited [19]. In addition to muscle nutrients, texture is also an important part of evaluating the quality of fillets. The texture of fish muscle is mainly related to myofiber properties. The type of myofibril, cross-sectional area, diameter, and myofibril density determine the textural properties and colour of fish muscles. Texture includes hardness, springiness, cohesiveness, gumminess, chewiness, resilience, and shear force. In fish, the hardness and elasticity of the muscle becomes greater as the fish grows, and the meat becomes tougher and tastes better [20]. The study observed the effects of incubating zebrafish embryos in three different temperature treatment groups—22 °C, 26 °C, and 31 °C. After hatching, the embryos were then reared at a constant temperature of 26 °C. The results showed a noticeable variation in the number of muscle fibres, with the trend being 26 °C > 31 °C > 22 °C [21]. During the yolk stage, the Dicentrarchus labrax L. was reared at two temperatures: natural temperatures of 15 °C and 17.7 °C. Subsequently, the larvae were transferred to a normal temperature environment. Muscle growth during the yolk stage was similar in the two experimental groups. However, at 25, 80, and 120 days, the 17.7 °C treatment group exhibited greater hypertrophy and hyperplasia of white muscle fibres (p < 0.05) [22].
From early embryonic cells through ultimate differentiation and maturity, fish muscle fibre formation and growth is a very complicated regulatory process that is influenced by a variety of signalling pathways and positive and negative transcription factors, as well as exogenous stress at various stages [23,24]. The MRFs family encodes four muscle-specific transcription factors—myogenic determining factor (Myod), myogenin (Myog), myogenic factor 5 (Myf5), and myogenic regulatory 4 (MRF4)—which control the entire process of muscle development, including stereotypy, proliferation, and myofibril formation from precursor myoblasts to postnatal muscle maturation and functional refinement [25]. This shows that the expression of MRFs is closely related to the improvement of muscle quality. The MRFs family first activates the entire regulatory network through an activation process and the MRFs family is activated in two pathways, by itself and by each other. Among myosatellite cells, Myf5 and Myod are the first to be expressed, causing myosatellite cells to differentiate into myogenic cells; Myog and MRF4 mainly cause myogenic cells to switch to terminal skeletal muscle fibres [26]. Myostatins (MSTNs) are genetically encoded muscle growth inhibitor proteins that maintain the resting state of myosatellite cells by negatively regulating the cell cycle circulating [27]. In experiments with zebrafish fasting for 0, 3, 7, and 14 d, zebrafish starved for 14 days showed a significant reduction in Myod gene expression [28]. Mouse studies show that MRF4 directly induces terminal differentiation of myoblasts, which is associated with muscle development, and that its absence may lead to muscle hypoplasia [29,30]. Myog expression level was discovered to be down-regulated at lower rearing temperatures in the study on Senegalese sole (Solea senegalensis), with smaller muscle fibre and a negative impact on muscle growth [31]. Piaractus mesopotamicus was farmed for 60 days at three different temperatures, 24 °C, 28 °C, and 32 °C. It was found that the expression of Myod was highest in the 24 °C treatment group on day 30 and day 60, suggesting that high temperatures may inhibit Piaractus mesopotamicus muscle growth [32]. In sea bass larvae, the highest levels of MRFs family and MyHC transcripts occurred at 8 °C but not in the 20 °C treatment group [33].
Gibel carp is a new variety selected and bred by Gui, an academic at the Chinese Academy of Sciences, and his team [34]. It has a good hybrid advantage as a hybridization of Carassius auratus gibelio and Cyprinus carpiouar singuonensis, with an obvious effect of increasing yield, and flesh is tender and nutritious [35]. The scales of gibel carp are tightly packed and not easily descaled. It is more stable in terms of genetic traits and has a low incidence of Myxobolus pharynae disease [36]. There exists a general consensus that increasing fish production is no longer the primary goal of aquaculture and that obtaining higher quality fish should be the goal [37,38].
Assessing the impact of acute thermal stress on muscle mass in gibel carp is critical since muscle is the most important and edible element of the fish from an economic standpoint. Even though there have been some studies on the effect of other environmental factors on the muscle quality of gibel carp, the association between acute thermal stress and the expression level of the MRFs family is poorly understood in aquatic organisms. Therefore, this study revealed, for the first time, the changes in muscle quality and muscle growth factors in gibel carp under acute thermal stress. The findings provide a scientific basis for changes in the economic value and welfare of fish under high temperature conditions.

2. Materials and Methods

2.1. Fish, Experimental Design and Sample Collection

All fresh fish originated from the same batch farmed by the Institute of Hydrobiology, CAS. One-hundred-and-eighty fish were stocked in separate tanks for at least 1 week for acclimatization before the experiment. During the period of acclimatization, they were fed 2% of their body weight. All fish with an initial average weight of 141.95 ± 25.32 g per tail were evenly and randomly divided into 9 tanks. The tanks used in the experiment were 0.5 m in diameter and were divided into three treatments including a room temperature treatment—20 °C (±1.9 °C), 26 °C (±0.30 °C), and 32 °C (±0.49 °C). Heating rods with a power of 500 watts were used to control the water temperature, and the heating rate was 0.5 °C per hour, equally. The water in the tank was replaced daily by a recirculating aquaculture system with circulating water preheated to the set temperature for each experiment and the water temperature was measured every 6 h. The water in the tanks was replaced daily with circulating water preheated to the set temperature for each experiment. The experiment lasted for 168 h and no food was given during that period. Finally, the back white muscle samples of gibel carp were collected at 0 h, 1 h, 12 h, 24 h, 72 h, and 168 h, respectively. Three fish were randomly sampled from each tank at each time point. Fish were anesthetized with MS222 (Yuanye Bio. Co. Ltd., Shanghai, China); once a fish had become significantly less active in the water and was salvaged, it would be deconstructed for each sample collection. Samples of dorsal muscle were collected at 0 h, 1 h, 12 h, 24 h, 72 h, and 168 h for growth relative gene expression level analysis. Texture measurements, shear force, histological observation, and chemical analysis were performed on the back muscle samples collected at 168h only (Figure 1). Three replicates were applied in each experimental treatment.

2.2. Cumulative Mortality Rate and Histological Observation

The number of dead fish was recorded daily to calculate the mortality rate in the three temperature treatments. Three 1 cm × 1 cm × 0.5 cm size back muscle samples were randomly selected from the three temperature treatments and were immersed in 4% paraformaldehyde (Biosharp Bio. Co. Ltd., Anhui, China) for histological observation. Histological observation was performed based on histological paraffin section techniques and hematoxylin-eosin (H & E) staining according to the method described by Zhao et al. [39]. The diameters of back muscle fibres in three independent visual fields at different positions of each cross-section were randomly recorded, their average values were calculated for the muscle fibre diameter (μm) [40], and the distance between fibres was recorded to assess the muscle quality.

2.3. Muscle Texture Measurements

A muscle texture assay was performed as described by Lu et al. [41]. Nine fish were randomly selected from each of the three temperature treatments and two muscle samples were collected above the lateral line and below the dorsal fin, both of which were 1 cm × 1 cm × 0.8 cm in size. After collecting the back muscle samples from each culture temperature, a texture profile analysis (TPA) and a shear force test were performed immediately at room temperature. Probe P/36R was equipped for the double compression TPA test, the post-test speed was 1 mm/s, the test speed was 1 mm/s, and the test strain was 65%. The highest peaks were manually selected after the determination of the TPA test and calculated the indicators of hardness, springiness, cohesiveness, gumminess, chewiness, and resilience. The type of loading probe was Auto-5 g for the shear force test and the shear distance was set to 3 mm. The TPA test and the shear force test were run once for each filet sample and both tests were conducted at room temperature.

2.4. Chemical Analysis

Moisture was obtained after drying samples in an oven at 105 °C for 9 h. The samples were then taken out and cooled to room temperature at three hour intervals and weighed until the difference between the two weights did not exceed 2 mg. The determination of ash content was first carbonised in an electric furnace (Hanon Analytical Co., Ltd., Jinan, China) until it was smokeless, after which it was measured with a Muffle Furnace (Hanon Analytical Co., Ltd., Jinan, China) at 550 °C for 9 h. The concentration of crude protein was measured using the Kjeldahl method, which determines nitrogen content (N × 6.25) using a Tecator Kjeltec 8400 distillation unit (FOSS Analytical Co., Ltd., Suzhou, China) after sample digestion. The content of crude lipid was determined gravimetrically using the Soxhlet method. The fishmeal was wrapped in filter paper and cotton thread before being weighed, and the dried fishmeal was extracted with anhydrous ether (Yuanye Bio. Co., Ltd., Shanghai, China) and weighed after extraction.

2.5. RNA Extraction and RT-qPCR

The total RNA of the back muscles was extracted using Trizol Reagent (Takara, Tokyo, Japan). The concentration and purity of the RNA was evaluated using a Nano Drop 8000 Spectrophotometer (Nano Drop, Boston, MA, USA) and agarose gel electrophoresis, respectively. Reverse transcription was performed when the results of the Nano Drop 8000 Spectrophotometer showed that the values of A260/A280 and A260/A230 were both greater than 2.0, and when agarose gel electrophoresis band images were clear and bright, indicating reliable RNA quality. The total RNA was used as a template for reverse transcription using the Hifair® III 1st Strand cDNA Synthesis Super Mix for qPCR (gDNA digester plus) kit (YEASEN). Primers of Myog, Myod, MRF4, MSTN-1, and MSTN-2 genes were synthesized by Wuhan Tianyihuiyuan Biotechnology Co. (Wuhan, China) and are presented in Table 1. All genes for which relative quantification was performed were normalized with β-actin. All experiments were performed in triplicates.
The expression results were calculated by using the 2−ΔΔCT method and normalization after verification that the primers amplified with an efficiency of approximately 100%.

2.6. Statistical Analysis

The experimental data were expressed as mean ± SE, using a one-way variance analysis (ANOVA) and a t-test in SPSS 22.0 (IBM, Armonk, NY, USA); the results of the statistical analysis were deemed significant at an alpha level of 0.05. For the quantitative statistics of the histological observation, the mapping software Image J 1.53k was employed (NIH, Bethesda, MD, USA). For each gene (Myog, Myod, MRF4, MSTN-1, MSTN-2), data from qRT-PCR were optimized by comparative Ct (2−∆∆CT) value to compute the relative gene expression level in the three temperature treatments of gibel carp [42]. For histological observation and gene expression level tests, asterisks (*) indicate statistical significance compared to the control group, * p < 0.05, ** p < 0.01 and *** p < 0.001. As for muscle textural analysis, different superscripts were used to show the significance (p < 0.05).

3. Results

3.1. Cumulative Mortality Rate and Structure of Muscle Fiber of C. gibelio

During the acute thermal stress trial, six fish perished in the 32 °C treatment, representing a 10% mortality rate, while no fish perished in the other temperature treatment groups.
Figure 2A exhibited the H & E staining sections of the white dorsal muscle of gibel carp under different water temperature treatments. Figure 2B,C showed the quantitative analysis of the images in Figure 2A. The analyses indicated significantly higher muscle fibre diameter for the 20 °C and 26 °C treatments compared to the 32 °C treatment at 168 h (p < 0.01). Furthermore, the average fibre interstitium in the 32 °C treatment was significantly higher than those in 20 °C treatment (p < 0.05).

3.2. Effect of Acute Thermal Stress on Muscle Texture of C. gibelio

Measure indexes related to muscle texture are presented in Table 2. The indicators that exhibited significant differences were muscle hardness, gumminess, and chewiness, which exhibited the same trend, with the largest values occurring in the 20 °C treatment group. The 20 °C group was significantly higher than the 26 °C and 32 °C groups in the three indicators (p < 0.05) and also performed better at springiness, adhesiveness, cohesiveness, and resilience. The shear force was inversely proportional to the tenderness of the fillets, showing that the tenderest fillets were those treated at 20 °C. The difference between all indicators was not statistically significant in the 26 °C and 32 °C groups except for shear force.
For the eight muscle texture markers used to assess muscle composition, PCA models were created, and a degree of clustering between samples in the three temperature treatments was observed (Figure 3). PC1 and PC2 contributed 39.2% and 18.1% to the variation sources, respectively. Indicators gumminess and cohesiveness have the greatest impact on PC1 and indicators hardness and adhesiveness have the greatest impact on PC2. The value points for the 32 °C treatment group appeared more to the left of the 0 point of PC1, whereas the value points for the 20 °C treatment appeared more to the right of the 0 point, indicating that the 32 °C group had a lower than average level of muscle texture. Consequently, the 20 °C and 32 °C treatments showed greater separation between groups due to temperature differences. Muscle texture levels were more similar in the 26 °C and 32 °C treatments.

3.3. Muscle Nutrient Contents of C. gibelio

The fresh weight values of moisture, crude protein, crude fat, and crude ash contents are presented in order in Figure 4. Compared to groups 26 °C and 32 °C, water content was significantly lower in the 20 °C treatment group, indicating that 168 h of thermal stress reduced the content of other nutrients in gibel carp muscle. Acute thermal stress also significantly reduced protein deposition in the 32 °C treatment with a further decrease in crude fat content. A comparison of nutrient content values revealed that water concentration in the dorsal muscle increased and the protein content decreased with the increase of stocking temperature, with crude ash content exhibiting the highest value in the 26 °C treatment group.

3.4. Effect of Acute Thermal Stress on MRFs Family Related Genes Expression Level of C. gibelio

Compared with the 20 °C treatment group, the 26 °C and 32 °C treatment groups exhibited significantly higher mRNA levels of Myog, Myod, MRF4, and MSTN-1 at 1 h, whereas the expression of MSTN-2 showed a significant increase only in the 32 °C treatment group. The peak expression of all genes appeared at 1 h, except for Myod and MSTN-2, whose peak expression appeared at 12 h after the acute thermal stress. Although the peaks appeared at different times, the results showed that all genes had a similar expression pattern in gibel carp, with an upsurge followed by a gradual decline (Figure 5). The minimum gene expression values of the positively regulatory genes associated with muscle growth all occurred at 168 h, which may indicate that the MRFs family expression and the growth of gibel carp were inhibited after acute heat stress.

4. Discussion

Teleost fish experience increased morbidity and mortality when water temperatures exceed their optimal range for survival due to fluctuating heating [43,44,45]. In our experiments, six of the sixty fish in the 32 °C treatment group died, with a mortality rate of 10%, while no mortality occurred in the other two temperature treatments, consistent with previous studies. Thus, we speculate that the occurrence of these deaths was attributed to the difference in water temperature, because gibel carp is typically a cold-water fish and 32 °C might exceed its maximum temperature tolerance.
There is no standardized criterion for the evaluation of fish muscle quality, and people have different preferences for the texture of fish fillets [46]. Indicators such as hardness, springiness, cohesiveness, and shear force directly relate to muscle texture [47], as the results showed that the back muscle in the 20 °C treatment was softer and more tender. Changes in fillet texture are related to several factors, which include the changes in muscle fibre density, diameter, and the melting of myostromin, a major protein in connective tissue [48]. Hardness, springiness, and shear force are the main indicators of the texture of freshwater fish muscles of all the texture indicators [49,50]. It has been shown that the finer and denser the muscle, the more tender the muscle, and the better the quality of the muscle, the better the taste, and the easier it is to digest and absorb [51,52,53]. The shear force of the 20 °C treatment group was lower in the current study, and the hardness, gumminess, and cohesiveness of the 32 °C treatment group were significantly lower than those of the 20 °C treatment group, indicating that the muscle treated at 20 °C was more tender, had a better taste, and had a superior muscle quality. The PCA analyses of all muscle texture indexes also demonstrates that the 20 °C treatment group had the best muscle quality levels of all the temperature groups.
Muscle growth is largely dependent on the stability of protein turnover in teleost, in terms of both synthesis and degradation [54]. High temperatures above the tolerance range of the fish reduce protein deposition in skeletal muscle, which in turn slows down fish growth [55]. Researchers have different opinions about the effects of thermal stress on the protein and lipid content of livestock muscle. In studies on broilers, it has been found that thermal stress leads to a decrease in the content of some crude components in the breast muscle, which reduces the nutritional value of the broiler [56,57]. However, the opposite result was found in studies concerning pigs, where sustained thermal stress increased the content of nutrients in the muscle [58,59]. In summary, our results are similar to those of the broiler study; we speculated that acute thermal stress induced the reduction of gibel carp and might have a negative effect on protein deposition and a positive effect on moisture content.
Muscle growth in vertebrates is classified as restricted or unrestricted. In mammals, muscle growth is an increase in muscle fibre volume with no change in number, which is typical of restrictive growth [60]. Fish have both myofiber proliferation growth and hypertrophic growth. The contribution of myofibrillar growth and hypertrophic growth to fish growth depends on the species and the size of the fish [61]. Slow-growing fish, such as zebrafish, rely mostly on expanding existing myofibers rather than on producing new ones, whereas fast-growing species, such as toothfish, rely on both myofiber proliferation and hypertrophic growth [62]. The MRFs family plays a crucial role in both of these muscle growth processes. During the first process of muscle growth, the positive regulator factor, Myod, influences muscle fibre thickening, and Myog and MRF4 affect the muscle mass and the number of muscle fibres during the second process. The negative regulators MSTN-1 and MSTN-2 keep skeletal muscle satellite cells in their resting state by preventing myogenic cells from cycling from G1 to S phase [63]. The expression levels of all genes in the 32 °C treatment showed a significant increase within 1 h after the start of the experiment, indicating that the gibel carp were affected by thermal stress and changed body homeostasis in 32 °C treatment, which then gradually decreased to below the initial state after 168 h. Similar results have been reported in many other animals under short-term stress, including Siniperca chuatsi [64], Gadus morhua [65], and Oreochromis niloticus [66]. MSTN-1 and MSTN-2 have the ability to inhibit the proliferation of myogenic cells, and deletion of these genes leads to an increase in skeletal muscle mass [67]. The elevated expressions of MSTN-1 in back muscle indicated that thermal stress may contribute to the decreased muscle growth of fish. Moreover, the low mRNA expression levels of Myod and MRF4 at 168 h may be due to the acute thermal stress and may lead to the subsequent slow growth of gibel carp.

5. Conclusions

Acute thermal stress causes increased mortality and decreased muscle quality and mass in gibel carp (Carassius gibelio). The 32 °C and 26 °C treatment groups first induced the gene expression of MRFs family and later repressed the expression, thus leading to a decrease in muscle fibre diameter and an increase in gap, ultimately causing a deterioration in taste. Compared to the stimulatory effect of the 32 °C treatment, 20 °C was optimal for muscle growth. These results provide a reference for the adverse effects of rapid climate change on muscle quality in aquaculture.

Author Contributions

Conceptualization, Q.H.; methodology, Q.H.; formal analysis, Q.H.; investigation, Q.H., J.L. (Jiamin Lu) and Y.Y.; data curation, Q.H.; writing—original draft preparation, Q.H.; writing—review and editing, Q.H., J.L. (Jiamin Lu), J.L. (Jieya Liu) and D.L.; project administration, D.L. and J.L. (Jieya Liu); funding acquisition, D.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by China Agriculture Research System (grant number CARS-45-23) and the National Natural Science Foundation of China (grant number 31502140).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors appreciate Dapeng Li, for his guidance and assistance. The authors also thank Jiamin Lu and Yu Yang for them generous help through this time of struggle together.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Raval, A.; Ramanathan, V. Observational determination of the greenhouse effect. Nature 1989, 342, 758–761. [Google Scholar] [CrossRef] [Scilit]
  2. Peng, X.K.; Zhang, Y.; Huang, X.Y.; Zhou, G.C.; Xing, X.N.; Zhang, E.P. Effects of acute cold stress on immune function and expression of heat shock protein 70 family genes in different tissues in sheep. Acta. Vet. Zootec. Sin. 2019, 50, 1625–1634. [Google Scholar]
  3. Bolzan, L.P.; Barroso, D.C.; Souza, C.F.; Oliveira, F.C.; Wagner, R.; Baldisserotto, B.; Val, A.L.; Baldissera, M.D. Dietary supplementation with nerolidol improves the antioxidant capacity and muscle fatty acid profile of Brycon amazonicus exposed to acute heat stress. J. Therm. Biol. 2021, 99, 103003. [Google Scholar] [CrossRef] [Scilit]
  4. Wu, X.Y.; Lai, J.S.; Chen, Y.Y.; Liu, Y.; Song, M.J.; Li, F.Y.; Gong, Q. Characterization of MRF genes and their tissue distributions and analysis of the effects of starvation and refeeding on the expression of these genes in Acipenser dabryanus muscle. Comp. Biochem. Phys. B 2021, 256, 110648. [Google Scholar] [CrossRef] [Scilit]
  5. Habeeb, A.A.; Marai, I.F.; Kamal, T.H. Farm Animals and the Environment, 1st ed.; C.A.B. International: Örebro, Sweden, 1992; pp. 27–47. [Google Scholar]
  6. Sealey, W.M.; Gaylord, T.G.; Toner, M.; Ilgen, J.; Fraser, W.C.; Hooley, C.G.; Barrows, F.T. Growth and acute temperature tolerance of June Sucker juveniles fed varying dietary protein and lipid levels with and without supplemental dicalcium phosphate. N. Am. J. Aquac. 2013, 75, 124–132. [Google Scholar] [CrossRef] [Scilit]
  7. Doke, S.N.; Warrier, S.B.; Ninjoor, V.; Nadkarni, G.B. Role of hydrolytic enzymes in the spoilage of fish. J. Food. Sci. Technol. 1979, 16, 223–226. [Google Scholar]
  8. Paneru, B.D.; Al-Tobasei, R.; Kenney, B.; Kenney, B.; Leeds, T.D.; Salem, M. RNA-Seq reveals MicroRNA expression signature and genetic polymorphism associated with growth and muscle quality traits in rainbow trout. Sci. Rep. 2017, 7, 9078. [Google Scholar]
  9. Barbosa, V.; Maulvault, A.L.; Alves, R.N.; Anacleto, P.; Pousao-Ferreira, P.; Carvalho, M.; Nunes, M.L.; Rosa, R.; Marques, A. Will seabass (Dicentrarchus labrax) quality change in a warmer ocean? Food. Res. Int. 2017, 97, 27–36. [Google Scholar] [CrossRef] [Scilit]
  10. Schirone, R.C.; Gross, L. Effect of temperature on early embryological development of the zebra fish, Brachydanio rerio. J. Exp. Zool. 1968, 169, 43–52. [Google Scholar] [CrossRef] [Scilit]
  11. Björnsson, B.; Tryggvadóttir, S.V. Effects of size on optimal temperature for growth and growth efficiency of immature Atlantic halibut (Hippoglossus hippoglossus L.). Aquaculture 1996, 142, 33–42. [Google Scholar] [CrossRef] [Scilit]
  12. Mahanty, A.; Purohit, G.K.; Mohanty, S.; Mohanty, B.P. Heat stress–induced alterations in the expression of genes associated with gonadal integrity of the teleost Puntius sophore. Fish. Physiol. Biochem. 2019, 45, 1409–1417. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Lu, Y.; Wu, Z.; Song, Z.; Xiao, P.; Liu, Y.; Zhang, P.; You, F. Insight into the heat resistance of fish via blood: Effects of heat stress on metabolism, oxidative stress and antioxidant response of olive flounder Paralichthys olivaceus and turbot Scophthalmus maximus. Fish Shellfish. Immunol. 2016, 58, 125–135. [Google Scholar] [PubMed]
  14. López-Olmeda, J.F.; Sánchez-Vázquez, F.J. Thermal biology of zebrafish (Danio rerio). J. Therm. Biol. 2011, 36, 91–104. [Google Scholar] [CrossRef] [Scilit]
  15. Luo, S.W.; Cai, L.; Liu, Y.; Wang, W.N. Functional analysis of a dietary recombinant Fatty acid binding protein 10 (FABP10) on the Epinephelus coioides in response to acute low temperature challenge. Fish Shellfish. Immunol. 2014, 36, 475–484. [Google Scholar] [PubMed]
  16. Scott, G.R.; Johnston, I.A. Temperature during embryonic development has persistent effects on thermal acclimation capacity in zebrafish. Proc. Natl. Acad. Sci. USA 2012, 109, 14247–14252. [Google Scholar]
  17. Malek, R.L.; Sajadi, H.; Abraham, J.; Grundy, M.A.; Gerhard, G.S. The effects of temperature reduction on gene expression and oxidative stress in skeletal muscle from adult zebrafish. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2004, 138, 363–373. [Google Scholar]
  18. Armobin, K.; Ahmadifar, E.; Adineh, H.; Samani, M.N.; Kalhor, N.; Yilmaz, S.; Van, D.H. Quercetin application for common carp (Cyprinus carpio): I. effects on growth performance, humoral immunity, antioxidant status, immune-related genes, and resistance against heat stress. Aquac. Nutr. 2023, 2023, 1168262. [Google Scholar]
  19. Moffitt, B.P.; Crawshaw, L.I. Effects of acute temperature changes on metabolism, heart rate, and ventilation frequency in carp Cyprinus carpio L. Physiol. Biochem. Zool. 1983, 56, 397–403. [Google Scholar]
  20. Johnston, I.A.; Alderson, R.; Sandham, C.; Dingwall, A.; Mitchell, D.; Selkirk, C.; Nickell, D.; Baker, R.; Robertson, B.; Whyte, D.; et al. Muscle fibre density in relation to the colour and texture of smoked Atlantic salmon (Salmo salar L.). Aquaculture 2000, 189, 335–349. [Google Scholar]
  21. Johnston, I.A.; Lee, H.T.; Macqueen, D.J.; Paranthaman, K.; Kawashima, C.; Anwar, A.; Kinghorn, J.R.; Dalmay, T. Embryonic temperature affects muscle fibre recruitment in adult zebrafish: Genome-wide changes in gene and microRNA expression associated with the transition from hyperplastic to hypertrophic growth phenotypes. J. Exp. Biol. 2009, 212, 1781–1793. [Google Scholar]
  22. López-Albors, O.; Ayala, M.D.; Gil, F.; Garcıa-Alcázar, A.; Abellán, E.; Latorre, R.; Ramírez-Zarzosa, G.; Vázquez, J.M. Early temperature effects on muscle growth dynamics and histochemical profile of muscle fibres of sea bass Dicentrarchus labrax L., during larval and juvenile stages. Aquaculture 2003, 220, 385–406. [Google Scholar]
  23. Refaey, M.M.; Li, D.; Tian, X.; Zhang, Z.; Zhang, X.; Li, L.; Tang, R. High stocking density alters growth performance, blood biochemistry, intestinal histology, and muscle quality of channel catfish Ictalurus punctatus. Aquaculture 2018, 492, 73–81. [Google Scholar]
  24. Bugeon, J.; Lefevre, F.; Fauconneau, B. Fillet texture and muscle structure in brown trout (Salmo trutta) subjected to long-term exercise. Aquac. Res. 2003, 34, 1287–1295. [Google Scholar]
  25. Zammit, P.S. Function of the myogenic regulatory factors Myf5, MyoD, Myogenin and MRF4 in skeletal muscle, satellite cells and regenerative myogenesis. Semin. Cell Dev. Biol. 2017, 72, 19–32. [Google Scholar] [CrossRef] [Scilit]
  26. Hernández, J.M.; García-González, E.G.; Brun, C.E.; Rudnicki, M.A. The myogenic regulatory factors, determinants of muscle development, cell identity and regeneration. Semin. Cell Dev. Biol. 2017, 72, 10–18. [Google Scholar] [CrossRef] [Scilit]
  27. McPherron, A.C.; Lawler, A.M.; Lee, S.J. Regulation of skeletal muscle mass in mice by a new TGF-p superfamily member. Nature 1997, 387, 83–90. [Google Scholar]
  28. Wu, Y.; You, X.; Sun, W.; Xiong, G.Q.; Shi, L.; Qiao, Y.; Wu, W.J.; Xin, L.; Jun, W.; Anzi, D.; et al. Insight into acute heat stress on meat qualities of rainbow trout (Oncorhynchus mykiss) during short-time transportation. Aquaculture 2021, 543, 737013. [Google Scholar]
  29. Rudnicki, M.A.; Schnegelsberg, P.N.; Stead, R.H.; Braun, T.; Arnold, H.H.; Jaenisch, R. MyoD or Myf-5 is required for the formation of skeletal muscle. Cell 1993, 75, 1351–1359. [Google Scholar] [CrossRef] [Scilit]
  30. Tajbakhsh, S.; Rocancourt, D.; Cossu, G.; Buckingham, M. Redefining the genetic hierarchies controlling skeletal myogenesis: Pax-3 and Myf-5 act upstream of MyoD. Cell 1997, 89, 127–138. [Google Scholar] [PubMed]
  31. Campos, C.; Valente, L.; Conceicao, L.; Engrola, S.; Fernandes, J. Temperature affects methylation of the myogenin putative promoter, its expression and muscle cellularity in Senegalese sole larvae. Epigenetics 2013, 8, 389–397. [Google Scholar] [PubMed]
  32. De, P.T.G.; De, A.F.L.A.; Carani, F.R.; Vechetti-Júnior, I.J.; Padovani, C.R.; Salomao, R.A.S.; Dal-Pai-Silva, M.; Vander, B.; Maeli, D. Rearing temperature induces changes in muscle growth and gene expression in juvenile pacu (Piaractus mesopotamicus). Comp. Biochem. Phys. B 2014, 169, 31–37. [Google Scholar]
  33. Wilkes, D.; Xie, S.Q.; Stickland, N.C.; Alami-Durante, H.; Kentouri, M.; Sterioti, A.; Goldspink, G. Temperature and myogenic factor transcript levels during early development determines muscle growth potential in rainbow trout (Oncorhynchus mykiss) and sea bass (Dicentrarchus labrax). J. Exp. Biol. 2001, 204, 2763–2771. [Google Scholar]
  34. Zhou, L.; Wang, Y.; Gui, J.F. Analysis of genetic heterogeneity among five gynogenetic clones of silver crucian carp, Carassius auratus gibelio Bloch, based on detection of RAPD molecular markers. Cytogenet. Genome. Res. 2000, 88, 133–139. [Google Scholar]
  35. Li, Z.; Liang, H.; Wang, Z.; Zou, G.; Gui, J. Comparative analysis on the flesh quality and nutrient component of tetraploid gibel carp “changfeng” variety. Acta. Hydrobiol. Sin. 2016, 40, 853–858. [Google Scholar]
  36. Cang, P.; Zhang, M.; Qiao, G.; Sun, Q.; Xu, D.; Li, Q.; Yuan, X.; Liu, W. Analysis of Growth, Nutrition and Economic Profitability of Gibel Carp (Carassius auratus gibelio♀ × C. carpio♂) Cultured in Zero-water Exchange System. Pak. J. Zool. 2019, 51, 619. [Google Scholar] [CrossRef] [Scilit]
  37. Gui, J.; Zhu, Z. Molecular basis and genetic improvement of economically important traits in aquaculture animals. Chin. Sci. Bull. 2012, 57, 1751–1760. [Google Scholar] [CrossRef] [Scilit]
  38. Valente, L.M.; Moutou, K.A.; Conceicao, L.E.; Engrola, S.; Fernandes, J.M.; Johnston, I.A. What determines growth potential and juvenile quality of farmed fish species? Rev. Aquac. 2013, 1, 168–193. [Google Scholar] [CrossRef] [Scilit]
  39. Zhao, H.; Xia, J.; Zhang, X.; He, X.; Li, L.; Tang, R.; Li, D. Diet affects muscle quality and growth traits of grass carp (Ctenopharyngodon idellus): A comparison between grass and artificial feed. Front. Physiol. 2018, 9, 283. [Google Scholar] [PubMed]
  40. Zhang, L.; Xu, N.; Liu, X.; Onxayvieng, K.; Liu, L.; Tang, R.; Li, D. Exercise training accelerates UPS-and mTOR-mediated protein turnover of grass carp Ctenopharyngodon idella. Aquaculture 2021, 545, 737252. [Google Scholar]
  41. Lu, J.; Li, S.; He, X.; Tang, R.; Li, D. An in-pond tank culture system for high-intensive fish production: Effect of stocking density on growth of grass carp (Ctenopharyngodon idella Valenciennes, 1844) and blunt snout bream (Megalobrama amblycephala Yih, 1955). Aquaculture 2022, 549, 737808. [Google Scholar]
  42. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar]
  43. Jeffries, K.M.; Hinch, S.G.; Sierocinski, T.; Clark, T.D.; Eliason, E.J.; Donaldson, M.R.; Li, S.R.; Pavlidis, P.; Miller, K.M. Consequences of high temperatures and premature mortality on the transcriptome and blood physiology of wild adult sockeye salmon (Oncorhynchus nerka). Ecol. Evol. 2012, 2, 1747–1764. [Google Scholar] [CrossRef] [Scilit]
  44. Kim, K.H.; Hwang, Y.J.; Kwon, S.R. Influence of daily water temperature changes on the chemiluminescent response and mortality of cultured rockfish (Sebastes schlegeli). Aquaculture 2001, 192, 93–99. [Google Scholar] [CrossRef] [Scilit]
  45. Dulger, N.; Kumlu, M.; Turkmen, S.; Olculu, A.; Yilmaz, H.A.; Ocal, N. Thermal tolerance of European Sea Bass (Dicentrarchus labrax) juveniles acclimated to three temperature levels. J. Therm. Biol. 2012, 37, 79–82. [Google Scholar] [CrossRef] [Scilit]
  46. Dunajski, E. Texture of fish muscle. J. Texture. Stud. 1980, 10, 301–318. [Google Scholar]
  47. Hyldig, G.; Nielsen, D. A review of sensory and instrumental methods used to evaluate the texture of fish muscle. J. Texture Stud. 2001, 32, 219–242. [Google Scholar]
  48. Taylor, R.G.; Fjaera, S.O.; Skjervold, P.O. Salmon fillet texture is determined by myofiber-myofiber and myofiber-myocommata attachment. J. Food Sci. 2002, 67, 2067–2071. [Google Scholar] [CrossRef] [Scilit]
  49. Hultmann, L.; Turid, R. Iced storage of Atlantic salmon (Salmo salar)–effects on endogenous enzymes and their impact on muscle proteins and texture. Food Chem. 2004, 87, 31–41. [Google Scholar]
  50. Periago, M.J.; Ayala, M.D.; López-Albors, O.; Abdel, I.; Martínez, C.; García-Alcázar, A.; Ros, G.; Gil, F. Muscle cellularity and flesh quality of wild and farmed sea bass, Dicentrarchus labrax L. Aquaculture 2005, 249, 175–188. [Google Scholar] [CrossRef] [Scilit]
  51. Cheng, J.H.; Sun, D.W.; Han, Z.; Zeng, X.A. Texture and structure measurements and analyses for evaluation of fish and fillet freshness quality: A review. Compr. Rev. Food Sci. Food Saf. 2014, 13, 52–61. [Google Scholar] [PubMed]
  52. Lee, J.S.; Cook, M.A.; Luckenbach, J.A.; Berejikian, B.A.; Simchick, C.A.; Oden, S.M.; Goetz, F.W. Investigation of long-term effects of larval rearing temperature on growth, deformities, flesh quality, and phenotypic sex of cultured sablefish (Anoplopoma fimbria). Aquaculture 2017, 479, 91–99. [Google Scholar]
  53. Hatae, K.; Yoshimatsu, F.; Matsumoto, J.J. Role of muscle fibers in contributing firmness of cooked fish. J. Food Sci. 1990, 55, 693–696. [Google Scholar] [CrossRef] [Scilit]
  54. Johnston, I.A.; Bower, N.I.; Macqueen, D.J. Growth and the regulation of myotomal muscle mass in teleost fish. J. Exp. Biol. 2011, 214, 1617–1628. [Google Scholar] [CrossRef] [Scilit]
  55. Lin, F.; Lin, J.; Liu, X.; Yuan, Y.; Liu, G.; Ye, X. Effects of temperature on muscle growth and collagen deposition in zebrafish (Danio rerio). Aquacult. Rep. 2022, 22, 100952. [Google Scholar]
  56. Baziz, H.A.; Geraert, P.A.; Padilha, J.C.; Guillaumin, S. Chronic heat exposure enhances fat deposition and modifies muscle and fat partition in broiler carcasses. Poult. Sci. 1996, 75, 505–513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  57. Zhang, Z.Y.; Jia, G.Q.; Zuo, J.J.; Zhang, Y.; Lei, J.; Ren, L.; Feng, D.Y. Effects of constant and cyclic heat stress on muscle metabolism and meat quality of broiler breast fillet and thigh meat. Poult. Sci. 2012, 91, 2931–2937. [Google Scholar] [CrossRef] [Scilit]
  58. Lefaucheur, L.; Le, D.J.; Mourot, J.; Monin, G.; Ecolan, P.; Krauss, D. Influence of environmental temperature on growth, muscle and adipose tissue metabolism, and meat quality in swine. J. Anim. Sci. 1991, 69, 2844–2854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Lopez, J.; Goodband, R.D.; Allee, G.L.; Jesse, G.W.; Nelssen, J.L.; Tokach, M.D.; Becker, B.A. The effects of diets formulated on an ideal protein basis on growth performance, carcass characteristics, and thermal balance of finishing giltshoused in a hot, diurnal environment. J. Anim. Sci. 1994, 72, 367–379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Choi, Y.M.; Yeunsu, S.; Sangsu, S.; Kichoon, L. Skeletal muscle characterization of Japanese quail line selectively bred for lower body weight as an avian model of delayed muscle growth with hypoplasia. PLoS ONE 2014, 9, e95932. [Google Scholar]
  61. De, A.; Carvalho, R.; Pinhal, D.; Padovani, C.; Martins, C.; Dal, P. Differential expression of myogenic regulatory factor MyoD in pacu skeletal muscle (Piaractus mesopotamicus Holmberg 1887: Serrasalminae, Characidae, Teleostei) during juvenile and adult growth phases. Micron 2008, 39, 1306–1311. [Google Scholar]
  62. Lee, B.; Lee, B.J.; Lee, Y.; Hur, S.W.; Kim, K.D.; Kim, K.W.; Kim, H.S.; Han, S.S.; Jeehwan, C.; Kichoon, L.; et al. Muscle fiber growth in olive flounder, Paralichthys olivaceus: Fiber hyperplasia at a specific body weight period and continuous hypertrophy. J. World Aquac. Soc. 2019, 50, 593–603. [Google Scholar]
  63. Zammit, P.S.; Relaix, F.; Nagata, Y.; Ruiz, A.P.; Collins, C.A.; Partridge, T.A.; Beauchamp, J.R. Pax7 and myogenic progression in skeletal muscle satellite cells. J. Cell Sci. 2006, 119, 1824–1832. [Google Scholar] [PubMed]
  64. Zhu, X.; Hu, J.; Zhang, J.; Liu, J.; Bao, L.; Pan, Y.; Chu, W. Effect of short-term fasting and glucocorticoids on KLF15 expression and branched-chain amino acids metabolism in Chinese perch. Aquacult. Rep. 2021, 19, 100617. [Google Scholar]
  65. Caipang, C.M.A.; Monica, F.B.; Viswanath, K. Short-term overcrowding of Atlantic cod, Gadus morhua: Effects on serum-mediated antibacterial activity and transcription of glucose transport and antioxidant defense related genes. Comp. Biochem. Phys. A 2008, 151, 560–565. [Google Scholar]
  66. Jun, Q.; Hong, Y.; Hui, W.; Didlyn, K.M.; Jie, H.; Pao, X. Physiological responses and HSP70 mRNA expression in GIFT tilapia juveniles, Oreochromisniloticus under short-term crowding. Aquac. Res. 2015, 46, 335–345. [Google Scholar]
  67. Zheng, G.D.; Sun, C.F.; Pu, J.W.; Chen, J.; Jiang, X.Y.; Zou, S.M. Two myostatin genes exhibit divergent and conserved functions in grass carp (Ctenopharyngodon idellus). Gen. Comp. Endocr. 2015, 214, 68–76. [Google Scholar]
Figure 1. Sampling timeline of the acute thermal stress experiment.
Figure 1. Sampling timeline of the acute thermal stress experiment.
Water 15 02706 g001
Figure 2. H & E stained sections (original magnification ×100, transverse section) of muscle tissue from gibel carp under three temperature treatments are shown in (A). The muscle fibre diameter and muscle fibre gap statistics under the three temperature treatments are shown in (B,C). An asterisk (*) indicates statistical significance compared to the 20 °C treatment, * p < 0.05, ** p < 0.01.
Figure 2. H & E stained sections (original magnification ×100, transverse section) of muscle tissue from gibel carp under three temperature treatments are shown in (A). The muscle fibre diameter and muscle fibre gap statistics under the three temperature treatments are shown in (B,C). An asterisk (*) indicates statistical significance compared to the 20 °C treatment, * p < 0.05, ** p < 0.01.
Water 15 02706 g002
Figure 3. PCA score plots for the muscle texture indicators of gibel carp from three temperature treatments.
Figure 3. PCA score plots for the muscle texture indicators of gibel carp from three temperature treatments.
Water 15 02706 g003
Figure 4. The nutrition contents of moisture, crude protein, crude lipid, and crude ash in white muscle of gibel carp in three temperature treatments. An asterisk (*) indicates statistical significance compared to the 20 °C treatment, * p < 0.05.
Figure 4. The nutrition contents of moisture, crude protein, crude lipid, and crude ash in white muscle of gibel carp in three temperature treatments. An asterisk (*) indicates statistical significance compared to the 20 °C treatment, * p < 0.05.
Water 15 02706 g004
Figure 5. RT-qPCR analysis of mRNA levels of Myog (A), Myod (B), MRF4 (C), MSTN-1 (D), and MSTN-2 (E) in white dorsal muscle of gibel carp from various temperature treatments. Gene expression levels represented the relative mRNA expression compared to the 20 °C treatment group. An asterisk (*) indicates statistical significance compared to the 20 °C treatment, * p < 0.05, ** p < 0.01, *** p < 0.01.
Figure 5. RT-qPCR analysis of mRNA levels of Myog (A), Myod (B), MRF4 (C), MSTN-1 (D), and MSTN-2 (E) in white dorsal muscle of gibel carp from various temperature treatments. Gene expression levels represented the relative mRNA expression compared to the 20 °C treatment group. An asterisk (*) indicates statistical significance compared to the 20 °C treatment, * p < 0.05, ** p < 0.01, *** p < 0.01.
Water 15 02706 g005
Table 1. The primer sequences for genes cloning and expression in the study of gibel carp.
Table 1. The primer sequences for genes cloning and expression in the study of gibel carp.
PrimerForward Sequence (5′ to 3′)Reverse Sequence (5′ to 3′)
MyogGGACGCACTGCTCCACTCTGAGGAACATCAGCAGGGAAACC
MyodGAGAGCATCCAGAGGGCATCAGTTCTACCTGGCCTCCAGT
MRF4CTGCGACGGTCAGTGTCTAATGTCAGCCTCTGGTTCGGATTGG
MSTN-1TCAGTCCGAAGATCCAAGCGTCCTGCGTTCACGTCGATTT
MSTN-2TGCATGCCATCAAGTCCCAATCATCCCCCAGAACGTCGTA
β-actinCATTGACTCAGGATGCGGAAACTCTGTGAGGGCAGAGTGGTAGACG
Table 2. Comparison of eight texture indicators at three different temperature treatments of the back muscle of gibel carp.
Table 2. Comparison of eight texture indicators at three different temperature treatments of the back muscle of gibel carp.
Parameters20 °C26 °C32 °C
Hardness (g)5049.92 ± 113.16 a4427.19 ± 72.00 b3953.51 ± 337.20 b
Adhesiveness−21.16 ± 1.18−18.52 ± 1.45−17.00 ± 4.32
Springiness0.57 ± 0.020.57 ± 0.020.55 ± 0.04
Cohesiveness (g)0.31 ± 0.010.28 ± 0.010.30 ± 0.01
Gumminess (g)1565.84 ± 37.16 a1205.91 ± 68.04 b1207.96 ± 40.45 b
Chewiness952.66 ± 65.41 a722.06 ± 14.17 b729.58 ± 47.04 b
Resilience0.15 ± 0.010.14 ± 0.010.15 ± 0.01
Shear force558.96 ± 4.61 a626.76 ± 2.95 b704.63 ± 17.14 c
Note: Different superscripts show statistical significance between groups (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hu, Q.; Lu, J.; Yang, Y.; Li, D.; Liu, J. Acute Thermal Stress Reduces Skeletal Muscle Growth and Quality in Gibel Carp (Carassius gibelio). Water 2023, 15, 2706. https://doi.org/10.3390/w15152706

AMA Style

Hu Q, Lu J, Yang Y, Li D, Liu J. Acute Thermal Stress Reduces Skeletal Muscle Growth and Quality in Gibel Carp (Carassius gibelio). Water. 2023; 15(15):2706. https://doi.org/10.3390/w15152706

Chicago/Turabian Style

Hu, Qixin, Jiamin Lu, Yu Yang, Dapeng Li, and Jieya Liu. 2023. "Acute Thermal Stress Reduces Skeletal Muscle Growth and Quality in Gibel Carp (Carassius gibelio)" Water 15, no. 15: 2706. https://doi.org/10.3390/w15152706

APA Style

Hu, Q., Lu, J., Yang, Y., Li, D., & Liu, J. (2023). Acute Thermal Stress Reduces Skeletal Muscle Growth and Quality in Gibel Carp (Carassius gibelio). Water, 15(15), 2706. https://doi.org/10.3390/w15152706

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop