Strigolactone-Mediated Trehalose Enhances Salt Resistance in Tomato Seedlings
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Treatments
2.3. Measurement of Morphological Indexes
2.4. Determination of Tre, Starch and Glu Content
- (1)
- The foil bag was equilibrated at room temperature for 20 min; the required strip was sealed immediately and the remaining strips were placed in self-sealing bags at 4 °C.
- (2)
- The standard wells and the sample well were set up. Fifty μL of the standard liquid of each concentration was added into the standard wells, and one standard well corresponded to one concentration.
- (3)
- Ten μL of sample and 40 μL of sample solvent were added into the sample well, successively. No additions were made to the blank well.
- (4)
- Apart from the blank well, 100 μL horseradish peroxidase (HRP)-labeled detection antibody was added to all standard wells and to the sample well, respectively, and the reaction well was sealed with a sealing film. The reaction well was incubated in a 37 °C water bath or incubator for 60 min.
- (5)
- The liquid was discarded, and the board was pat dried on absorbent paper, and each microplate well was filled with washing reagent and allowed to stand for 1 min. The washing reagent was discarded, and the board was pat dried on absorbent paper, the board was washed 5 times.
- (6)
- In each microplate well, 50 μL of substrate A and substrate B were added and incubated at 37 °C in the dark for 15 min.
- (7)
- The 50 μL termination solution was added into each microplate well, and the OD value of each microplate well was measured at 450 nm within 15 min. The Tre content was calculated in the sample, based on the standard curve.
2.5. Determination of TPP and TPS Activities
2.6. Real-Time RT-PCR Analysis
2.7. Statistical Analysis
3. Results
3.1. Effect of GR24 and TIS108 on Tomato Seedling Growth under Salt Stress
3.2. SLs Were Involved in the Conversion among Tre, Starch, and Glu
3.3. Effect of SLs on TPS, TPP, and THL Activities under Salt Stress
3.4. SLs Regulated the Transcriptional Level of TPS1, TPS2, TPP1, and TPP2 Genes under Salt Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Mahajan, S.; Tuteja, N. Cold, salinity and drought stresses: An overview. Arch. Biochem. Biophys. 2005, 444, 139–158. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Hong, Y.; Zhu, G.; Li, Y.; Niu, Q.; Yao, J.; Hua, K.; Bai, J.; Zhu, Y.; Shi, H.; et al. Loss of salt tolerance during tomato domestication conferred by variation in a Na+/K+ transporter. EMBO J. 2020, 39, e103256. [Google Scholar] [CrossRef] [Scilit]
- Hasanuzzaman, M.; Nahar, K.; Fujita, M. Ecophysiology, Abiotic Stress Responses and Utilization of Halophytes; Springer: Singapore, 2019. [Google Scholar]
- Ahmad, P.; Azooz, M.M.; Prasad, M.N.V. Ecophysiology and Responses of Plants under Salt Stress; Springer: New York, NY, USA, 2013; pp. 25–87. [Google Scholar]
- Hussain, S.; Khaliq, A.; Tanveer, M.; Matloob, A.; Hussain, H.A. Aspirin priming circumvents the salinity-induced effects on wheat emergence and seedling growth by regulating starch metabolism and antioxidant enzyme activities. Acta Physiol. Plant. 2018, 40, 68. [Google Scholar] [CrossRef] [Scilit]
- Zhao, S.; Zhang, Q.; Liu, M.; Zhou, H.; Ma, C.; Wang, P. Regulation of plant responses to salt stress. Int. J. Mol. Sci. 2021, 22, 4609. [Google Scholar] [CrossRef] [Scilit]
- Rofekuggaman, M.; Kubra, K.; Mahmood, S. Effect of Different Salt Concentrations (NaCl) on Seed Germination and Seedling Growth of Tomato Cv. BINA Tomato-10. Asian Plant Res. J. 2020, 5, 38–44. [Google Scholar] [CrossRef] [Scilit]
- Hu, J.; Cai, J.; Park, S.J.; Lee, K.; Li, Y.; Chen, Y.; Yun, J.-Y.; Xu, T.; Kang, H. N6-Methyladenosine mRNA Methylation Is Important for Salt Stress Tolerance in Arabidopsis. Plant J. 2021, 106, 1759–1775. [Google Scholar] [CrossRef] [Scilit]
- Cook, C.E.; Whichard, L.P.; Turner, B.; Wall, M.E.; Egley, G.H. Germination of Witchweed (Striga lutea Lour.): Isolation and properties of a potent stimulant. Science 1966, 154, 1189–1190. [Google Scholar] [CrossRef] [Scilit]
- Yasuda, N.; Sugimoto, Y.; Kato, M.; Inanaga, S.; Yoneyama, K. (+)-Strigol, a witchweed seed germination stimulant, from Menispermum dauricum root culture. Phytochemistry 2003, 62, 1115–1119. [Google Scholar] [CrossRef] [Scilit]
- Mori, N.; Nishiuma, K.; Sugiyama, T.; Hayashi, H.; Akiyama, K. Carlactone-type strigolactones and their synthetic analogues as inducers of hyphal branching in arbuscular mycorrhizal fungi. Phytochemistry 2016, 130, 90–98. [Google Scholar] [CrossRef] [Scilit]
- Pozo, M.J.; López-Ráez, J.A.; Azcón, C.; García-Garrido, J.M. Phytohormones as integrators of environmental signals in the regulation of mycorrhizal symbioses. New Phytol. 2015, 205, 1431–1436. [Google Scholar] [CrossRef] [Scilit]
- Marro, N.; Caccia, M.; López-Ráez, J.A. Are Strigolactones a Key in Plant–parasitic Nematodes Interactions? An Intriguing Question. Plant Soil 2021, 462, 591–601. [Google Scholar] [CrossRef] [Scilit]
- Kong, C.C.; Ren, C.G.; Li, R.Z.; Xie, Z.H.; Wang, J.P. Hydrogen peroxide and strigolactones signaling are involved in alleviation of salt stress induced by arbuscular mycorrhizal fungus in sesbania cannabina seedlings. J. Plant Growth Regul. 2017, 36, 734–742. [Google Scholar] [CrossRef] [Scilit]
- Tian, M.Q.; Jiang, K.; Takahashi, I.; Li, G.D. Strigolactone-induced senescence of a bamboo leaf in the dark is alleviated by exogenous sugar. J. Pestic. Sci. 2018, 43, 173–179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waters, M.T.; Gutjahr, C.; Bennett, T.; Nelson, D.C. Strigolactone signaling and evolution. Annu. Rev. Plant Biol. 2017, 68, 291–322. [Google Scholar] [CrossRef] [Scilit]
- Tripepi, A.; Guglielminetti, L. Actions of strigolactone GR24 and DRM1 gene expression on Arabidopsis root architecture. Russ. J. Plant Physiol. 2017, 64, 845–849. [Google Scholar] [CrossRef] [Scilit]
- Sarwar, Y.; Shahbaz, M. GR24 Triggered variations in morpho-physiological attributes of sunflower (Helianthus annuus) under salinity. Int. J. Agric. Biol. 2019, 21, 34–40. [Google Scholar]
- Lu, T.; Yu, H.; Li, Q.; Chai, L.; Jiang, W. Improving Plant Growth and Alleviating Photosynthetic Inhibition and Oxidative Stress From Low-Light Stress With Exogenous GR24 in Tomato (Solanum lycopersicum L.) Seedlings. Front. Plant Sci. 2019, 10, 490. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Tan, Z.; Zhou, Y.; Guo, S.; Sang, T.; Wang, Y.; Shu, S. Physiological mechanism of strigolactoneenhancing tolerance to low light stress in cucumber seedlings. BMC Plant Biol. 2022, 22, 30. [Google Scholar] [CrossRef] [Scilit]
- Ha, C.V.; Leyva-González, M.A.; Osakabe, Y.; Tran, U.T.; Nishiyama, R.; Watanabe, Y.; Tanaka, M.; Seki, M.; Yamaguchi, S.; Dong, N.V.; et al. Positive regulatory role of strigolactone in plant responses to drought and salt stress. Proc. Natl. Acad. Sci. USA 2014, 111, 851–856. [Google Scholar] [CrossRef] [Scilit]
- León, P.; Sheen, J. Sugar and hormone connections. Trends Plant Sci. 2003, 8, 110–116. [Google Scholar] [CrossRef] [Scilit]
- Ruan, Y.L.; Jin, Y.; Yang, Y.J.; Li, G.J.; Boyer, J.S. Sugar input, metabolism, and signaling mediated by invertase: Roles in development, yield potential, and response to drought and heat. Mol. Plant 2010, 3, 942–955. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wingler, A. The function of trehalose biosynthesis in plants. Phytochemistry 2002, 60, 437–440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henry, C.; Bledsoe, S.W.; Siekman, A.; Kollman, A.; Waters, B.M.; Feil, R.; Stitt, M.; Lagrimini, L.M. The trehalose pathway in maize: Conservation and gene regulation in response to the diurnal cycle and extended darkness. J. Exp. Bot. 2014, 65, 5959–5973. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eastmond, P.J.; van Dijken, A.J.H.; Spielman, M.; Kerr, A.; Tissier, A.F.; Dickinson, H.G.; Jones, J.D.G.; Smeekens, S.C.; Graham, I.A. Trehalose-6-phosphate synthase 1, which catalyses the first step in trehalose synthesis, is essential for Arabidopsis embryo maturation. Plant J. 2002, 29, 225–235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ponnu, J.; Wahl, V.; Schmid, M. Trehalose-6-phosphate: Connecting plant metabolism and development. Front. Plant Sci. 2011, 2, 70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arguelles, J.C. Physiological Roles of Trehalose in Bacteria and Yeasts: A Comparative Analysis. Arch. Microbiol. 2000, 174, 217–224. [Google Scholar] [PubMed]
- Andersson, U.; Levander, F.; Radstrom, P. Trehalose-6-Phosphate Phosphorylase Is Part of a Novel Metabolic Pathway for Trehalose Utilization in Lactococcus Lactis. J. Biol. Chem. 2001, 276, 42707–42713. [Google Scholar] [CrossRef] [Scilit]
- Garg, A.K.; Kim, J.K.; Owens, T.G.; Ranwala, A.P.; Choi, Y.D.; Kochian, L.V.; Wu, R.J. Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proc. Natl. Acad. Sci. USA 2002, 99, 15898–15903. [Google Scholar] [CrossRef] [Scilit]
- Iordachescu, M.; Imai, R. Trehalose biosynthesis in response to abiotic stresses. J. Integr. Plant Biol. 2008, 50, 1223–1229. [Google Scholar] [CrossRef] [Scilit]
- Fernandez, O.; Béthencourt, L.; Quero, A.; Sangwan, R.S.; Clément, C. Trehalose and plant stress responses: Friend or foe? Trends Plant Sci. 2010, 15, 409–417. [Google Scholar] [CrossRef] [Scilit]
- Li, H.W.; Zang, B.S.; Deng, X.W.; Wang, X.P. Overexpression of the trehalose-6-phosphate synthase gene OsTPS1 enhances abiotic stress tolerance in rice. Planta 2011, 234, 1007–1018. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akram, N.A.; Waseem, M.; Ameen, R. Trehalose pretreatment induces drought tolerance in radish (Raphanus sativus L.) plants: Some key physio-biochemical traits. Acta Physiol. Plant. 2016, 38, 3. [Google Scholar] [CrossRef] [Scilit]
- Islam, M.O.; Kato, H.; Shima, S.; Tezuka, D.; Matsui, H.; Imai, R. Functional identification of a rice trehalase gene involved in salt stress tolerance. Gene 2019, 685, 42–49. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Redillas, M.; Park, S.H.; Lee, J.W.; Kim, Y.S.; Jin, S.J.; Jung, H.; Bang, S.W.; Hahn, T.R.; Kim, J.K. Accumulation of trehalose increases soluble sugar contents in rice plants conferring tolerance to drought and salt stress. Plant Biotechnol. Rep. 2012, 6, 89–96. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Li, C.; Yan, M.; Zhao, Z.; Huang, P.; Wei, L.; Wu, X.; Wang, C.; Liao, W. Strigolactone is involved in nitric oxide-enhanced the salt resistance in tomato seedlings. J. Plant Res. 2022, 135, 337–350. [Google Scholar] [CrossRef] [Scilit]
- Ito, S.; Umehara, M.; Hanada, A.; Yamaguchi, S.; Asami, T. Effects of Strigolactone-biosynthesis Inhibitor TIS108 on Arabidopsis. Plant Signal. Behav. 2013, 8, E24193. [Google Scholar] [CrossRef] [Scilit]
- Sheng, W.J.; Wei, C.X. Screening Methods for Cereal Grains with Different Starch Components: A Mini Review. J. Cereal Sci. 2022, 108, 103557. [Google Scholar] [CrossRef] [Scilit]
- Saqib, A.A.N.; Whitney, P.J. Differential Behaviour of the Dinitrosalicylic Acid (DNS) Reagent towards Mono- and Di-saccharide Sugars. Biomass Bioenergy 2011, 35, 4748–4750. [Google Scholar] [CrossRef] [Scilit]
- Huang, P.P.; Li, C.X.; Liu, H.W.; Zhao, Z.X.; Liao, W.B. Hydrogen Gas Improves Seed Germination in Cucumber by Regulating Sugar and Starch Metabolisms. Horticulturae 2021, 7, 456. [Google Scholar] [CrossRef] [Scilit]
- Wu, H.; Fan, S.; Gong, H.; Guo, J. Roles of salicylic acid in selenium-enhanced salt tolerance in tomato plants. Plant Soil 2023, 484, 569–588. [Google Scholar] [CrossRef] [Scilit]
- Zhang, R.; Dong, Y.; Li, Y.; Ren, G.; Chen, C.; Jin, X. SLs signal transduction gene CsMAX2 of cucumber positively regulated to salt, drought and ABA stress in Arabidopsis thaliana L. Gene 2023, 864, 147282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, C.; Bian, C.; Liu, W.; Sun, Z.; Xi, X.; Guo, D.; Liu, X.; Tian, Y.; Wang, C.; Zheng, X. Strigolactone alleviates the salinity-alkalinity stress of Malus hupehensis seedlings. Front. Plant Sci. 2022, 13, 901782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fan, X.Q.; Li, H.; Guo, Y.S.; Sun, H.C.; Wang, S.Y.; Qi, Q.; Jiang, X.N.; Wang, Y.; Xu, X.F.; Qiu, C.P.; et al. Integrated Multi-omics Analysis Uncovers Roles of Mdm-miR164b-MdORE1 in Strigolactone-mediated Inhibition of Adventitious Root Formation in Apple. Plant Cell Environ. 2022, 45, 3582–3603. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, X.; Ruyter-Spira, C.; Bouwmeester, H. The interaction between strigolactones and other plant hormones in the regulation of plant development. Front. Plant Sci. 2013, 4, 199. [Google Scholar] [CrossRef] [Scilit]
- Ahsan, M.; Zulfiqar, H.; Farooq, M.A.; Ali, S.; Tufail, A.; Kanwal, S.; Shaheen, M.R.; Sajid, M.; Gul, H.; Jamal, A.; et al. Strigolactone (GR24) Application Positively Regulates Photosynthetic Attributes, Stress-Related Metabolites and Antioxidant Enzymatic Activities of Ornamental Sunflower (Helianthus Annuus Cv. Vincent’s Choice) under Salinity Stress. Agriculture 2023, 13, 50. [Google Scholar] [CrossRef] [Scilit]
- Ma, N.; Hu, C.; Wan, L.; Hu, Q.; Xiong, J.; Zhang, C. Strigolactones Improve Plant Growth, Photosynthesis, and Alleviate Oxidative Stress under Salinity in Rapeseed (Brassica napus L.) by Regulating Gene Expression. Front. Plant Sci. 2017, 8, 1671. [Google Scholar] [CrossRef] [Scilit]
- Koltai, H.; Dor, E.; Hershenhorn, J.; Joel, D.M.; Weininger, S.; Lekalla, S.; Shealtiel, H.; Bhattacharya, C.; Eliahu, E.; Resnick, N.; et al. Strigolactones’ effect on root growth and roothair elongation may be mediated by auxin-efflux carriers. J. Plant Growth Regul. 2010, 29, 129–136. [Google Scholar] [CrossRef] [Scilit]
- Villaécija-Aguilar, J.A.; Hamon-Josse, M.; Carbonnel, S.; Kretschmar, A.; Schmidt, C.; Dawid, C.; Bennett, T.; Gutjahr, C. SMAX1/SMXL2 regulate root and root hair development downstream of KAI2-mediated signalling in Arabidopsis. PLoS Genet. 2019, 15, e1008327. [Google Scholar] [CrossRef] [Scilit]
- Altamura, M.M.; Piacentini, D.; Rovere, F.D.; Fattorini, L.; Falasca, G.; Betti, C. New Paradigms in Brassinosteroids, Strigolactones, Sphingolipids, and Nitric Oxide Interaction in the Control of Lateral and Adventitious Root Formation. Plants 2023, 12, 413. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Zhang, L.; Ma, C.; Su, M.; Wang, J.; Zheng, S.; Zheng, T. Exogenous strigolactones alleviate the photosynthetic inhibition and oxidative damage of cucumber seedlings under salt stress. Sci. Hortic. 2022, 297, 110962. [Google Scholar] [CrossRef] [Scilit]
- Hira, Z.; Muhammad, S.; Muhammad, A.; Muhammad, N.; Hammad, N.; Muhammad, A.; Shah, F. Strigolactone (GR24) Induced Salinity Tolerance in Sunflower (Helianthus annuus L.) by Ameliorating Morpho-Physiological and Biochemical Attributes Under In Vitro Conditions. J. Plant Growth Regul. 2021, 40, 2079–2091. [Google Scholar]
- Wang, L.; Wang, B.; Yu, H.; Guo, H.; Lin, T.; Kou, L.; Wang, A.; Shao, N.; Ma, H.; Xiong, G.; et al. Transcriptional regulation of strigolactone signalling in Arabidopsis. Nature 2020, 583, 277–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ho Do, M.; Seo, Y.S.; Park, H.Y. Polysaccharides: Bowel health and gut microbiota. Crit. Rev. Food Sci. Nutr. 2021, 61, 1212–1224. [Google Scholar] [CrossRef] [Scilit]
- Ballell, L.; Young, R.J.; Field, R.A. Synthesis and evaluation of mimetics of UDP and UDP-alpha-D-galactose, dTDP and dTDP-alpha-D-glucose with monosaccharides replacing the key pyrophosphate unit. Org. Biomol. Chem. 2005, 3, 1109–1115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.H.; Tsai, M.Y.; Lee, G.C.; Shaw, J.F. Construction of a recombinant thermostable beta-amylase-trehalose synthase bifunctional enzyme for facilitating the conversion of starch to trehalose. J. Agric. Food Chem. 2007, 55, 1256–1263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delorge, I.; Janiak, M.; Carpentier, S.; Van Dijck, P. Fine tuning of trehalose biosynthesis and hydrolysis as novel tools for the generation of abiotic stress tolerant plants. Front. Plant Sci. 2014, 5, 147. [Google Scholar] [CrossRef] [Scilit]
- Henry, C.; Bledsoe, S.W.; Griffiths, C.A.; Kollman, A.; Paul, M.J.; Sakr, S.; Lagrimini, L.M. Differential Role for Trehalose Metabolism in Salt-Stressed Maize. Plant Physiol. 2015, 169, 1072–1089. [Google Scholar] [CrossRef] [Scilit]
- Yuan, G.; Sun, D.; An, G.; Li, W.; Si, W.; Liu, J.; Zhu, Y. Transcriptomic and Metabolomic Analysis of the Effects of Exogenous Trehalose on Salt Tolerance in Watermelon (Citrullus lanatus). Cells 2022, 11, 2338. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Xie, J.; Li, J.; Zhang, J.; Zhang, X.; Yao, Y.; Wang, C.; Niu, T.; Bakpa, E.P. Trehalose alleviates salt tolerance by improving photosynthetic performance and maintaining mineral ion homeostasis in tomato plants. Front. Plant Sci. 2022, 13, 974507. [Google Scholar] [CrossRef] [Scilit]
- Li, G.D.; Pan, L.N.; Jiang, K.; Takahashi, I.; Nakamura, H.; Xu, Y.W.; Asami, T.; Shen, R.F. Strigolactones Are Involved in Sugar Signaling to Modulate Early Seedling Development in Arabidopsis. Plant Biotechnol. 2016, 33, 87–97. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, I.; Jiang, K.; Asami, T. Counteractive effects of sugar and strigolactone on leaf senescence of rice in darkness. Agronomy 2021, 11, 1044. [Google Scholar] [CrossRef] [Scilit]
- Martins, M.C.; Hejazi, M.; Fettke, J.; Steup, M.; Feil, R.; Krause, U.; Arrivault, S.; Vosloh, D.; Figueroa, C.M.; Ivakov, A.; et al. Feedback inhibition of starch degradation in Arabidopsis leaves mediated by trehalose 6-phosphate. Plant Physiol. 2013, 163, 1142–1163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kolbe, A.; Tiessen, A.; Schluepmann, H.; Paul, M.; Ulrich, S.; Geigenberger, P. Trehalose 6-phosphate Regulates Starch Synthesis via Posttranslational Redox Activation of ADP-glucose Pyrophosphorylase. Proc. Natl. Acad. Sci. USA 2005, 102, 11118–11123. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saripalli, G.; Gupta, P.K. AGPase: Its role in crop productivity with emphasis on heat tolerance in cereals. Theor. Appl. Genet. 2015, 128, 1893–1916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stracke, C.; Meyer, B.H.; Hagemann, A.; Jo, E.; Lee, A.; Albers, S.V.; Cha, J.; Bräsen, C.; Siebers, B. Salt Stress Response of Sulfolobus acidocaldarius Involves Complex Trehalose Metabolism Utilizing a Novel Trehalose-6-Phosphate Synthase (TPS)/Trehalose-6-Phosphate Phosphatase (TPP) Pathway. Appl. Environ. Microbiol. 2020, 86, e01565-20. [Google Scholar] [CrossRef] [Scilit]
- Haider, I.; Aneo-Jimenez, B.; Bruno, M.; Bimbo, A.; Floková, K.; Abuauf, H.; Ntui, V.O.; Guo, X.; Charnikhova, T.; Al-Babili, S.; et al. The Interaction of Strigolactones with Abscisic Acid during the Drought Response in Rice. J. Exp. Bot. 2018, 69, 2403–2414. [Google Scholar] [CrossRef] [Scilit]
- Wu, S.; Ma, X.Q.; Zhou, A.Q.; Valenzuela, A.; Zhou, K.; Li, Y.R. Establishment of Strigolactone-producing Bacterium-yeast Consortium. Sci. Adv. 2021, 7, eabh4048. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; He, H.; Vitali, M.; Visentin, I.; Charnikhova, T.; Haider, I.; Cardinale, F. Osmotic stress represses strigolactone biosynthesis in lotus japonicus roots: Exploring the interaction between strigolactones and ABA under abiotic stress: An international journal of plant biology. Planta 2015, 241, 1435–1451. [Google Scholar] [CrossRef] [Scilit]
- Toh, S.; Kamiya, Y.; Kawakami, N.; Nambara, E.; McCourt, P.; Tsuchiya, Y. Thermoinhibition uncovers a role for strigolactones in Arabidopsis seed germination. Plant Cell Physiol. 2012, 53, 107–117. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Zhao, L.J.; Wang, L.T.; Liu, X.Y.; Yu, Z.; Liu, J.; Wu, W.Z.; Ding, L.; Xia, C.; Zhang, L.C.; et al. TabZIP60 Is Involved in the Regulation of ABA Synthesis-mediated Salt Tolerance through Interacting with TaCDPK30 in Wheat (Triticum aestivum L.). Planta 2023, 257, 107. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.R.; Blakeslee, J.J.; Jones, M.L.; Chapin, L.J.; Dami, I.E. Exogenous Abscisic Acid Enhances Physiological, Metabolic, and Transcriptional Cold Acclimation Responses in Greenhouse-Grown Grapevines. Plant Sci. 2020, 293, 110437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lei, M.; Wu, X.; Zhang, J.; Wang, H.; Huang, C. Gene cloning, expression, and characterization of trehalose-6-phosphate synthase from Pleurotus ostreatus. J. Basic Microbiol. 2017, 57, 580–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, T.; Tiwari, N.; Bharadwaj, C.; Roorkiwal, M.; Reddy, S.P.P.; Patil, B.S.; Kumar, S.; Hamwieh, A.; Vinutha, T.; Bindra, S.; et al. A comprehensive analysis of Trehalose-6-phosphate synthase (TPS) gene for salinity tolerance in chickpea (Cicer arietinum L.). Sci. Rep. 2022, 12, 16315. [Google Scholar] [CrossRef] [Scilit]
- Acosta-Pérez, P.; Camacho-Zamora, B.D.; Espinoza-Sánchez, E.A.; Gutiérrez-Soto, G.; Zavala-García, F.; Abraham-Juárez, M.J.; Sinagawa-García, S.R. Characterization of Trehalose-6-phosphate Synthase and Trehalose-6-phosphate Phosphatase Genes and Analysis of its Differential Expression in Maize (Zea mays) Seedlings under Drought Stress. Plants 2020, 9, 315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pramanik, M.H.R.; Imai, R. Functional Identification of a Trehalose 6-phosphate Phosphatase Gene That Is Involved in Transient Induction of Trehalose Biosynthesis during Chilling Stress in Rice. Plant Mol. Biol. 2005, 58, 751–762. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Gene Name | Gene ID | Primer Sequence (5′–3′) |
|---|---|---|
| TPS1 | LOC100135703 | GGGCAGAAACCGAGTATGGCTAAG |
| CGACAGAGGCGAGTTGATGGAC | ||
| TPS2 | LOC101250326 | GCAAGGAACGGAGAAGCTGGATG |
| ACTCAGAAACCACCAACATGCTCTC | ||
| TPP1 | LOC101259279 | CCAAGCAGAGGTGTTCTTCGGATG |
| TGTTTGTGAGCGTTCTGGTGTCC | ||
| TPP2 | LOC101245612 | ACTCTCAGCACCAGGTTACTCACAG |
| ACTCTCAGCACCAGGTTACTCACAG | ||
| Actin | NC_015447 | AATGAACTTCGTGTGGCTCCAGAG |
| ATGGCAGGGGTGTTGAAGGTTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lu, X.; Liu, X.; Xu, J.; Liu, Y.; Chi, Y.; Yu, W.; Li, C. Strigolactone-Mediated Trehalose Enhances Salt Resistance in Tomato Seedlings. Horticulturae 2023, 9, 770. https://doi.org/10.3390/horticulturae9070770
Lu X, Liu X, Xu J, Liu Y, Chi Y, Yu W, Li C. Strigolactone-Mediated Trehalose Enhances Salt Resistance in Tomato Seedlings. Horticulturae. 2023; 9(7):770. https://doi.org/10.3390/horticulturae9070770
Chicago/Turabian StyleLu, Xuefang, Xiaojun Liu, Junrong Xu, Yunzhi Liu, Yuzhen Chi, Wenjin Yu, and Changxia Li. 2023. "Strigolactone-Mediated Trehalose Enhances Salt Resistance in Tomato Seedlings" Horticulturae 9, no. 7: 770. https://doi.org/10.3390/horticulturae9070770
APA StyleLu, X., Liu, X., Xu, J., Liu, Y., Chi, Y., Yu, W., & Li, C. (2023). Strigolactone-Mediated Trehalose Enhances Salt Resistance in Tomato Seedlings. Horticulturae, 9(7), 770. https://doi.org/10.3390/horticulturae9070770

