Next Article in Journal
Sustainable Use of Sewage Sludge for Marigold (Tagetes erecta L.) Cultivation: Experimental and Predictive Modeling Studies on Heavy Metal Accumulation
Previous Article in Journal
Three Different Fertilizers Enhance Spinach Growth and Reduce Spinach Cd Concentration in Cd Contaminated Alkaline Soil
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 9
Issue 4
10.3390/horticulturae9040446
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Systematic Analysis of Two Tandem GGDEF/EAL Domain Genes Regulating Antifungal Activities in Pseudomonas glycinae MS82

by
Jinsheng Lin
1,
Shaoxuan Qu
1,
Xianyi Chen
1,
Huiping Li
1,
Lijuan Hou
1,
Shi-En Lu
2,
Ping Xu
1,
Ning Jiang
1 and
Lin Ma
1,*
1
Jiangsu Key Laboratory for Horticultural Crop Genetic Improvement, Institute of Vegetable Crops, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China
2
Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Starkville, MS 39762, USA
*
Author to whom correspondence should be addressed.
Horticulturae 2023, 9(4), 446; https://doi.org/10.3390/horticulturae9040446
Submission received: 27 February 2023 / Revised: 20 March 2023 / Accepted: 28 March 2023 / Published: 29 March 2023
(This article belongs to the Section Insect Pest Management)
Browse Figures
Review Reports Versions Notes

Abstract

Cyclic diguanylate (c-di-GMP) affects bacterial physiological and biochemical functions like biofilm, motility, virulence, and bacterial secretion systems. GGDEF/EAL-domain proteins, participating in c-di-GMP synthesis and degradation, are widely present in Pseudomonas, with various structures and functions. Pseudomonas glycinae MS82 is a rhizosphere bacterium that protects mushroom against the pathogenic fungi. Although 14 genes encoding GGDEF/EAL-domain proteins have been identified in the genome of MS82, c-di-GMP regulation is poorly understood as a facilitator or repressor of physiological phenotypes. Here, PafQ and PafR, encoding the proteins with the tandem GGDEF/EAL domain, were functionally analyzed and found to regulate antifungal activity. Individual deletion mutants of PafQ and PafR were constructed in P. glycinae MS82 through biparental conjugation and homologous recombination. Subsequently, antifungal activity, biofilm formation, motility, and expression of the genes related to antifungal substance synthesis were examined and contrasted with those of wild-type P. glycinae MS82. Most phenotypes of physiological activities were significantly reduced after knocking out PafQ or PafR. In other members of the genus Pseudomonas, homologous genes of PafQ and PafR possess different functions in c-di-GMP regulation. In P. glycinae, the positive regulation of PafQ and PafR on fungistatic substance synthesis, biofilm formation, and motility is crucial in the biocontrol of mushroom diseases.

1. Introduction

Pseudomonas spp., a type of rhizospheric microorganism, are termed plant growth-promoting rhizobacteria (PGPR) because of their effect of promoting plant growth and controlling plant diseases [1]. Pseudomonas spp. can produce a variety of antibiotic substances, such as phenazines [2], pyrrolnitrin (PRN) [3], 2,4-diacetylphloroglucinol (DAPG) [4], pyoluteorin (PLT) [5], hydrocyanic acid (HCN) [6], cyclic lipopeptide (CLP) [7], etc. Recently, increasing attention has been paid to the effective control of diseases of edible fungi by using the antifungal substances produced by Pseudomonas spp. These antifungal substances had obvious inhibitory effects on brown blotch disease [8], dry bubble disease [9], and so on. Pseudomonas glycinae MS82, formerly known as P. fluorescens MS82, isolated from the rhizosphere of a soybean plant, was shown to have good prospects of biocontrol application through in vivo and in vitro tests. A striking feature of P. glycinae MS82 is its antifungal activity against the pathogenic fungi Trichoderma viride and Mycogone perniciosa, which affect edible mushroom, but not against the fungus Agaricus bisporus, the most commonly and widely consumed mushroom globally [10,11].
Cyclic diguanylate monophosphate (c-di-GMP) is a ubiquitous in bacteria and serves as an important second messenger that regulates important physiological and biochemical functions of bacteria, such as biofilm [12], motility [13], virulence [14], bacterial secretion systems [15], quorum sensing [16] and other physiological activities and metabolism. The metabolism and intracellular levels of c-di-GMP in bacteria are predominantly regulated by diguanylate cyclase (DGC) and phosphodiesterase (PDE), while DGC and PDE are mainly determined by the highly conserved GGDEF and EAL domains [17]. There is a class of genes in bacteria that possess have both GGDEF and EAL domains. However, while it appears that these two domains with opposite catalytic functions exist in the same gene, in fact either the GGDEF domain has weak or no enzyme activity [18], or only one of the activities is displayed [19].
The cyclic diguanylate signaling pathway is well known for regulating bacterial antimicrobial functions. C-di-GMP in Pseudomonas fluorescens could improve the effect of biological control through promoting the formation of biofilm and enhancing its colonization ability in plant rhizosphere [20]. But the higher intracellular levels of c-di-GMP is the inhibitory signal for the antifungal substance HSAF secreted by Lysobacter enzymogenes OH11 [21]. Our previous research showed that the tandem GGDEF/EAL domain gene PafR is required for the antifungal activity of P. gylcinae MS82 against T. viride and M. perniciosa [10]. This study aimed to further investigate the regulation of the genes containing the tandem GGDEF/EAL domain on bacterial phenotypes including synthesis of antifungal active substances in P. gylcinae MS82 by quantitative analyses of antifungal activity and other related functions in the corresponding mutants.

2. Materials and Methods

2.1. Bacterial Strains, Media, and Growth Conditions

Bacterial strains and plasmids used in this work are detailed in Table 1. Bacteria strains were cultured at 28 °C (P. gylcinae) or 37 °C (Escherichia coli) in liquid LB (Luria-Bertani) or on LB-agar plates [22]. The concentrations of ampicillin (Amp) and gentamicin (Gm) were both 50 ng/mL in the different media. P. glycinae MS82 and mutants were grown on LB-agar plates for determination of biofilm formation. In the bacterial motility assay, the swimming medium was adjusted to LB medium containing 0.3% (w/v) agar, the swarming medium was adjusted to LB medium containing 0.7% (w/v) agar, and twitching motility medium was adjusted to LB medium containing 1% (w/v) agar.

2.2. Construction of PafQ and PafR Deletion Mutants

Deletion mutants were constructed using the homologous recombination and parental combination method as described previously [24]. Briefly, the up- and down-stream regions of PafQ and PafR were amplified with four pairs of primers (see Table 2), respectively. The plasmid pEX18-13385 (or pEX18-24120) was obtained by digesting both regions with the selected restriction enzyme. Finally, the PafQ (or PafR) deletion mutant MT13385 (or MT24120) clones could grow on LB media containing ampicillin but not on the media supplemented with both ampicillin and gentamicin.

2.3. Bioassay of Fungistatic Activity

The fungistatic activities of P. glycinae MS82, MT13385, and MT24120 were performed with the inhibition zone method as described previously [25]. In brief, 10 μL bacterial suspension (the concentration is approximately 2 × 108 CFU/mL) was inoculated in the center of a LB-agar plate. The T. virens strain NJ1 spore suspension (about 2 × 108/mL spore) was oversprayed onto the plate with a TLC Reagent Sprayer after the bacterial inoculum dried. The inoculated plates were incubated at 28 °C for two days in the dark. Three independent replicates were conducted and the diameter of the antifungal zone of each treatment was measured.

2.4. qRT-PCR Analysis

P. glycinae MS82 produces several substances with antifungal activities [11]. To understand whether deletion of the two genes had any effect on the expression of genes involved in the synthesis of these antimicrobial substances, expressions of some related synthesis genes in different mutants were quantitatively measured by qRT-PCR analysis. Total RNA was extracted from bacteria cells (106 cells per sample) with TSP412 reagent (TSINGKE, Beijing, China) and reverse transcription was performed using a Goldenstar RT6 cDNA Synthesis Kit Ver 2 (TSINGKE, Beijing, China) as per the manufacturer’s protocols. Relative mRNA quantification was calculated using a standard curve. Target gene expression was normalized to that of the housekeeping gene gyrB. Primers used for qRT-PCR are listed in Table 3.

2.5. Analysis of Biofilm Formation

Biofilm formation was analyzed at different time points as described by Huertas-Rosales et al. [26]. The assay was performed on the sterile 96-well flat-bottom plates. Inoculated plates were incubated at 28 °C up to 48 h. Observations were made each 12 h for a total of four times. The experiments were repeated 4 times with three technical replicates each.

2.6. Analysis of Motility

Analyses of swimming, swarming, and twitching motility were conducted as described previously [27]. For swimming and swarming assay, 10 μL liquid cultures of P. glycinae MS82, MT13385, and MT24120 were spotted in the center of medium plates, then grown statically at 28 °C for 12 h. For twitching assay, three different clones were seeded on the base of the twitching plates and grown statically at 28 °C. 72 h later, the agar was removed and the empty plate was dealt with 0.01% crystal violet for half an hour. Finally, spreading diameters in the three kinds of motility assay were measured. Three replicates were performed for each assay.

3. Results

3.1. Deletion of PafQ and PafR

According to the genome of P. glycinae MS82 deposited in the GenBank database under accession number CP028826.1, PafQ (locus_tag: DBV33_13385) and PafR (locus_tag: DBV33_24120) are two of the 14 tandem GGDEF/EAL domain genes encoding proteins associated with biosynthesis of DGCs and/or PDEs of c-di-GMP. PafQ is a 2082-bp gene consisting of a MHYT-GGDEF-EAL domain, while PafR is a 3822-bp gene and contains three PAC domains, two PAS motifs, and one GGDEF/EAL domain.
To investigate potential biological functions of PafQ and PafR, two deletion mutants were constructed from P. glycinae MS82. The length of amplified fragments containing up- and downstream regions of PafQ or PafR were 812 bp and 706 bp from strains MT13385 and MT24120, respectively (Figure 1A-1,B-2). The deletion mutants were confirmed through PCR combined with restriction enzyme digestion, and the fragment sequences were subjected to BLAST from the National Center for Biotechnology Information (NCBI, https://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 25 November 2021). Genetic stability of the mutant strains were confirmed by continuously culturing.

3.2. Bioassay of Fungistatic Activity

Fungistatic activities of P. glycinae MS82 and two mutants against the fungal pathogen T. virens were significantly different (Figure 2); when PafQ and PafR were knocked out separately, the antifungal activities of both strains decreased markedly. In addition, the antifungal activity of strain MT13385 (PafQ deletion mutant, 15.67 ± 1.15 mm) was significantly higher than that of strain MT24120 (PafR deletion mutant, 1.67 ± 0.58 mm).

3.3. qRT-PCR Analysis

Transcriptomic analysis was conducted using qRT-PCR to evaluate the regulatory function(s) of PafQ and PafR on nine genes related to the synthesis of antifungal substances (Figure 3). After deletion of the gene PafQ, the expression of eight of the examined genes was significantly reduced compared with the expression levels in strain MS82; the exception was the gene 17145, which exhibited increased expression in strain MT13385. However, the expression of all the nine genes in the PafR-deletion mutant MT24120 was significantly lower compared with that in strain MS82, and the expression of six genes in strain MT24120 was significantly lower compared with that in the PafQ-deletion mutant MT13385. The differences in the expression of these genes related to antifungal substance synthesis in different mutants was correlated with the differences in antibacterial activity.

3.4. Analysis of Biofilm Formation

Effects of deletion of genes PafQ and PafR on bacterial biofilm formation were analyzed and shown in Figure 4. At 12 h, the amounts of biofilm formed by both mutants were lower compared with that of strain MS82. However, at 24 h, the amount of biofilm formed by MT13385 was significantly higher than those of strains MT24120 and MS82. After 36 h, the biofilm formation amount of strain MS82 was significantly lower compared with that of strain MT13385 and significantly higher than that of strain MT24120. These data suggest deletions of genes PafQ and PafR have opposing effects on bacterial biofilm formation.

3.5. Analysis of Motility

The motility assay showed slightly different results among the three types of motility (Figure 5). The diameters of the two deletion mutants (strains MT13385 and MT24120) for all three motility assays were significantly lower than those of the wild-type strain MS82. In the swimming and swarming motility assays, the diameters between the two mutants was not different significant; however, in the twitching motility assay, the diameter of strain MT24120 was significantly higher than that of strain MT13385. These results indicated that both PafQ and PafR had positive effects on motility ability, but the extent of the effects was different.

4. Discussion

In the past decade, most research on c-di-GMP focused on pathogenic bacteria, especially Pseudomonas aeruginosa, an important pathogenic bacterium in humans and animals. The c-di-GMP signaling pathway regulates the physiological functions of motility [28], toxicity [29], exopolysaccharides (EPS) [17], and biofilm formation [30]. Most of these traits are closely related to the pathogenicity or drug resistance of bacteria. Roles of c-di-GMP in pathogenesis has been extensively studied, and the c-di-GMP signaling pathway is known to influence the bacteriostatic ability of bacteria through the regulation of metabolite synthesis, biofilm formation, and motility. However, its function in biocontrol traits of PGPR remains to be further investigated.
One of the most common mechanisms of Pseudomonas as biocontrol bacteria is to inhibit the growth of pathogens by secreting secondary metabolites. The synthesis of some metabolites is regulated by c-di-GMP-related genes. For example, the production of 2,4-DAPG is negatively regulated by c-di-GMP through the RsmA and RsmE proteins. Furthermore, three of 23 GGDEF/EAL domain proteins are imvovled in regulation of biological control traits in P. fluorescens 2P24 [31]. PigX, a GGDEF/EAL domain protein, has high homology in biocontrol strain Serratia plymuthica G3 and pathogenic strain Serratia sp. ATCC 39006 and exhibited a positive impact on PRN production in the former [32] but negative impacts on prodigiosin antibiotic biosynthesis in the latter [33]. The results of this study also suggest that the two GGDEF-EAL domain genes in strain MS82 could positively regulate the production of fungistatic substances.
The colonization ability of biocontrol bacteria is another key factor affecting biocontrol function. Biofilm formation and motility are closely related to colonization ability [34,35]. The process of biofilm formation in Pseudomonas is regulated by a variety of c-di-GMP-binding receptors, such as PilZ domain proteins (FlgZ, Alg44, and MapZ) [36,37,38], transcription regulatory factors (FleQ and BrlR) [39,40], degenerated GGDEF/EAL domain proteins (FimX and PelD) [41,42], T2SSE_N (MshEN) domain proteins (GspE) [43], GIL domain proteins (BcsA) [44], etc. These effector proteins regulate motility and EPS synthesis, and then affect biofilm formation [30]. Alg44, an endometrial protein with a PilZ domain, binds c-di-GMP, and the combining of c-di-GMP with Alg44 can activate the enzyme activity of glycosyltransferase Alg8 and then promote alginate synthesis and biofilm formation [45]. FleQ, as a positive regulator, directly binds the promoter regions of flagellar and EPS genes to promote biofilm production and colonization on plants [46]. FimX and PelD, each containing degenerated EAL and GGEDF domains, can combine with c-di-GMP through these degenerated domains, and both proteins positively affected biofilm formation by promoting the assembly of type IV pilus and the synthesis of EPS, respectively [42,47]. Genes PafQ and PafR also exhibited similar positive regulation on biofilm formation and motility in this study.
GGDEF and EAL domains, often linked in series, are widely found in proteins associated with c-di-GMP metabolism [48]. GGDEF/EAL domain proteins may be mono-functional or double-functional enzymes, and their activities may activate or inhibit each other. For example, there are six GGDEF/EAL domain proteins in Acetobacter xylinum, of which three show DGC activity and the other three exhibit PDE activity. They regulate bacterial cellulose synthesis [49]. In Shewanella baltica, the GGDEF-EAL domain protein Sbal_3235, which regulates the biofilm formation and spoilage activity, has both DGC and PDE activities [50]. PafQ, containing a tandem GGDEF-EAL domain and a conserved membrane-sensing MHYT domain, is highly homologous with MucR, a membrane-anchored protein that contains a GGDEF/EAL domain and exhibits both DGC and PDE activity [51]. MucR specifically exerts DGC activity to regulate alginate biosynthesis by activating alginate production through the formation of a localized c-di-GMP pool in the vicinity of Alg44 [52]. Binding of the MHYT domain of MucR with nitric oxide (NO) in the environment activates the PDE activity of MucR and inhibits its DGC activity. MucR promotes the degradation of c-di-GMP and affects the production of biofilms [53]. PafR, containing three PAS domains and a tandem GGDEF-EAL domain, is also highly homologous with MucR. The similarity between the gene PafR in MS82 and the gene MorA in P. putida PNL-MK25 was 89.16% with BLAST from the NCBI. MorA, a novel regulator localized in membrane, is conserved among diverse species of the genus Pseudomonas, and homologs are present in all genomes of members of the genus Pseudomonas sequenced thus far [54]. In P. putida, MorA restricts flagellar protein biosynthesis and assembly to the late growth stage of the bacterial cells [55]. In P. aeruginosa, MorA promotes the biofilm formation and negatively regulates protease secretion via the type II secretion system (T2SS) [56]. In P. glycinae MS82, PafR demonstrated positive regulation on antifungal activity, biofilm formation, and motility. These differences in the phenotypes may result from the different species of Pseudomonas used in the different studies [57].

5. Conclusions

This study confirmed the positive regulatory roles of tandem GGDEF/EAL-domain genes PafQ and PafR in the antifungal activity of biocontrol bacteria P. glycinae MS82. Most phenotypes of physiological activities, such as antifungal activity, biofilm formation, motility, were significantly reduced for the PafQ or PafR deletion mutant. In P. glycinae, the positive regulation of PafQ and PafR on fungistatic substance synthesis, biofilm formation, and motility is crucial in the biocontrol of mushroom diseases. Further investigations are needed to understand the detailed mechanisms by which the cyclic-di-GMP signaling pathway affects metabolites. Although c-di-GMP receptors have been reported extensively, it is difficult to foresee possible intermediary players without solid experimental data. Nevertheless, proteins with predicted c-di-GMP binding canonical motifs can be used to explore their roles as receptors in this signaling pathway.

Author Contributions

Conceptualization, S.-E.L. and L.M.; methodology, J.L., X.C. and L.M.; software, H.L. and P.X.; validation, S.Q., L.H. and N.J.; writing—original draft preparation, J.L. and X.C.; writing—review and editing, L.M. and S.-E.L.; funding acquisition, L.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded in part by a grant from the National Natural Science Foundation of China (No. 31901933) and the China Agriculture Research System of MOF and MARA (No. CARS-20).

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Liu, K.; Newman, M.; McInroy, J.A.; Hu, C.H.; Kloepper, J.W. Selection and assessment of plant growth-promoting rhizobacteria for biological control of multiple plant diseases. Phytopathology 2017, 107, 928–936. [Google Scholar] [CrossRef] [PubMed]
  2. Montelongo-Martínez, L.F.; Hernández-Méndez, C.; Muriel-Millan, L.F.; Hernández-Estrada, R.; Fabian-Del Olmo, M.J.; González-Valdez, A.; Soberón-Chávez, G.; Cocotl-Yañez, M. Unraveling the regulation of pyocyanin synthesis by RsmA through MvaU and RpoS in Pseudomonas aeruginosa ID4365. J. Basic Microbiol. 2023, 63, 51–63. [Google Scholar] [CrossRef]
  3. Zhang, J.; Mavrodi, D.V.; Yang, M.; Thomashow, L.S.; Weller, D.M. Pseudomonas synxantha 2-79 transformed with pyrrolnitrin biosynthesis genes has improved biocontrol activity against soilborne pathogens of wheat and canola. Phytopathology 2020, 110, 1010–1017. [Google Scholar] [CrossRef]
  4. Gutiérrez-García, K.; Neira-González, A.; Pérez-Gutiérrez, R.M.; Granados-Ramírez, G.; Zarraga, R.; Wrobel, K.; Barona-Gómez, F.; Flores-Cotera, B.L. Phylogenomics of 2,4-diacetylphloroglucinol-producing Pseudomonas and novel antiglycation endophytes from Piper auritum. J. Nat. Prod. 2017, 80, 1955–1963. [Google Scholar] [CrossRef]
  5. Zhang, Q.X.; Kong, X.W.; Li, S.Y.; Chen, X.J.; Chen, X.J. Antibiotics of Pseudomonas protegens FD6 are essential for biocontrol activity. Australas. Plant Pathol. 2020, 49, 307–317. [Google Scholar] [CrossRef]
  6. Pandey, S.; Gupta, S. Evaluation of Pseudomonas sp. for its multifarious plant growth promoting potential and its ability to alleviate biotic and abiotic stress in tomato (Solanum lycopersicum) plants. Sci. Rep. 2020, 10, 20951. [Google Scholar] [CrossRef] [PubMed]
  7. Ma, Z. Analysis of the complete genome sequence of a rhizosphere-derived Pseudomonas sp. HN3-2 leads to the characterization of a cyclic lipopeptide-type antibiotic bananamide C. 3 Biotech 2022, 12, 35. [Google Scholar] [CrossRef] [PubMed]
  8. Soler-Rivas, C.; Arpin, N.; Olivier, J.M.; Wichers, H.J. WLIP, a lipodepsipeptide of Pseudomonas ‘reactans’, as inhibitor of the symptoms of the brown blotch disease of Agaricus bisporus. J. Appl. Microbiol. 1999, 86, 635–641. [Google Scholar] [CrossRef]
  9. Tajalipour, S.; Hassanzadeh, N.; Jolfaee, H.K.; Heydarib, A.; Ghasemib, A. Biological control of mushroom brown blotch disease using antagonistic bacteria. Biocontrol Sci. Technol. 2014, 24, 473–484. [Google Scholar] [CrossRef]
  10. Ma, L.; Wang, X.; Deng, P.; Baird, S.M.; Liu, Y.; Qu, S.; Lu, S. The PafR gene is required for antifungal activity of strain MS82 against Mycogone perniciosa. Adv. Microbiol. 2017, 7, 217–230. [Google Scholar] [CrossRef][Green Version]
  11. Ma, L.; Qu, S.; Lin, J.; Jia, J.; Baird, S.M.; Jiang, N.; Li, H.; Hou, L.; Lu, S. The complete genome of the antifungal bacterium Pseudomonas sp. strain MS82. J. Plant Dis. Protect. 2019, 126, 153–160. [Google Scholar] [CrossRef]
  12. Tagua, V.G.; Molina-Henares, M.A.; Travieso, M.L.; Nisa-Martínez, R.; Quesada, J.M.; Espinosa-Urgel, M.; Ramos-González, M.I. C-di-GMP and biofilm are regulated in Pseudomonas putida by the CfcA/CfcR two-component system in response to salts. Environ. Microbiol. 2022, 24, 158–178. [Google Scholar] [CrossRef] [PubMed]
  13. Cutruzzolà, F.; Paiardini, A.; Rossi, C.S.; Spizzichino, S.; Paone, A.; Giardina, G.; Rinaldo, S. A conserved scaffold with heterogeneous metal ion binding site: The multifaceted example of HD-GYP proteins. Coordin. Chem. Rev. 2022, 450, 214228. [Google Scholar] [CrossRef]
  14. Verma, R.K.; Biswas, A.; Kakkar, A.; Lomada, S.K.; Pradhan, B.B.; Chatterjee, S. A bacteriophytochrome mediates interplay between light sensing and the second messenger cyclic di-GMP to control social behavior and virulence. Cell Rep. 2020, 32, 108202. [Google Scholar] [CrossRef]
  15. Ribbe, J.; Baker, A.E.; Euler, S.; O’Toole, G.A.; Maier, B. Role of cyclic di-GMP and exopolysaccharide in type IV pilus dynamics. J. Bacteriol. 2017, 199, e00859-16. [Google Scholar] [CrossRef]
  16. Gdaniec, B.G.; Allard, P.-M.; Queiroz, E.F.; Wolfender, J.-L.; van Delden, C.; Köhler, T. Surface sensing triggers a broad-spectrum antimicrobial response in Pseudomonas aeruginosa. Environ. Microbiol. 2020, 22, 3572–3587. [Google Scholar] [CrossRef]
  17. Blanco-Romero, E.; Garrido-Sanz, D.; Durán, D.; Rivilla, R.; Redondo-Nieto, M.; Martín, M. Regulation of extracellular matrix components by AmrZ is mediated by c-di-GMP in Pseudomonas ogarae F113. Sci. Rep. 2022, 12, 11914. [Google Scholar] [CrossRef] [PubMed]
  18. Christen, M.; Christen, B.; Folcher, M.; Schauerte, A.; Jenal, U. Identification and characterization of a cyclic di-GMP-specific phosphodiesterase and its allosteric control by GTP. J. Biol. Chem. 2005, 280, 30829–30837. [Google Scholar] [CrossRef]
  19. Römling, U.; Galperin, M.Y.; Gomelsky, M. Cyclic di-GMP: The first 25 years of a universal bacterial second messenger. Microbiol. Mol. Biol. Rev. 2013, 77, 1–52. [Google Scholar] [CrossRef]
  20. Muriel, C.; Blanco-Romero, E.; Trampari, E.; Arrebola, E.; Durán, D.; Redondo-Nieto, M.; Malone, J.G.; Martín, M.; Rivilla, R. The diguanylate cyclase AdrA regulates flagellar biosynthesis in Pseudomonas fluorescens F113 through SadB. Sci. Rep. 2019, 9, 8096. [Google Scholar] [CrossRef] [PubMed]
  21. Chen, Y.; Xia, J.; Su, Z.; Xu, G.; Gomelsky, M.; Qian, G.; Liu, F. Lysobacter PilR, the regulator of type IV pilus synthesis, controls antifungal antibiotic production via a cyclic di-GMP pathway. Appl. Environ. Microbiol. 2017, 83, e03397-16. [Google Scholar] [CrossRef] [PubMed]
  22. Lennox, E.S. Transduction of linked genetic characters of the host by bacteriophage P1. Virology 1955, 1, 190–206. [Google Scholar] [CrossRef]
  23. Jia, J.; Wang, X.; Deng, P.; Ma, L.; Baird, M.S.; Li, X.; Lu, S.E. Pseudomonas glycinae sp. nov. isolated from the soybean rhizosphere. MicrobiologyOpen 2020, 9, e1101. [Google Scholar] [CrossRef] [PubMed]
  24. Chen, X.; Qu, S.; Luo, X.; Lu, S.-E.; Liu, Y.; Li, H.; Hou, L.; Lin, J.; Jiang, N.; Ma, L. PafS containing GGDEF-domain regulates life activities of Pseudomonas glycinae MS82. Microorganisms 2022, 10, 2342. [Google Scholar] [CrossRef]
  25. Wang, X.Q.; Liu, A.X.; Guerrero, A.; Liu, J.; Yu, X.Q.; Deng, P.; Ma, L.; Baird, S.M.; Smith, L.; Li, X.D.; et al. Occidiofungin is an important component responsible for the antifungal activity of Burkholderia pyrrocinia strain Lyc2. J. Appl. Microbiol. 2015, 120, 607–618. [Google Scholar] [CrossRef]
  26. Huertas-Rosales, Ó.; Romero, M.; Heeb, S.; Espinosa-Urgel, M.; Camara, M.; Ramos-Gonzalez, M.I. The Pseudomonas putida CsrA/RsmA homologues negatively affect c-di-GMP pools and biofilm formation through the GGDEF/EAL response regulator CfcR. Envion. Microbiol. 2017, 19, 3551–3566. [Google Scholar] [CrossRef] [PubMed]
  27. Smet, J.D.; Wagemans, J.; Hendrix, H.; Staes, I.; Visnapuu, A.; Horemans, B.; Aertsen, A.; Lavigne, R. Bacteriophage mediated interference of the c-di-GMP signaling pathway in Pseudomonas aeruginosa. Microb. Biotechnol. 2020, 14, 967–978. [Google Scholar] [CrossRef]
  28. Cai, Y.; Hutchin, A.; Craddock, J.; Walsh, M.A.; Webb, J.S.; Tews, I. Differential impact on motility and biofilm dispersal of closely related phosphodiesterases in Pseudomonas aeruginosa. Sci. Rep. 2020, 10, 6232. [Google Scholar] [CrossRef]
  29. Meissner, A.; Wild, V.; Simm, R.; Rohde, M.; Erck, C.; Bredenbruch, F.; Morr, M.; Römling, U.; Hussler, S. Pseudomonas aeruginosa cupA-encoded fimbriae expression is regulated by a GGDEF and EAL domain-dependent modulation of the intracellular level of cyclic diguanylate. Envion. Microbiol. 2007, 9, 2475–2485. [Google Scholar] [CrossRef]
  30. Valentini, M.; Filloux, A. Biofilms and cyclic di-GMP (c-di-GMP) signaling: Lessons from Pseudomonas aeruginosa and other bacteria. J. Biol. Chem. 2016, 291, 12547–12555. [Google Scholar] [CrossRef]
  31. Liang, F.; Zhang, B.; Yang, Q.; Zhang, Y.; Zheng, D.; Zhang, L.Q.; Yan, Q.; Wu, X. Cyclic di-GMP regulates the quorum-sensing system and biocontrol activity of Pseudomonas fluorescens 2P24 through the RsmA and RsmE proteins. Appl. Environ. Microbiol. 2020, 86, e02016-20. [Google Scholar] [CrossRef] [PubMed]
  32. Wu, Y. Functional Analysis of the GGDEF/EAL Domain Protein PigX in Serratia plymuthica G3. Ph.D. Thesis, Jiangsu University, Zhenjiang, China, 2016. [Google Scholar]
  33. Fineran, P.C.; Williamson, N.R.; Lilley, K.S.; Salmond, G.P.C. Virulence and prodigiosin antibiotic biosynthesis in Serratia are regulated pleiotropically by the GGDEF/EAL domain protein, PigX. J. Bacteriol. 2007, 189, 7653–7662. [Google Scholar] [CrossRef] [PubMed]
  34. Blake, C.; Christensen, M.N.; Kovács, T. Molecular aspects of plant growth promotion and protection by Bacillus subtilis. Mol. Plant Microbe Interact. 2021, 34, 15–25. [Google Scholar] [CrossRef] [PubMed]
  35. Allard-Massicotte, R.; Tessier, L.; Lecuyer, F.; Lakshmanan, V.; Lucier, J.-F.; Garneau, D.; Caudwell, L.; Vlamakis, H.; Bais, H.P.; Beauregard, P.B. Bacillus subtilis early colonization of Arabidopsis thaliana roots involves multiple chemotaxis receptors. mBio 2016, 7, e01664-16. [Google Scholar] [CrossRef]
  36. Baker, A.E.; Diepold, A.; Kuchma, S.L.; Scott, J.E.; Ha, D.G.; Orazi, G.; Armitage, J.P.; O’Toole, G.A. PilZ domain protein FlgZ mediates cyclic di-GMP-dependent swarming motility control in Pseudomonas aeruginosa. J. Bacteriol. 2016, 198, 1837–1846. [Google Scholar] [CrossRef]
  37. Xu, L.; Xin, L.; Zeng, Y.; Yam, J.K.H.; Ding, Y.; Venkataramani, P.; Cheang, Q.W.; Yang, X.; Tang, X.; Zhang, L.-H.; et al. A cyclic di-GMP-binding adaptor protein interacts with a chemotaxis methyltransferase to control flagellar motor switching. Sci. Signal. 2016, 9, ra102/1–ra102/12. [Google Scholar] [CrossRef]
  38. Yan, X.-F.; Xin, L.; Yen, J.T.; Zeng, Y.; Jin, S.; Cheang, Q.W.; Fong, R.A.C.Y.; Chiam, K.-H.; Liang, Z.-X.; Gao, Y.-G. Structural analyses unravel the molecular mechanism of cyclic di-GMP regulation of bacterial chemotaxis via a PilZ adaptor protein. J. Biol. Chem. 2018, 293, 100–111. [Google Scholar] [CrossRef]
  39. Deepa, N.; Chauhan, S.; Kumari, P.; Rai, A.K.; Tandon, S.; Singh, A. Linalool reduces the virulence of Pseudomonas syringae pv. tomato DC 3000 by modulating the PsyI/PsyR quorum-sensing system. Microb. Pathog. 2022, 173, 105884. [Google Scholar] [CrossRef]
  40. Bense, S.; Witte, J.; Preuße, M.; Koska, M.; Pezoldt, L.; Dröge, A.; Hartmann, O.; Müsken, M.; Schulze, J.; Fiebig, T.; et al. Pseudomonas aeruginosa post-translational responses to elevated c-di-GMP levels. Mol. Microbiol. 2022, 117, 1213–1226. [Google Scholar] [CrossRef]
  41. Jain, R.; Sliusarenko, O.; Kazmierczak, B.I. Interaction of the cyclic-di-GMP binding protein FimX and the Type 4 pilus assembly ATPase promotes pilus assembly. PLoS Pathog. 2017, 13, e1006594. [Google Scholar] [CrossRef]
  42. Whitfield, G.B.; Marmont, L.S.; Ostaszewski, A.; Rich, J.D.; Whitney, J.C.; Parsek, M.R.; Harrison, J.J.; Howell, P.L. Pel polysaccharide biosynthesis requires an inner membrane complex comprised of PelD, PelE, PelF, and PelG. J. Bacteriol. 2020, 202, e00684-19. [Google Scholar] [CrossRef]
  43. Roelofs, K.G.; Jones, C.J.; Helman, S.R.; Shang, X.; Orr, M.W.; Goodson, J.R.; Galperin, M.Y.; Yildiz, F.H.; Lee, V.T. Systematic identification of cyclic-di-GMP binding proteins in Vibrio cholerae reveals a novel class of cyclic-di-GMP-binding ATPases associated with type II secretion systems. PLoS Pathog. 2015, 27, e1005232. [Google Scholar] [CrossRef] [PubMed]
  44. Fang, X.; Ahmad, I.; Blanka, A.; Schottkowski, M.; Cimdins, A.; Galperin, M.Y.; Römling, U.; Gomelsky, M. GIL, a new c-di-GMP-binding protein domain involved in regulation of cellulose synthesis in enterobacteria. Mol. Microbiol. 2014, 93, 439–452. [Google Scholar] [CrossRef] [PubMed]
  45. Zhou, E.; Seminara, A.B.; Kim, S.; Hall, C.L.; Wang, Y.; Lee, V.T. Thiol-benzotriazolo-quinazolinone inhibits Alg44 binding to c-di-GMP and reduces alginate production by Pseudomonas aeruginosa. ACS Chem. Biol. 2017, 12, 3076–3085. [Google Scholar] [CrossRef] [PubMed]
  46. Molina-Henares, M.A.; Ramos-González, M.I.; Daddaoua, A.; Fernández-Escamilla, A.M.; Espinosa-Urgel, M. FleQ of Pseudomonas putida KT2440 is a multimeric cyclic diguanylate binding protein that differentially regulates expression of biofilm matrix components. Res. Microbiol. 2017, 168, 36–45. [Google Scholar] [CrossRef] [PubMed]
  47. Qi, Y.; Chuah, M.L.C.; Dong, X.; Xie, K.; Luo, Z.; Tang, K.; Liang, Z.X. Binding of cyclic diguanylate in the non-catalytic EAL domain of FimX induces a long-range conformational change. J. Biol. Chem. 2011, 286, 2910–2917. [Google Scholar] [CrossRef]
  48. Nie, H.; Xiao, Y.; He, J.; Liu, H.; Nie, L.; Chen, W.; Huang, Q. Phenotypic–genotypic analysis of GGDEF/EAL/HD-GYP domain-encoding genes in Pseudomonas putida. Environ. Microbiol. Rep. 2020, 12, 38–48. [Google Scholar] [CrossRef]
  49. Tal, R.; Wong, H.C.; Calhoon, R.; Gelfand, D.; Benziman, M. Three cdg operons control cellular turnover of cyclic di-GMP in Acetobacter xylinum: Genetic organization and occurrence of conserved domains in isoenzymes. J. Bacteriol. 1998, 180, 4416–4425. [Google Scholar] [CrossRef]
  50. Wang, F.; Wang, Y.; Cen, C.; Fu, L.; Wang, Y. A tandem GGDEF-EAL domain protein-regulated c-di-GMP signal contributes to spoilage-related activities of Shewanella baltica OS155. Appl. Microbiol. Biotechnol. 2020, 104, 2205–2216. [Google Scholar] [CrossRef]
  51. Wang, Y.; Hay, I.D.; Rehman, Z.U.; Rehm, B.H.A. Membrane-anchored MucR mediates nitrate-dependent regulation of alginate production in Pseudomonas aeruginosa. Appl. Microbiol. Biotechnol. 2015, 99, 7253–7265. [Google Scholar] [CrossRef]
  52. Hay, I.D.; Remminghorst, U.; Rehm, B.H.A. MucR, a novel membrane-associated regulator of alginate biosynthesis in Pseudomonas aeruginosa. Appl. Environ. Microb. 2009, 75, 1110–1120. [Google Scholar] [CrossRef]
  53. Li, Y.; Heine, S.; Entian, M.; Sauer, K.; Frankenberg-Dinkel, N. NO-induced biofilm dispersion in Pseudomonas aeruginosa is mediated by an MHYT domain-coupled phosphodiesterase. J. Bacteriol. 2013, 195, 3531–3542. [Google Scholar] [CrossRef] [PubMed]
  54. Phippen, C.W.; Mikolajek, H.; Schlaefli, H.G.; Keevil, C.W.; Webb, J.S.; Tews, I. Formation and dimerization of the phosphodiesterase active site of the Pseudomonas aeruginosa MorA, a bi-functional c-di-GMP regulator. FEBS Lett. 2014, 588, 4631–4636. [Google Scholar] [CrossRef]
  55. Choy, W.-K.; Zhou, L.; Syn, C.K.-C.; Zhang, L.-H.; Swarup, S. MorA defines a new class of regulators affecting flagellar development and biofilm formation in diverse Pseudomonas species. J. Bacteriol. 2004, 186, 7221–7228. [Google Scholar] [CrossRef] [PubMed]
  56. Ravichandran, A.; Ramachandran, M.; Suriyanarayanan, T.; Wong, C.C.; Swarup, S. Global regulator MorA affects virulence-associated protease secretion in Pseudomonas aeruginosa PAO1. PLoS ONE 2015, 10, e0123805. [Google Scholar] [CrossRef] [PubMed]
  57. Katharios-Lanwermeyer, S.; Whitfield, G.B.; Howell, P.L.; O’Toole, G.A. Pseudomonas aeruginosa uses c-di-GMP phosphodiesterases RmcA and MorA to regulate biofilm maintenance. mBio 2021, 12, e03384-20. [Google Scholar] [CrossRef]
Horticulturae 09 00446 g001
Figure 1. PCR confirmation of PafQ and PafR deletion mutants. (A), PafQ; (B), PafR; M, marker 5000; 1, P. glycinae mutant MT13385; 2, P. glycinae mutant MT24120; 3, P. glycinae MS82 (wild-type strain).
Figure 1. PCR confirmation of PafQ and PafR deletion mutants. (A), PafQ; (B), PafR; M, marker 5000; 1, P. glycinae mutant MT13385; 2, P. glycinae mutant MT24120; 3, P. glycinae MS82 (wild-type strain).
Horticulturae 09 00446 g001
Horticulturae 09 00446 g002
Figure 2. Inhibition of PafQ and PafR deletion mutants against T. virens. Different letters indicate values are significantly different (p < 0.05). MS82, P. glycinae wild-type strain; MT13385, PafQ deletion mutant; MT24120, PafR deletion mutant.
Figure 2. Inhibition of PafQ and PafR deletion mutants against T. virens. Different letters indicate values are significantly different (p < 0.05). MS82, P. glycinae wild-type strain; MT13385, PafQ deletion mutant; MT24120, PafR deletion mutant.
Horticulturae 09 00446 g002
Horticulturae 09 00446 g003
Figure 3. qRT-PCR analysis of nine genes in PafQ and PafR deletion mutants. The nine genes are shown as identification numbers shown in the genome GenBank accession number CP028826.1. Different letters indicate values are significantly different (p < 0.05). MS82, P. glycinae the wild-type strain; MT13385, PafQ deletion mutant; MT24120, PafR deletion mutant.
Figure 3. qRT-PCR analysis of nine genes in PafQ and PafR deletion mutants. The nine genes are shown as identification numbers shown in the genome GenBank accession number CP028826.1. Different letters indicate values are significantly different (p < 0.05). MS82, P. glycinae the wild-type strain; MT13385, PafQ deletion mutant; MT24120, PafR deletion mutant.
Horticulturae 09 00446 g003
Horticulturae 09 00446 g004
Figure 4. Biofilm formation growth curves of PafQ and PafR deletion mutants. MS82, P. glycinae wild-type strain; MT13385, PafQ deletion mutant; MT24120, PafR deletion mutant.
Figure 4. Biofilm formation growth curves of PafQ and PafR deletion mutants. MS82, P. glycinae wild-type strain; MT13385, PafQ deletion mutant; MT24120, PafR deletion mutant.
Horticulturae 09 00446 g004
Horticulturae 09 00446 g005
Figure 5. Motility assay of PafQ and PafR deletion mutants. Different letters indicate values are statistically different (p < 0.05). MS82, P. glycinae the wild-type strain; MT13385, PafQ deletion mutant; MT24120, PafR deletion mutant.
Figure 5. Motility assay of PafQ and PafR deletion mutants. Different letters indicate values are statistically different (p < 0.05). MS82, P. glycinae the wild-type strain; MT13385, PafQ deletion mutant; MT24120, PafR deletion mutant.
Horticulturae 09 00446 g005
Table 1. Strains and plasmids used in this work.
Table 1. Strains and plasmids used in this work.
Strains and PlasmidsGenotype or Phenotype 1Source
Strains
E. coli
DH5αsupE44 ΔlacU169 (Φ80 lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1TSINGKE, Beijing, China
S17-1λRP4-2(Km::Tn7,Tc::Mu-1), pro-82, LAMpir, recA1, endA1, thiE1, hsdR17, creC510WEIDI, Shanghai, China
P. gylcinae
MS82Ampr 1, Wild type[23]
MT13385Ampr, PafQ deletion mutant derived from MS82 This work
MT24120Ampr, PafR deletion mutant derived from MS82This work
T. virens
NJ1A fungal pathogen collected from Pleurotus ostreatus substrateLab stock
Plasmids and vectors
pEX18GMGmr, Suicide vector, SacBFENGHUI, Changsha, China
pEX18-13385Gmr, up- and down-stream region of PafQ in PEX18GMThis work
pEX18-24120Gmr, up- and down-stream region of PafR in PEX18GMThis work
1 Ampr, Gmr stand for resistance to ampicillin and gentamicin.
Table 2. Primers used for deletion of PafQ and PafR.
Table 2. Primers used for deletion of PafQ and PafR.
Primer NameSequence 5′→3′Restriction
Enzyme Site 1		Length (bp)Annealing Temperature (°C)
13385-F1
13385-R1		CGGAATTCGAATACCTCAACAGACACTC 1
GGGGTACCCCTTGGCAGTAGCAATGCGC		Eco RI
Kpn I		38755
13385-F2
13385-R2		GGGGTACCGGAAATCACCGAAACCACCG
GCTCTAGAATGACCTGCGATTAGCGGCT		Kpn I
Xba I		42555
24120-F1
24120-R1		CGGAATTCCAGCCAGACCGCAGGATTAC
GGGGTACCGCTGTCGCTGAGGATTTTTC		Eco RI
Kpn I		40455
24120-F2
24120-R2		GGGGTACCGCGACGAGGTTCAGGGTTAT
GCTCTAGAATCGGGGGCAGAAAAGGGG		Kpn I
Xba I		30255
1 The restriction enzyme site is underlined in the primer sequence.
Table 3. Primers for qRT-PCR in RNA samples of mutants.
Table 3. Primers for qRT-PCR in RNA samples of mutants.
Gene Locus_tag 1Gene FunctionPrimer NamePrimer Sequence 5′→3′
DBV33_00020DNA gyrase subunit BgyrB-FCGGCACCCAGATTCACTT
gyrB-RGGAGTTGAGGAAGGACAGTT
DBV33_00835adenylyl-sulfate kinase835-FAGTCGTGGTCTGCAAAGTGT
835-RCTGCACCAGACCTCGCAATA
DBV33_09910non-ribosomal peptide synthetase (NRPS)9910-FCGTCAGACTGCTCAACACCT
9910-RTTGACCGATCGGCATTGTCA
DBV33_09945membrane dipeptidase9945-FATCGGGTTCAAGGACAACCC
9945-RTCCTTGTCGACTTCGTTCCC
DBV33_09975ornithine monooxygenase9975-FCAACAATGCCACCGGTGAAG
9975-RAAGCCCTGCATGTACAGACC
DBV33_11760NRPS11760-FCTGGCAGCGATCCATGTGTA
11760-RTGAATGACAACTCGCGACCA
DBV33_11765NRPS11765-FAGCATCTGGACGAACCTGTG
11765-RCAGGTCGAGGCGGAAGTATC
DBV33_12065NRPS12065-FGTTGAAGTGTGGCCGTTGTC
12065-RCGTTGCTGATCCGGACGATA
DBV33_12075NRPS12075-FGGTATCGGGCCAATCCTGAG
12075-RACCGCTGCCACTCAAATACA
DBV33_17145(2Fe-2S)-binding protein17145-FCAATGCACTGCCTAGAAAGAACC
17145-RTGAGCACGGTTTCGCCAATAG
1 The gene locus_tag stands for the gene number in the GenBank database under accession number CP028826.1.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lin, J.; Qu, S.; Chen, X.; Li, H.; Hou, L.; Lu, S.-E.; Xu, P.; Jiang, N.; Ma, L. Systematic Analysis of Two Tandem GGDEF/EAL Domain Genes Regulating Antifungal Activities in Pseudomonas glycinae MS82. Horticulturae 2023, 9, 446. https://doi.org/10.3390/horticulturae9040446

AMA Style

Lin J, Qu S, Chen X, Li H, Hou L, Lu S-E, Xu P, Jiang N, Ma L. Systematic Analysis of Two Tandem GGDEF/EAL Domain Genes Regulating Antifungal Activities in Pseudomonas glycinae MS82. Horticulturae. 2023; 9(4):446. https://doi.org/10.3390/horticulturae9040446

Chicago/Turabian Style

Lin, Jinsheng, Shaoxuan Qu, Xianyi Chen, Huiping Li, Lijuan Hou, Shi-En Lu, Ping Xu, Ning Jiang, and Lin Ma. 2023. "Systematic Analysis of Two Tandem GGDEF/EAL Domain Genes Regulating Antifungal Activities in Pseudomonas glycinae MS82" Horticulturae 9, no. 4: 446. https://doi.org/10.3390/horticulturae9040446

APA Style

Lin, J., Qu, S., Chen, X., Li, H., Hou, L., Lu, S.-E., Xu, P., Jiang, N., & Ma, L. (2023). Systematic Analysis of Two Tandem GGDEF/EAL Domain Genes Regulating Antifungal Activities in Pseudomonas glycinae MS82. Horticulturae, 9(4), 446. https://doi.org/10.3390/horticulturae9040446

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop