Next Article in Journal
Genetically Modified Plants Based on Bacillus Genes and Commercial Bacillus-Based Biopesticides for Sustainable Agriculture
Next Article in Special Issue
Identification of an Entomopathogenic Fungus, Pseudozyma flocculosa (Traquair, Shaw & Jarvis), and Its Efficacy against Tetranychus urticae Koch
Previous Article in Journal
Effect of Different Postharvest Methods on Essential Oil Content and Composition of Three Mentha Genotypes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 9
10.3390/horticulturae9090962
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Splicing and Expression Regulation of fruitless Gene in Bemisia tabaci (Hemiptera: Aleyrodidae)

by
Yating Liu
1,
Jinxi Xie
1,
Wenlu Wang
2,
Yanyuan Lei
3,
Xuguo Zhou
4,
Youjun Zhang
2 and
Wen Xie
2,*
1
School of Food Science and Engineering, Foshan University, Foshan 528225, China
2
Department of Plant Protection, Institute of Vegetables and Flowers, Chinese Academy of Agricultural Sciences, Beijing 100081, China
3
Guangdong Provincial Key Laboratory of High Technology for Plant Protection, Plant Protection Research Institute, Guangdong Academy of Agricultural Sciences, Guangzhou 510640, China
4
Department of Entomology, University of Kentucky, Lexington, KY 40546-0091, USA
*
Author to whom correspondence should be addressed.
Horticulturae 2023, 9(9), 962; https://doi.org/10.3390/horticulturae9090962
Submission received: 30 June 2023 / Revised: 15 August 2023 / Accepted: 21 August 2023 / Published: 24 August 2023
(This article belongs to the Special Issue Advancement in Mechanism of Vegetable Pest Catastrophe and Green Prevention and Control)
Browse Figures
Review Reports Versions Notes

Abstract

:
The fruitless (fru) gene is a key factor in controlling sexual behavior in insects. The homolog of fru has been identified in most insect species and exhibits conservation in the transcript architecture and regulation of male sexual behavior. However, the structure of fru transcripts in Hemiptera remains unknown. Here, we identified and characterized two fru transcripts in Bemisia tabaci, named fru-a and fru-b. fru-a contained a 1263 bp open reading frame (ORF) encoding for 420 amino acids, while fru-b contained a 1143 bp ORF encoding for 380 amino acids. These two proteins start with the same BTB domain and end with two different zinc finger domains, belonging to ZnA and ZnG, respectively. The expression of fru-a and fru-b differed significantly between females and males, and both were expressed at lower levels in males. We demonstrated the presence of multiple TRA/TRA-2 binding sites and alternative splicing in fru-a and fru-b. Moreover, the RNAi result provided evidence that transformer regulates the expression of fru-a and fru-b. These results promote the study of the sex determination cascade in B. tabaci and lay the foundation for the study of sexual behavior in this insect.

1. Introduction

The mechanisms of sex determination in insects are diverse. Even among closely related species, the mechanisms for determining sex are different. Its divergent model comprises four levels of sex-determining regulators: primary signal > key gene > double-switch gene > sex-differentiation gene. The primary signal is variable among insect species, resulting in repression or activation of the key gene. The active state of this key gene is conveyed by alternative splicing of a conserved double-switch gene. This switch gene then transmits similar splicing information to the sex differentiation genes, which ultimately translate the molecular signal into a specific sexual phenotype. In Drosophila melanogaster (Diptera: Drosophilidae), the model is a well-characterized genetic hierarchy X:A > Sxl > tra/tra2 > dsx and fru [1]. This cascade appears to control sex determination in all Drosophila species and is partially conserved in other insect species, especially the tra > dsx and fru regulatory modules [2].
Transformer (tra) is a master regulator of sex determination in many insects. It not only regulates its own sex-specific alternative splicing, but also controls the splicing of downstream target genes dsx and fru [3]. Doublesex (dsx) is a double-switch gene that controls sexually dimorphic characteristics at the bottom of the somatic sex determination cascade and is functionally conserved in many insect species [4]. Fruitless (fru) is the downstream sex-differentiation gene that controls sexual behavior. It was originally found to be related to regulating the development of the muscle of Lawrence (MOL), a male-specific structure in the abdomen of D. melanogaster [5]. Later, it was found that fru controls the formation of sexual dimorphisms in neurons and regulates male courtship, copulation, and even aggressive behavior [6,7]. Now, it is clear that fru is the switch gene for sexual behavior in Drosophila and is involved in the regulation of almost all male sexual behaviors [8]. Recently, various fru homologs were identified in distantly related insect species, including Aedes aegypti (Diptera: Culicidae), Anopheles gambiae (Diptera: Culicidae), Bactrocera dorsalis (Diptera: Tephritidae), B. correcta, Nasonia vitripennis (Hymenoptera: Pteromalidae), Bombyx mori (Lepidoptera: Bombycidae), Gryllus bimaculatus (Orthoptera: Gryllidae), Schistocerca gregaria (Orthoptera: Acrididae), and Blattella germanica (Blattodea: Blattellidae) [9,10,11,12,13,14,15]. In all of these insects, fru has been shown to be the primary regulator of male sexual behavior. This suggests that, despite the evolution of insects, the regulation of sexual behavior by fru is conserved. Therefore, fru has become the starting point for understanding the genetic determination of sexual behaviors.
The structure of the Fru protein is strikingly similar: it starts with a highly conserved protein–protein interaction module, the BTB domain, and ends with 1-4 exons encoding zinc finger domains [16]. In D. melanogaster, the fru gene forms a set of transcription factors by using four different promoters (P1–P4) and a large number of alternative splicing. Among them, the fru transcripts regulating male sexual behavior are directed from the most-distal P1 promoter. In females, tra and tra2 splice P1-directed fru transcripts into female specific isoforms and prevent their translation. In males, due to the lack of active TRA protein, fru undergoes default splicing and translates into the FruM protein [17]. Neurons expressed by FruM connect with other neurons to form sexually dimorphic circuits that control male mating behavior [18]. Sex-specific splicing isoforms of fru have also been demonstrated in other non-Drosophila insects. In most insects, the sex-specific splicing of fru is regulated by upstream tra [16]. However, whether this mode is conserved in Hemiptera is not yet known.
The whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae), is an important worldwide invasive pest that has a unique reproductive pattern. That is, the haplodiploid sex-determination model: males are haploid; females are diploid. The parthenogenesis and sexual reproduction of the whitefly coexist. Unmated females only give birth to haploid males, and mated females can give birth to both males and females [19]. Previously, we identified 26 sex-determining genes in B. tabaci and confirmed by RNAi the interaction between Btdsx and Bttra2 and their important role in male genital formation, as well as the relationship between Btix and female fertility [20,21,22,23]. In addition, we identified a number of candidate genes for female mating response by transcriptomic analysis [24]. However, the mechanism of mating behaviors in B. tabaci males remains a mystery. In this paper, we characterized the fru gene in B. tabaci, explored the alternative splicing of Btfru in adults, and provide evidence that Bttra regulates the expression of Btfru. Our results deepen the understanding of sex-differentiation genes in B. tabaci and promote the study of sex-determination mechanisms in B. tabaci.

2. Materials and Methods

2.1. Insect Strains

The Q biotype Bemisia tabaci (Mediterranean, MED) strain used in this study was originally collected in Beijing, China, in 2009. Since then, the population has been reared on cotton in a naturally lit greenhouse with an ambient temperature of 25 ± 1 °C and a humidity of 70 ± 5%. Mitochondrial cytochrome oxidase I (mtCOI) markers were used every 2–3 generations to confirm population purity.

2.2. Sample Collection

Samples of eggs, 1st-, 2nd-, 3rd-, and 4th-instar nymphs and newly emerged females and males of the whitefly were collected, snap frozen in liquid nitrogen, and stored at −80 °C for subsequent experiments.
Clean, insect-free cotton was placed in an insect cage, and the plants were removed after 3 days of egg-laying. Then, the eggs were collected on this as egg-stage samples. The remaining egg-bearing cotton seedlings were placed in a clean insect-free cage and raised in a greenhouse. Five days later, when the whitefly had hatched, it was collected as a first-instar sample. Eight days later, it was collected as a second-instar sample. Twelve days later, it was collected as a third-instar sample, and sixteen days later, it was collected as a fourth-instar sample. When collecting the newly emerged female and male adults, the original adults on the leaves were first sucked away, and then, the emerged adults were collected in microscopic tubes (5.0 × 0.5 cm) after 1 h. Each tube contained 1 adult, and the sex of the insects was distinguished under a stereomicroscope. A total of 3 biological replicates were collected for each group of samples.

2.3. RNA Extraction and cDNA Synthesis

Total RNA was extracted by TRIzol reagent (Life Technologies). The purity and quantity of RNA were measured using NanoDrop 2000. RNA integrity was detected by 1% Tris/Borate/EDTA (TBE) agarose gel electrophoresis. The first strand of cDNA was synthesized with PrimeScript® RT Reagent Kit (TaKaRa Biotech, Kyoto, Japan), and the product was used immediately or stored at −20 °C for future use.

2.4. Gene Cloning and Splice-Variant Detection

The annotated sequence obtained previously was used to clone the fru gene in B. tabaci [21]. The full-length primers for the Btfru gene were designed with Primer Premier 5.0 software (Table 1). PCR reactions consisted of 12.5 μL Es-Taq MasterMix, 10.5 μL ddH2O, 1 μL cDNA template, and 0.5 μL of each primer (10 mM). The reaction procedure was as follows: denaturation at 95 °C for 5 min; amplification, 95 °C for 30 s, 56 °C or 59 °C (depending on the primers) for 30 s, and 72 °C for 1 min (35 cycles); extension, 72 °C for 10 min. PCR products were purified by a DNA Gel Extraction Kit (NEB, Beijing, China), cloned into the pEASY-T1 vector (TransGen, Beijing, China), and sequenced. The analysis of alternative splicing was consistent with previous methods [22].

2.5. Phylogenetic Analysis

To analyze the evolutionary placement of fru zinc finger domains, we firstly collected the nucleotide sequences of known fru zinc fingers. Secondly, we aligned these sequences by CLUSTALW [25]. The phylogenetic tree was constructed with MEGA 6 software, using the neighbor-joining method with a p-distance model and pairwise deletion of gaps [26].

2.6. Real-Time Quantitative PCR

To distinguish the spliceosomes of fru, we designed quantitative primers in the BTB domain, the common region of fru-a and fru-b, and the ZnA and ZnG regions, respectively. The specific primers are shown in Table 1. Relative transcript levels of all fru isoforms, fru-a and fru-b, and the reference gene (SDHA) were assayed by real-time qPCR with the conditions described as follows [27]: denaturation at 95 °C for 10 min; amplification, 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s (40 cycles). Amplified products were identified using SuperReal PreMix Plus (SYBR Green) (Tiangen, Beijing, China). Three independent biological replicates were included for each stage. The relative differences in transcript levels were analyzed by the 2−ΔΔCt method [28].

2.7. RNA Interference

To amplify dsRNA targeting Bttra, primers containing a T7 promoter sequence were designed (Table 1). The dsRNA for enhanced green fluorescent protein (EGFP) was used as the negative control. All dsRNAs were prepared using the T7 Ribomax™ Express RNAi system (Promega, Madison, WI, USA). RNAi was achieved by directly feeding a 0.20 mL drop of diet solution containing 5% yeast extract, 30% sucrose (wt/vol), and 100 ng dsRNA to B. tabaci adults in an incubated chamber [29,30]. Approximately 40 newly emerged mixed adults (the ratio of males to females was 1:1) were introduced into an environmental chamber at 25 °C under a photoperiod of L14:D10 and a relative humidity (RH) of 70%. Each sample was represented by three technical replicates. Mortality was recorded, and B. tabaci specimens were collected after two days of feeding.

3. Results

3.1. Characterization of Btfru

Previously, we successfully identified a fru homolog in B. tabaci [21]. In this study, we found two fru transcripts in our transcriptome data, named fru-a and fru-b. fru-a contains a 1263 bp open reading frame (ORF) encoding 420 amino acids with a predicted molecular weight (Mw) of 46.67 kDa and an isoelectric point (pI) of 6.47. fru-b contains a 1143 bp ORF encoding for 380 amino acids with a predicted Mw of 42.33 kDa and a pI of 6.43. Genomic structural analysis showed that fru-a and fru-b were located in the same scaffold, with fru-a containing 7 exons and 6 introns and fru-b containing 6 exons and 5 introns (Figure 1). The BTB domain and C2H2 zinc finger domain were identified in the predicted fru-a and fru-b amino acid sequences (Figure 1). The two transcripts both begin with an exon linked to the BTB-coding exon and end with alternative C2H2 zinc finger domain coding exons. We also searched for the presence of Tra/Tra2 binding sites in the Btfru gene and found two in fru-a and one in fru-b, respectively (Figure 1).

3.2. Phylogenetic Analysis of Btfru

Phylogenetic analysis showed that Fru proteins were clustered within each insect order, and two BtFru were closely related to that of Lygus hesperus (Figure S1). In order to reveal the evolutionary origin of fru-a and fru-b, the zinc finger domains of both were analyzed in depth. By searching the literature, the zinc finger sequences of the reported insect fru gene were collected, and the phylogenetic tree was constructed with fru-a and fru-b. The result is shown in Figure 2. The zinc fingers of fru-a and fru-b belong to ZnA and ZnG, respectively (Figure 2). Multi-alignment analysis of the ZnA and ZnG sequences of known insects revealed high similarity in each species (67% and 71%, respectively), as shown in Figure S2. From the evolutionary analysis, it is known that ZnF and ZnB, ZnA and ZnC are likely to be derived from the same ancestor. Phylogenetic analysis also showed that not all insect FRUs contain all known zinc finger domains; for example, Drosophila fru has only ZnA, ZnB, and ZnC; Nasonia fru has ZnA, ZnB, ZnC, ZnF, and ZnG; the whitefly fru has only ZnA and ZnG.
In addition, we found that the C2H2 zinc finger domains of fru have the same consistent sequence, CX2CX9HX3HX6CX2CX5RXDX4HX4H, where C and H are cysteines and histidines, while X represents an unconserved amino acid. If the H sequences of the zinc finger domains are excluded, there are three additional amino acid residues (underlined) that are conserved in all frus: CX2CXKXVX5HX3HX6CX2CX5RXDX4HX3KH (Figure S2). This should be a typical feature of the fru zinc finger domains.

3.3. Developmental Expression of Btfru

In order to reveal the expression patterns of fru-a and fru-b in different developmental stages of B. tabaci, quantitative primers specific to the fru-a and fru-b zinc fingers were designed, and the cDNA samples of different developmental stages of B. tabaci were used as the templates for qRT-PCR. The results showed that both fru transcripts were highly expressed in the egg stage, followed by the third-instar larvae, with the lowest expression in males and significant differences between males and females (Figure 3).

3.4. Analyses of Alternative Splicing Variants of Btfru

To analyze the spliceosomes of Btfru, we performed PCR amplification with full-length primers using newly emerged males and females as templates (Figure S3). All Btfru isoforms obtained from this analysis are listed in Table 2. In our study, 21 isoforms were found in fru-a, and amongst them, only 3 contained both the BTB and Zn finger domains (Nos. 1, 18, 21). No. 1 occurred in both females and males; No. 18 occurred only in males; No. 21 occurred in females. In addition, six isoforms were found in fru-b. No. 1 and No. 6 contain both BTB and Zn finger domains. No. 6 occurred only in females.
The number of fru isoforms obtained from PCR assays was numerous, and their differences between males and females were enormous. To verify that this result was real and not caused by sequencing, we designed quantitative primers in the BTB domain and the ZnA and ZnG regions, respectively. The results are shown in Figure S4. Quantitative primers stuck in the BTB domain reflected the expression of all fru isoforms, and there was no significant difference between male and female expression at this time, indicating that most isoforms retained the BTB domain, which was consistent with the PCR sequencing results. The quantitative primers stuck in the ZnA and ZnG regions responded to the expression levels of specific zinc finger domains, which showed highly significant differences between males and females, with the expression of females in ZnG reaching 8.7-times higher than that of males. This result suggests that it is the use of different zinc finger domain endings that leads to the creation of the fru sex-specific isoforms.
Although we know that frus have sex-specific alternative splicing in B. tabaci, we did not find any sex-specific exons or stable sex-specific variants in fru-a and fru-b. All of the sex-specific variants were found in only one biological replicate. We tried many times, but failed to find a marker that could mark the sex-specific fru spliceosome. This is probably because the spliceosome of fru is too complex and variable.
At the same time, we also performed the fru spliceosome analysis of a single whitefly, and the results were even more complex, which further indicated that the population of the whitefly is too heterozygous and has too much individual variation.

3.5. Analysis of the Interaction between Bttra and Btfru

Comparative analysis of fru sequences of N. vitripennis, Apis mellifera, and B. tabaci revealed the presence of a short repeat sequence (T/G/C)GAAGAT(T/A) in all three genes (Figure 4A). These repeats are thought to be TRA/TRA2 binding sites in hymenopterans and are conserved in the dsx and fru genes of N. vitripennis and A. mellifera [9]. This finding indicates that the splicing of Btfru is also mediated by tra, as in other insect species.
Previously, we successfully identified a tra homolog in B. tabaci, named Bttra [21]. After silencing Bttra in B. tabaci adults, both fru-a and fru-b expression decreased significantly compared with the dsEGFP control groups (Figure 4B). This result suggests that Bttra regulates the expression of Btfru.

4. Discussion

The fruitless gene performs multiple functions during Drosophila development. In recent years, fru homologues have been identified in most insect species. These Frus are conserved both in transcript architecture and in the regulation of male sexual behavior. However, the status of Hemiptera fru remains unknown. Here, we conducted a detailed analysis of fru transcripts in B. tabaci.
The fru transcripts generally begin with a broad-complex, tramtrack, and bric-a-brac (BTB) domain and end with one alternative C2H2 zinc finger domain [31]. The BTB domain is involved in protein oligomerization and recruitment of transcriptional corepressors. It is the most-conserved feature of all Fru proteins [32,33]. The BTB domain found in B. tabaci fru transcripts is encoded by a single exon (Figure 1), which is the same as N. vitripennis, but different from that of D. melanogaster [9]. In Drosophila, the BTB domain is encoded by three different exons [34]. Multi-alignment analysis of the BTB domains revealed a high identity rate (80%) (Figure S5), further illustrating the high conservation of the BTB domain in insect Fru proteins.
The zinc finger domains in insect fru genes are diverse and less conserved than those in the BTB domain. The fru gene in Diptera encodes three C2H2-type zinc finger isoforms identified as A, B, and C. However, in Nasonia, the fru gene encodes five C2H2-type zinc fingers termed the A, B, C, F, and G exons [8,9,35,36,37]. In this study, we found two C2H2-type zinc finger isoforms (A and G) in B. tabaci (Figure 2). Of the species that have been reported so far, only N. vitripennis and B. tabaci possess both A and G, while other species have either A or G. The specific function of these two zinc fingers remains for further experimental study.
By alternative splicing, the fru gene encodes a set of transcription factors in D. melanogaster. The transcript begins with one of four promoters (P1–P4) and ends with one of four final exons (A–D). Only those transcripts produced by the most-terminal P1 promoter are spliced in a sex-specific way [31,38]. Nasonia fru transcripts derive from at least six different promoters. As in Drosophila, the transcripts common to both sexes arise from the promoters closest to the BTB exon (P2-P3-P4-P5-P6 promoters). In contrast, sex-specific transcripts are derived from promoters further upstream in the fru locus (P0-P1) [9]. In addition to Drosophila and Nasonia, sex-specific isoforms were observed in A. mellifera, A. gambiae, Ceratitis capitata, Aedes aegypti, Musca domestica, and Blatella germanica [10,35,36,37]. In this paper, we did not find any stable sex-specific variants in two fru transcripts. This may be partly due to the fact that B. tabaci is a rapidly evolving complex species with large individual differences [39]. On the other hand, it may be because we used the whole body instead of the head to analyze the fru transcripts. After all, in both Nasonia and Drosophila, sex-specific fru transcripts driven by P1 promoters are expressed primarily in the head [9]. Furthermore, the male-specific Ceratitis fru is expressed only in male head samples [40]. Therefore, we may be able to obtain some new fru transcripts by collecting head tissues from both males and females for transcriptome sequencing.
In D. melanogaster, sex-specific splicing of fru is regulated by tra and its cofactor tra-2 [17,31,38]. The pattern of tra/tra2 co-regulation of fru splicing is widely conserved in Hymenoptera, Coleoptera, and Diptera [40,41]. For example, injection of tra dsRNA in the early embryonic stage of B. dorsalis caused fruM to appear in pseudomales [14]. Similarly, by embryonic injection of tra2 dsRNA in C. capitata, male-specific fru mRNA was detected in XX-pseudomales [40]. Recently, researchers found that the expression of Drosophila male-specific fru in the gonads is regulated by dsx and is independent of tra. This led to the inference of a novel mechanism regulating sex-specific splicing of fru. This mechanism is regulated by dsx at the transcriptional level and is not mediated by splicing of tra [42]. In this study, the presence of the TRA/TRA-2 binding sites in Btfru and the expression changes induced by Bttra RNAi suggest that, like most insects, fru is regulated by tra in B. tabaci (Figure 4).
Functional studies of the Btfru gene can be complex. This is because the number of fru splice variants is large and varies greatly between individuals. Thus far, we have not found stable fru sex-specific variants in B. tabaci. Both Btfru transcripts were found to be highly expressed in females (Figure 3), indicating that the two Btfru transcripts may function in females, but not in males. The function of fru in males has been widely reported. In D. melanogaster, fru mutant males were unable to complete mating and exhibited courtship behavior towards both females and males. This confirmed that FruM proteins determine male courtship and orientation [8,43]. In addition, the functions of Drosophila FruM include influencing the formation of sexual dimorphisms in neurons and the formation of male-specific MOL, as well as controlling the differentiation of imaginal discs [16,18]. In Bombyx, mating behavior is independently regulated by fru. Loss of Bmfru completely prevents mating, but males can still exhibit courtship behavior [15]. RNAi knockdown of fru in S. gregaria prevents successful mating and affects male fertility [11]. Silencing the cockroach fru, males no longer showed courtship behavior [10]. All these experiments confirmed the ancestral function of fru in male sexual behavior. Its function in females, however, is rarely reported. Actually, female mate choice plays a key role in species reproduction. It affects both sexual selection within species and reproductive isolation between species. In 2019, a non-sex-specifically spliced fru transcript was revealed to influence female rejection behavior. fru mutant females not only did not show acceptance of copulation, but also actively rejected courting males, as evidenced by extrusion of the ovipositor, kicking and/or wing clipping, and actively moving away from courting males [44]. It was the first implication of fru in female behavior. Therefore, we still have much work to perform in the functional verification of Btfru.
With the in-depth study of the mechanism of insect sex determination, people began to try to conduct genetic manipulation of sex in some insects, for example RNAi knockdown of tra and tra2 to generate male-only progeny in B. dorsalis [45]. CRISPR-Cas9-targeted A. gambiae dsxF did not affect male development or fertility, whereas females showed an intersex phenotype and complete sterility [46]. Disruption of Osp in B. mori and Spodoptera litura results in female sterility, while male fertility is not affected [47]. The success of these experiments is driving the process of genetic manipulation of gender. Likewise, the possibility of the manipulation of the sex determination pathway opens up a new opportunity for pest control. In this study, we identified multiple spliceosomes of the sex-differentiation gene fru. Later, we can target specific spliceosomes for interference or gene editing, which is expected to realize the genetic regulation of sex in the whitefly.

5. Conclusions

In the present study, we cloned and characterized the fru gene in B. tabaci and explored the alternative splicing of fru in B. tabaci adults. Furthermore, we confirmed by RNAi that fru expression is regulated by tra. Our results suggest that tra is functionally conserved in controlling downstream sex-differentiation gene expression. Meanwhile, the sex-differentiation gene fru is far more complex in whiteflies than we thought. Future in-depth studies of the mechanism of sex determination in whiteflies may reveal the function of this gene in whiteflies.

Supplementary Materials

The following Supporting Information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae9090962/s1, Figure S1: The phylogenetic tree of known fru genes in insects, Figure S2: Conservation of zinc finger domains among insect species, Figure S3: PCR cloning of fru-a and fru-b in B. tabaci females and males, Figure S4. Expression levels of fru transcripts in B. tabaci adults, Figure S5: Conservation of BTB domains among insect species.

Author Contributions

Conceptualization, Y.L. (Yating Liu); methodology, Y.L. (Yating Liu) and W.X.; software, J.X.; validation, W.W.; formal analysis, Y.L. (Yating Liu); investigation, Y.L. (Yating Liu); resources, W.W.; data curation, Y.L. (Yating Liu); writing—original draft preparation, Y.L. (Yating Liu); writing—review and editing, X.Z. and Y.L. (Yanyuan Lei); supervision, W.X.; project administration, Y.Z.; funding acquisition, Y.L. (Yating Liu), Y.L. (Yanyuan Lei), Y.Z. and W.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (Grant Number 32102209), the Science and Technology Innovation Program of the Chinese Academy of Agricultural Sciences (CAAS-ASTIP-IVFCAAS), the Natural Science Foundation of Guangdong Province (Grant Number 2021A1515012445), and the Beijing Key Laboratory for Pest Control and Sustainable Cultivation of Vegetables.

Data Availability Statement

The sequences have been uploaded to the NCBI database, and the accession numbers are fru-a: OP868816 and fru-b: OP868817.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Schütt, C.; Nöthiger, R. Structure, function and evolution of sex-determining systems in dipteran insects. Development 2000, 127, 667–677. [Google Scholar] [CrossRef] [PubMed]
  2. Liu, Y.; Wang, W.; Chen, Z.; Xie, W.; Zhang, Y. Research progress on sex determination cascade in insects. Acta Entomol. Sin. 2023, 66, 245–254. [Google Scholar]
  3. Peng, W.; Zhai, Z. Progress and prospects of insect sex determination mechanism. Chin. J. Biol. Control 2021, 37, 1313–1324. [Google Scholar]
  4. Shukla, J.N.; Nagaraju, J. Doublesex: A conserved downstream gene controlled by diverse upstream regulators. J. Genet. 2010, 89, 341–356. [Google Scholar] [CrossRef]
  5. Gailey, D.A.; Taylor, B.J.; Hall, J.C. Elements of the fruitless locus regulate development of the muscle of Lawrence, a male-specific structure in the abdomen of Drosophila melanogaster adults. Development 1991, 113, 879–890. [Google Scholar] [CrossRef]
  6. von Philipsborn, A.C.; Jörchel, S.; Tirian, L.; Demir, E.; Morita, T.; Stern, D.L.; Dickson, B.J. Cellular and behavioral functions of fruitless isoforms in Drosophila courtship. Curr. Biol. 2014, 24, 242–251. [Google Scholar] [CrossRef]
  7. Wohl, M.; Ishii, K.; Asahina, K. Layered roles of fruitless isoforms in specification and function of male aggression-promoting neurons in Drosophila. eLife 2020, 9, e52702. [Google Scholar] [CrossRef]
  8. Demir, E.; Dickson, B.J. fruitless splicing specifies male courtship behavior in Drosophila. Cell 2005, 121, 785–794. [Google Scholar] [CrossRef]
  9. Bertossa, R.C.; Zande, L.V.D.; Beukeboom, L.W. The fruitless gene in Nasonia displays complex sex-specific splicing and contains new zinc finger domains. Mol. Biol. Evol. 2009, 26, 1557–1569. [Google Scholar] [CrossRef]
  10. Clynen, E.; Ciudad, L.; Bellés, X.; Piulachs, M.D. Conservation of fruitless’ role as master regulator of male courtship behaviour from cockroaches to flies. Dev. Genes Evol. 2011, 221, 43–48. [Google Scholar] [CrossRef]
  11. Boerjan, B.; Tobback, J.; Vandersmissen, H.P.; Huybrechts, R.; Schoofs, L. Fruitless RNAi knockdown in the desert locust, Schistocerca gregaria, influences male fertility. J. Insect Physiol. 2012, 58, 265–269. [Google Scholar] [CrossRef] [PubMed]
  12. Watanabe, T. Evolution of the neural sex-determination system in insects: Does fruitless homologue regulate neural sexual dimorphism in basal insects? Insect Mol. Biol. 2019, 28, 807–827. [Google Scholar] [CrossRef] [PubMed]
  13. Basrur, N.S.; de Obaldia, M.E.; Morita, T.; Herre, M.; von Heynitz, R.K.; Tsitohay, Y.N.; Vosshall, L.B. Fruitless mutant male mosquitoes gain attraction to human odor. eLife 2020, 9, e63982. [Google Scholar] [CrossRef] [PubMed]
  14. Laohakieat, K.; Isasawin, S.; Thanaphum, S. The transformer-2 and fruitless characterisation with developmental expression profiles of sex-determining genes in Bactrocera dorsalis and B. correcta. Sci. Rep. 2020, 10, 17938. [Google Scholar] [CrossRef]
  15. Xu, J.; Liu, W.; Yang, D.H.; Chen, S.Q.; Chen, K.; Liu, Z.L.; Yang, X.; Meng, J.; Zhu, G.H.; Dong, S.L.; et al. Regulation of olfactory-based sex behaviors in the silkworm by genes in the sex-determination cascade. PLoS Genet. 2020, 16, e1008622. [Google Scholar] [CrossRef]
  16. Salvemini, M.; Polito, C.; Saccone, G. Fruitless alternative splicing and sex behaviour in insects: An ancient and unforgettable love story? J. Genet. 2010, 89, 287–299. [Google Scholar] [CrossRef]
  17. Heinrichs, V.; Ryner, L.C.; Baker, B.S. Regulation of sex-specific selection of fruitless 5’ splice sites by transformer and transformer-2. Mol. Cell. Biol. 1998, 18, 450–458. [Google Scholar] [CrossRef]
  18. Sato, K.; Yamamoto, D. The mode of action of Fruitless: Is it an easy matter to switch the sex? Genes Brain Behav. 2020, 19, e12606. [Google Scholar] [CrossRef]
  19. Blackman, R.L.; Cahill, M. The karyotype of Bemisia tabaci (Hemiptera: Aleyrodidae). Bull. Entomol. Res. 1998, 88, 213–215. [Google Scholar] [CrossRef]
  20. Liu, Y.; Xie, W.; Yang, X.; Guo, L.; Wang, S.; Wu, Q.; Yang, Z.; Zhou, X.; Zhang, Y. Molecular cloning of the sex-related gene PSI in Bemisia tabaci and its alternative splicing properties. Gene 2016, 580, 104–110. [Google Scholar] [CrossRef]
  21. Liu, Y.; Xie, W.; Guo, L.; Yang, X.; Yang, J.; Wang, S.; Wu, Q.; Zhou, X.; Zhang, Y. Genome-wide dissection of sex determination genes in the highly invasive whitefly species Bemisia tabaci Q/MED. Insect Mol. Biol. 2019, 28, 509–519. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, Y.; Yang, J.; Huo, Z.; Wang, S.; Wu, Q.; Zhou, X.; Xie, W.; Zhang, Y. Characteristic and functional study of intersex, a gene related to female fertility in Bemisia tabaci. Front. Physiol. 2020, 11, 55. [Google Scholar] [CrossRef] [PubMed]
  23. Guo, L.; Xie, W.; Liu, Y.; Yang, Z.; Yang, X.; Xia, J.; Wang, S.; Wu, Q.; Zhang, Y. Identification and characterization of doublesex in Bemisia tabaci. Insect Mol. Biol. 2018, 27, 620–632. [Google Scholar] [CrossRef] [PubMed]
  24. Huo, Z.; Liu, Y.; Yang, J.; Xie, W.; Wang, S.; Wu, Q.; Zhou, X.; Pang, B.; Zhang, Y. Transcriptomic analysis of mating responses in Bemisia tabaci MED females. Insects 2020, 11, 308. [Google Scholar] [CrossRef]
  25. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
  26. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef]
  27. Li, R.; Xie, W.; Wang, S.; Wu, Q.; Yang, N.; Yang, X.; Pan, H.; Zhou, X.; Bai, L.; Xu, B.; et al. Reference gene selection for qRT-PCR analysis in the sweetpotato whitefly, Bemisia tabaci (Hemiptera: Aleyrodidae). PLoS ONE 2013, 8, e53006. [Google Scholar] [CrossRef]
  28. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  29. Upadhyay, S.K.; Chandrashekar, K.; Thakur, N.; Verma, P.C.; Borgio, J.F.; Singh, P.K.; Tuli, R. RNA interference for the control of whiteflies (Bemisia tabaci) by oral route. J. Biosci. 2011, 36, 153–161. [Google Scholar] [CrossRef]
  30. Yang, X.; Xie, W.; Li, R.M.; Zhou, X.M.; Wang, S.L.; Wu, Q.J.; Yang, N.N.; Xia, J.X.; Yang, Z.Z.; Guo, L.T.; et al. RNA interference-mediated knockdown of the hydroxyacid-oxoacid transhydrogenase gene decreases thiamethoxam resistance in adults of the whitefly Bemisia tabaci. Sci. Rep. 2017, 7, 41201. [Google Scholar] [CrossRef]
  31. Ito, H.; Fujitani, K.; Usui, K.; Shimizu-Nishikawa, K.; Tanaka, S.; Yamamoto, D. Sexual orientation in Drosophila is altered by the satori mutation in the sex-determination gene fruitless that encodes a zinc finger protein with a BTB domain. Proc. Natl. Acad. Sci. USA 1996, 93, 9687–9692. [Google Scholar] [CrossRef] [PubMed]
  32. Beaulieu, A.M.; Sant’Angelo, D.B. The BTB-ZF family of transcription factors: Key regulators of lineage commitment and effector function development in the immune system. J. Immunol. 2011, 187, 2841–2847. [Google Scholar] [CrossRef] [PubMed]
  33. Siggs, O.M.; Beutler, B. The BTB-ZF transcription factors. Cell Cycle 2012, 11, 3358–3369. [Google Scholar] [CrossRef] [PubMed]
  34. Davis, T.; Hiroki, I. Genomic structure of the sexual behaviour gene fruitless. Drosoph. Inf. Serv. 2001, 84, 65–66. [Google Scholar]
  35. Gailey, D.A.; Billeter, J.C.; Liu, J.H.; Bauzon, F.; Allendorfer, J.B.; Goodwin, S.F. Functional conservation of the fruitless male sex-determination gene across 250 Myr of insect evolution. Mol. Biol. Evol. 2006, 23, 633–643. [Google Scholar] [CrossRef]
  36. Meier, N.; Käppeli, S.C.; Hediger Niessen, M.; Billeter, J.C.; Goodwin, S.F.; Bopp, D. Genetic control of courtship behavior in the housefly: Evidence for a conserved bifurcation of the sex-determining pathway. PLoS ONE 2013, 8, e62476. [Google Scholar] [CrossRef]
  37. Salvemini, M.; D’Amato, R.; Petrella, V.; Aceto, S.; Nimmo, D.; Neira, M.; Alphey, L.; Polito, L.C.; Saccone, G. The orthologue of the fruitfly sex behaviour gene fruitless in the mosquito Aedes aegypti: Evolution of genomic organisation and alternative splicing. PLoS ONE 2013, 8, e48554. [Google Scholar] [CrossRef]
  38. Ryner, L.C.; Goodwin, S.F.; Castrillon, D.H.; Anand, A.; Villella, A.; Baker, B.S.; Hall, J.C.; Taylor, B.J.; Wasserman, S.A. Control of male sexual behavior and sexual orientation in Drosophila by the fruitless gene. Cell 1996, 87, 1079–1089. [Google Scholar] [CrossRef]
  39. De Barro, P.J.; Liu, S.S.; Boykin, L.M.; Dinsdale, A.B. Bemisia tabaci: A statement of species status. Annu. Rev. Entomol. 2011, 56, 1–19. [Google Scholar] [CrossRef]
  40. Salvemini, M.; Robertson, M.; Aronson, B.; Atkinson, P.; Polito, L.C.; Saccone, G. Ceratitis capitata transformer-2 gene is required to establish and maintain the autoregulation of Cctra, the master gene for female sex determination. Int. J. Dev. Biol. 2009, 53, 109–120. [Google Scholar] [CrossRef]
  41. Pane, A.; Salvemini, M.; Delli Bovi, P.; Polito, C.; Saccone, G. The transformer gene in Ceratitis capitata provides a genetic basis for selecting and remembering the sexual fate. Development 2002, 129, 3715–3725. [Google Scholar] [CrossRef] [PubMed]
  42. Zhou, H.; Whitworth, C.; Pozmanter, C.; Neville, M.C.; Van Doren, M. Doublesex regulates fruitless expression to promote sexual dimorphism of the gonad stem cell niche. PLoS Genet. 2021, 17, e1009468. [Google Scholar] [CrossRef] [PubMed]
  43. Manoli, D.S.; Foss, M.; Villella, A.; Taylor, B.J.; Hall, J.C.; Baker, B.S. Male-specific fruitless specifies the neural substrates of Drosophila courtship behaviour. Nature 2005, 436, 395–400. [Google Scholar] [CrossRef] [PubMed]
  44. Chowdhury, T.; Calhoun, R.M.; Bruch, K.; Moehring, A.J. The fruitless gene affects female receptivity and species isolation. Proc. R. Soc. B 2020, 287, 20192765. [Google Scholar] [CrossRef]
  45. Liu, G.Q.; Wu, Q.; Li, J.W.; Zhang, G.F.; Wan, F.H. RNAi-mediated knock-down of transformer and transformer 2 to generate male-only progeny in the oriental fruit fly, Bactrocera dorsalis (Hendel). PLoS ONE 2015, 10, e0128892. [Google Scholar] [CrossRef]
  46. Kyrou, K.; Hammond, A.M.; Galizi, R.; Kranjc, N.; Burt, A.; Beaghton, A.K.; Nolan, T.; Crisanti, A. A CRISPR-Cas9 gene drive targeting doublesex causes complete population suppression in caged Anopheles gambiae mosquitoes. Nat. Biotechnol. 2018, 36, 1062–1066. [Google Scholar] [CrossRef]
  47. Xu, X.; Bi, H.; Wang, Y.; Li, X.; Xu, J.; Liu, Z.; He, L.; Li, K.; Huang, Y. Disruption of the ovarian serine protease (Osp) gene causes female sterility in Bombyx mori and Spodoptera litura. Pest Manag. Sci. 2020, 76, 1245–1255. [Google Scholar] [CrossRef]
Horticulturae 09 00962 g001
Figure 1. The gene structure, deduced protein conserved domains, nucleotides, and deduced amino acid sequences of fru-a and fru-b. The orange boxes and lines between them represent exons and introns, respectively. The sizes of the exons and introns are plotted in proportion. The BTB domain is highlighted with an underline; the zinc finger domain is highlighted in dark grey; the TRA/TRA2 binding sites are highlighted in red bold characters.
Figure 1. The gene structure, deduced protein conserved domains, nucleotides, and deduced amino acid sequences of fru-a and fru-b. The orange boxes and lines between them represent exons and introns, respectively. The sizes of the exons and introns are plotted in proportion. The BTB domain is highlighted with an underline; the zinc finger domain is highlighted in dark grey; the TRA/TRA2 binding sites are highlighted in red bold characters.
Horticulturae 09 00962 g001
Horticulturae 09 00962 g002
Figure 2. Phylogenetic tree of fru zinc finger nucleotide sequences in different insects. The sequences of B. tabaci were determined in the current study, and sequences for the other insects were obtained from the GenBank database. ZnD was set as the outgroup. The full species names are Drosophila melanogaster, Anopheles gambiae, Pediculus humanus corporis, Tribolium castaneum, Apis mellifera, Nasonia vitripennis, Bemisia tabaci, Chorthippus brunneus, Lygus hesperus, Bombyx mori, and Danaus plexippus.
Figure 2. Phylogenetic tree of fru zinc finger nucleotide sequences in different insects. The sequences of B. tabaci were determined in the current study, and sequences for the other insects were obtained from the GenBank database. ZnD was set as the outgroup. The full species names are Drosophila melanogaster, Anopheles gambiae, Pediculus humanus corporis, Tribolium castaneum, Apis mellifera, Nasonia vitripennis, Bemisia tabaci, Chorthippus brunneus, Lygus hesperus, Bombyx mori, and Danaus plexippus.
Horticulturae 09 00962 g002
Horticulturae 09 00962 g003
Figure 3. Expression profiling of two fru transcripts in Bemisia tabaci at different developmental stages. E, egg; L1-2, 1st- and 2nd-instar nymphs; L3, 3rd-instar nymph; L4, 4th-instar nymph; F, newly emerged females; M, newly emerged males. ** represents highly significant differences (P < 0.01).
Figure 3. Expression profiling of two fru transcripts in Bemisia tabaci at different developmental stages. E, egg; L1-2, 1st- and 2nd-instar nymphs; L3, 3rd-instar nymph; L4, 4th-instar nymph; F, newly emerged females; M, newly emerged males. ** represents highly significant differences (P < 0.01).
Horticulturae 09 00962 g003
Horticulturae 09 00962 g004
Figure 4. (A) Short repeats found in the fru genes of B. tabaci, N. vitripennis and A. mellifera. (B) Relative transcript levels of tra, fru-a, and fru-b in control and Bttra dsRNA-fed B. tabaci. Different lowercase letters indicate significant differences (p < 0.05).
Figure 4. (A) Short repeats found in the fru genes of B. tabaci, N. vitripennis and A. mellifera. (B) Relative transcript levels of tra, fru-a, and fru-b in control and Bttra dsRNA-fed B. tabaci. Different lowercase letters indicate significant differences (p < 0.05).
Horticulturae 09 00962 g004
Table 1. Primer sequences for full-length gene cloning, alternative splicing analysis, gene expression analysis, and RNA interference were used in this study.
Table 1. Primer sequences for full-length gene cloning, alternative splicing analysis, gene expression analysis, and RNA interference were used in this study.
Application of PrimersGene NamePrimer NamePrimer Sequence (5′-3′)
Cloning and AS analysisfru-afru6255-FCGTCTCTCCCCCAACCAG
fru-full-RCCCTTAGCATCAATAGCGG
fru-bfru-F5-fullATGGAGGAGGCATTTTGTTTGAAG
fru-R5-fullTTATGTGTTGTGCTTGAGCCTGAAA
qRT-PCR
analysis		fru-aqfru-A-F1AAGCAATCCGCAGCCGTT
qfru-A-R1CTGATGTCGTTGAGATACCGC
fru-bqfru-G-F2ATGAAAAACCACTTCTTGACGC
qfru-G-R2TATGTGTTGTGCTTGAGCCTGA
fruBTB-qFCATTCGTCAAGTTTTTCGGGTA
BTB-qRGGAAGGTCTCGCTCGCTAAA
tradsTra-qF2AAGTCCCTCTCCTCAGCCCA
dsTra-qR2GCCACGGGTTAGACCTTTGA
SDHASDHA-qFGCGACTGATTCTTCTCCTGC
SDHA-qRTGGTGCCAACAGATTAGGTGC
RNAi
analysis		EGFPdsEGFP-FTAATACGACTCACTATAGGGAGACAGTGCTTCAGCCGCTAC
dsEGFP-RTAATACGACTCACTATAGGGAGAGTTCACCTTGATGCCGTTC
tradsTra-F2GGATCCTAATACGACTCACTATAGGTTGAGACGAATCAGCAATCG
dsTra-R3GGATCCTAATACGACTCACTATAGGGACCTTCGCAGGAACTTTTG
Table 2. Alternative splicing isoforms of fru-a and fru-b in Bemisia tabaci.
Table 2. Alternative splicing isoforms of fru-a and fru-b in Bemisia tabaci.
TypeVariantsExons IncludedSize (bp)Female (3) aMale (3) aDomain
fru-a11,2,3,4,5,6a,7126333BTB + Zn
21-198,160-727810BTB
31-169,178-728910BTB
41-210,110-731610
51-194,88-735410BTB
61-308,48-6a,735710Zn
71-200,78-735810BTB
81-279,71-6a,736301Zn
91-161,85-739010BTB
101-197,38-740110BTB
111-132,98-740610BTB
121-346,55-5,6a,744410Zn
131-131,9-749610BTB
141-305,37-5,6a,750310
151,2,3-107,244-766710BTB
161,2,3-7,79-789501BTB
171,2,3,4,5-86,163-793510BTB
181,2,3,4-73,21-6a,7107401BTB + Zn
191,2,3,4,5,6a-66,82-7111410BTB
201,2,3,4,5-56,7113010BTB
211-10,98-2,3,4,5,6a,7115510BTB + Zn
fru-b11,2,3,4,5,6b114333BTB + Zn
21-185,155-6b25310BTB
31-284,5,6b34810
41-292,5,6b39610BTB
51,2-81,178-6b51701BTB
61-51,2,3,4,5,6b109010BTB + Zn
a: Numbers in parentheses indicate the number of biological replicates, with 40 females or males assessed as a group per replicate.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, Y.; Xie, J.; Wang, W.; Lei, Y.; Zhou, X.; Zhang, Y.; Xie, W. Splicing and Expression Regulation of fruitless Gene in Bemisia tabaci (Hemiptera: Aleyrodidae). Horticulturae 2023, 9, 962. https://doi.org/10.3390/horticulturae9090962

AMA Style

Liu Y, Xie J, Wang W, Lei Y, Zhou X, Zhang Y, Xie W. Splicing and Expression Regulation of fruitless Gene in Bemisia tabaci (Hemiptera: Aleyrodidae). Horticulturae. 2023; 9(9):962. https://doi.org/10.3390/horticulturae9090962

Chicago/Turabian Style

Liu, Yating, Jinxi Xie, Wenlu Wang, Yanyuan Lei, Xuguo Zhou, Youjun Zhang, and Wen Xie. 2023. "Splicing and Expression Regulation of fruitless Gene in Bemisia tabaci (Hemiptera: Aleyrodidae)" Horticulturae 9, no. 9: 962. https://doi.org/10.3390/horticulturae9090962

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop