Next Article in Journal
Multi-Criteria DEXi Analysis for the Selection of Crop Species for Saltwater Aquaponics
Next Article in Special Issue
Antimicrobial Multiresistant Phenotypes of Genetically Diverse Pseudomonas spp. Isolates Associated with Tomato Plants in Chilean Orchards
Previous Article in Journal
Transcriptomic Analysis of Sunflower (Helianthus annuus) Roots Resistance to Orobanche cumana at the Seedling Stage
Previous Article in Special Issue
Development of a Highly Sensitive Loop-Mediated Isothermal Amplification Incorporated with Flocculation of Carbon Particles for Rapid On-Site Diagnosis of Blood Disease Bacterium Banana
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Review

Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit?

by
Rohaya Ibrahim
1,
Siti Izera Ismail
1,
Md Yasin Ina-Salwany
2 and
Dzarifah Zulperi
1,3,*
1
Department of Plant Protection, Faculty of Agriculture, Universiti Putra Malaysia, Serdang 43400, Selangor, Malaysia
2
Department of Aquaculture, Faculty of Agriculture, Universiti Putra Malaysia, Serdang 43400, Selangor, Malaysia
3
Laboratory of Sustainable Resources Management, Institute of Tropical Forestry and Forest Products, Universiti Putra Malaysia, Serdang 43400, Selangor, Malaysia
*
Author to whom correspondence should be addressed.
Horticulturae 2022, 8(8), 702; https://doi.org/10.3390/horticulturae8080702
Submission received: 10 June 2022 / Revised: 7 July 2022 / Accepted: 12 July 2022 / Published: 3 August 2022

Abstract

Jackfruit-bronzing disease, caused by Pantoea stewartii subsp. stewartii, has recently become more common in the jackfruit crop. Jackfruit-bronzing disease was first discovered in the Philippines in 2014 and spread to Malaysia and Mexico in 2017. Outbreaks of the disease reduced the quality of fresh jackfruit, lowered the market value of local jackfruit, and caused yield losses to the production and financial setbacks to the processors. This disease is more aggressive toward jackfruits with a sweeter flavor and high Brix composition. Symptoms are observable when the fruit is cut open, indicated by the appearance of rusty specks and yellowish-orange to reddish discoloration of the infected pulps and rags. Extensive research is needed to better understand the pathogen’s nature and pathogenicity, supporting future disease prevention and recognition of the pathogen-host interaction. This review explores the significance of the jackfruit-bronzing bacterium, its biology, diagnostics, and pathogenomics, emphasizing the pathogen’s virulence and the management strategies to mitigate this disease. Understanding this destructive bacterium will guide growers and agricultural practitioners to develop the most efficient and sustainable jackfruit-bronzing control methods.

1. Introduction

Jackfruit (Artocarpus heterophyllus Lam) falls into the class Magnoliopsida, order Rosales, and belongs to the family Moraceae [1,2]. It is a non-seasonal fruit and a close relative of Cempedak (Artocarpus integer) and breadfruit (Artocarpus altilis). It is the largest tree-borne fruit, at almost 1 m (39 in) long, and can weigh up to 60 kg (132 lb). For decades, it has been grown for food, fuel, timber, medicinal extracts, and as a source of income for rural people [3,4]. Jackfruit is indigenous to the Western Ghats of southern India. Today, it is widely cultivated throughout the South and Southeast Asian region, the Caribbean, Latin America, and parts of Africa [5,6,7]. The latest WorldAtlas has recorded India as the world’s top jackfruit producer, with 1.4 million tons produced, followed by Bangladesh, which claims jackfruit to be its national fruit, with 926 tons produced. Thailand and Indonesia are two other top jackfruit producers, with 392 and 340 metric tons, respectively (Figure 1) [8]. The jackfruit prices appear to have converged (below USD 1.00 per kg), except in areas of the world that are difficult to access, such as Australia (USD 2.91) and North America (USD 1.86) [9].
Jackfruit was listed under the National Key Economic Areas (NKEAs) as one of the economic-driven fruit crops of Malaysia, where its cultivation has been upgraded to a large scale [10]. The production value per metric ton was RM 1.25 in 2013, which increased considerably to RM 1.60, RM 1.81, and RM 1.92 in the following consecutive years. In 2017 and 2018, the production value showed zero increments and remained static at RM 2.09. The harvested area decreased at that time from 3107 to 2979 Ha. It was then that outbreaks of jackfruit-bronzing were first reported in the country. Nearly 10,000 ha of jackfruit plantations were affected by the disease symptoms, with a 50–80% disease incidence. The production value of jackfruit then decreased to RM 1.95 and RM 1.88 in 2019 and 2020, respectively [11,12]. While this was happening, jackfruit production in the Philippines declined, falling from 47.09 metric tons in 2012 to 40.2 metric tons in 2020 [13].
Previously, as far as we knew, jackfruit had few disease problems; those we knew of were caused by bacterial and fungal infections and some nematode species. P. stewartii subsp. stewartii and Dickeya fangzhongdai are two prevalent bacterial pathogens that cause jackfruit-bronzing and fruit rot diseases [14]. However, most reported cases of issues with jackfruit in the past were fungal-causing diseases such as leaf spots, dieback, fruit rot, and pink disease caused by Colletrotichum gloeosporioides, Phytophthora palmivora, and Rhizopus sp. The diseases are commonly spread in orchards with poor air circulation or during wet seasons with high relative humidity and temperatures [15,16]. In India and China, the most common species infecting and parasitizing jackfruit trees were Tylenchorhynchus mashhoodi and root-knot nematodes Meloidogyne enterolobii [17,18,19]. These plant pathogens pose a significant threat to the plant productivity, yields, and long-term viability of plantations. Uncontrolled epidemic diseases resulting from such pathogens in the future might restrict the agriculture growth sector at domestic and international levels.
In Malaysia, jackfruit-bronzing was first reported in the plantation areas of Selangor and Pahang [20]. Indicated by yellowish to reddish discoloration on the affected fruit pulp and rags, the disease urgently threatens jackfruit industries. It has reduced the quality of fresh jackfruit and further afflicts jackfruit marketing economically [21,22]. Recently, a persistent onslaught of jackfruit-bronzing has significantly constrained jackfruit production, resulting in a massive loss of yield and further distracting the jackfruit growth sector.
A public review on jackfruit-bronzing was published by [23], focusing on the diagnostic approaches for P. stewartii subsp. stewartii in Malaysia, particularly its pathogenicity and genetic diversity, highlights polymerase chain reaction (PCR) amplification assay and multilocus sequencing analysis (MLSA). Despite little information on the commercialization value of jackfruit, limited information exists on the bacterial pathogen’s virulence factors and genome sequence. There is merely one complete genome sequence of P. stewartii subsp. stewartii strain DC283 (GenBank Accession No: CP017581) is available in public databases.
This review provides an overview of recent research and advances in biology, diagnostics, pathogenomics, and potential disease management strategies of P. stewartii subsp. stewartii’s infection to improve the quality of local jackfruits. It is crucial to ensure the high quality and quantity of local jackfruit supplies to meet the increasing demand of domestic and international market needs.

2. Significance of Jackfruit-Bronzing Disease

Jackfruit-bronzing disease was first reported in the Philippines when the internal parts of the jackfruit changed to yellowish-orange and reddish discoloration. As a result, the quality of jackfruit dropped and disrupted the farmers-consumers supply chain. A research group [21] discovered a bacterium known as P. stewartii subsp. stewartii act as the disease’s causal agent. Interestingly, this bacterium was the same pathogen causing Stewart’s wilt on corn plants and localized lesions symptoms in pineapple (Figure 2).
This disease was reported in Malaysia three years later, where the bronzing symptoms appeared in the jackfruit plantations of Pahang state. This discovery ultimately answered the mystery of the rotting, rust, and rot-like symptoms previously discovered in plantation areas of Pahang and Negeri Sembilan state in 2010 [25]. The identified pathogen retained similar morphological and biochemical characteristics described by the Philippines research group. Species-specific PCR amplification confirmed P. stewartii subsp. stewartii as the causal agent of jackfruit-bronzing disease in Malaysia [20,26,27]. The disease later spread across North America when the fruit bronzing symptoms were observed in Nayarit jackfruit orchards, Mexico. The so-called ‘Mexican bacterial isolates’ matched the causal pathogen found earlier in the Philippines and Malaysia [22].
Typical fruit bronzing is a skin disorder of irregularly shaped patches marked by purplish or bronze-colored skin [28,29,30]. Unlike typical fruit bronzing, jackfruit-bronzing is associated with internal symptoms and can only be observed whenever the fruit is cut open. However, the plant pathologists indeed shared and highlighted the similar significant characteristics of these disease symptoms. Jackfruit-bronzing symptoms indicate rusty and yellowish-orange to reddish discoloration of the affected pulps and rags (Figure 3). The symptoms primarily exist in sweetened jackfruit variety and higher brix composition, specifically the Tekam Yellow (J33) variety [2]. Once infected, the color of the internal parts is deviated from their original and is no longer attractive with the presence of bronzing specks all over the jackfruits pulps and rags.

3. Pantoea stewartii Subspecies stewartii

3.1. History of Pantoea Species

The past five years’ studies showed P. stewartii, Pantoea ananatis, and Pantoea agglomerans appeared as the top three’s worldwide phytopathogenic Pantoea spp. inflicting damage and harming economically important crops and ornamental and flowering plant species. P. stewartii has been identified as the causal agent of leaf blotch on Sudan grass and Stewart’s wilt on Dracaena sanderiana in California and South Korea [31,32]. Recent publications associated P. stewartii with bacterial leaf blight (BLB) of rice in Thailand and the West African countries of Benin and Togo [33,34,35].
Two subspecies were proposed under P. stewartii when [36] managed to differentiate P. stewartii subsp. stewartiii from P. stewartii subsp. indologenes. In opposite to P. stewartii subsp. indologenes, P. stewartii subsp. stewartii cannot produce indole, utilize citrate, grow on cis-aconitate, and form acid from carbohydrates. P. stewartii subsp. stewartii recognizes maize (Zea mays), sweet corn (Zea mays subsp. mays), teosinte (Zea mays subsp. Mexicana and Zea mays subsp. parviglumis) as its main hosts [37]. Instead, the bacterium is known for causing Stewart’s wilt or Stewart’s bacterial wilt of maize and sweet corn, an economically significant disease affecting corn industries in Canada and the USA in the late 1980s [38,39]. A decade after, Stewart’s wilt disease was detected in Argentina [40] and Bogor district in Indonesia [41].
Another subspecies, P. stewartii subsp. indologenes is a known pathogen of rot on pineapple (Ananas comosus), rot and leaf spot on foxtail millet (Setaria italica), as well as pearl millet (Pennisetum americanum). In addition, it is virulent against various plant hosts. For example, it is known as a new causative agent of rice (Oryza sativa) BLB disease [42,43], center rot of onion (Allium cepa) [44], and leaf blight wilt on a flowering plant species of Asparagaceae, the D. sanderiana [45]. Figure 4 illustrates the host plants and diseases caused by P. stewartii and its two subspecies; P. stewartii subsp. indologenes and P. stewartii subsp. stewartii.

3.2. Biology

P. stewartii subsp. stewartii is a Gram-negative, facultatively anaerobic, non-flagellate, and rod-shaped bacterium. It taxonomically falls under Gamma-proteobacteria, order Enterobacteriales, family Erwiniaceae, genus Pantoea, and species P. stewartii. The colonies are creamy or pale yellow to lemon or orange-yellow, morphologically flat to convex, round with a 1–4 mm diameter, and translucent with a smooth margin on the King’s B (KB) medium (Figure 5).
P. stewartii subsp. stewartii originated in the USA and is widely disseminated to Africa, North, Central and South America, Asia, and Europe [46]. A recent pest survey card by [47] reinforced P. stewartii subsp. stewartii as a Union Quarantine Pest and urged specific measures to prevent the introduction of this bacterium. At present, the corn flea beetle (Chaetocnema pulicaria) acts as the primary vector for the pathogen. At the same time, the European Union considered maize seeds the main pathway for introducing and spreading Stewart’s wilt disease.
The life cycle of P. stewartii subsp. stewartii associated with jackfruit-bronzing is yet to be discovered, and there is little information available on the etiology of this disease. However, jackfruit seeds may be a potential vector of the disease, seeing the propagation by direct seeding is still being practiced worldwide, apart from grafting and cuttings techniques [48]. Shoot borers, bark borers, mealy bugs, and scale insects are the prevalent insect pests linked to most jackfruit diseases [49]. A current review by [50] reported that trunk borer, shoot, and fruit borer as major common insect pests attacking jackfruit. In contrast, bud weevil, spittle bugs, bark-eating caterpillars, and aphids are considered minor insect pests of jackfruit.

4. Diagnostics of Pantoea stewartii Subspecies stewartii from Diseased Jackfruit with Bronzing Symptoms

Identification of the P. stewartii subsp. stewartii can be conducted in two different methods; (i) phenotypic methods such as morphology, pathogenicity, or behavior, and (ii) molecular methods [51].

4.1. Phenotypic Characterization

Phenotypic characterization is a popular method due to low-price reagents and affordable equipment. This method allows the identification of the bacterial species from the genus up to the species level through the colony and cell morphology, Gram reaction, and metabolic and growth characteristics. Initially, a pure culture should be grown on media with various salt concentrations to identify the jackfruit-bronzing bacterium. Media such as 523, yeast dextrose carbonate, PA 20 [31,52,53], casamino acids peptone glucose [54], Luria-Bertani [22,55], and Pantoea genus-specific agar [56] are examples of media that serve for the purpose. Meanwhile, the King’s B supplemented with nutrient-broth yeast extract agar or yeast peptone glucose agar has been applied as the selective media for the growth of P. stewartii subsp. stewartii at 25 to 28 °C [57].
Following the colony mentioned above and morphological identification, Gram-staining was performed to differentiate the Pantoea species under a compound light microscope with oil immersion lenses for a 100x magnification. Biochemical tests were carried out to determine the biochemical properties of the bacterium. Table 1 represents selected tests and outcomes for identifying the jackfruit-bronzing bacterium. Biochemical tests show that bacteria use carbon sources to obtain energy and sustain life. Therefore, the test outcomes on which carbon sources react allow for a probabilistic assessment [58].
Hypersensitivity reaction (HR) is a quick and useful determinative test to discriminate plant pathogens from saprophytes by their capabilities to produce an HR in the leaf mesophyll tissue [60]. Essentially, a pathogenicity test should be carried out to confirm the infection by P. stewartii [59]. The test can be performed on healthy detached or attached jackfruit or jackfruit pulps [21,26,27]. The 108 CFU/mL bacterial inoculum is injected into the sterile and dried pulps and incubated in a controlled sterile chamber. Observation and examination for bronzing symptoms development are monitored daily for 2-weeks post-inoculation. The bacterial pathogen is reisolated and verified to identify the morphology, biochemical, and microscopic properties to confirm Koch’s postulates. Although similar type symptoms were perceived in artificially inoculated jackfruits, the bronzing symptoms are relatively brighter than the naturally infected ones. It is most likely due to the different periods, considering the artificially inoculated fruits are cut open when it is still at an early stage. Disease incubation is longer in naturally infected jackfruits since the infection occurs earlier and longer than 2-weeks [21]. Therefore, different jackfruit varieties could be used to discover the most resistant and sensitive varieties to bronzing disease. The most recent publication investigated the pathogenic variability of P. stewartii subsp. stewartii infection against three different jackfruit varieties in Malaysia; Tekam Yellow (J33), Hong (J34), and Subang Chap Boy (J39) [24].

4.2. Molecular Characterization

The molecular methods are one of the primary identification tests for P. stewartii subsp. stewartii [59]. Besides serological tests and fatty acid profiling assay, the molecular approaches are applicable for phylogenetic and diversity analyses of prokaryotic taxa. The methods utilized two alternatives, either (i) hybridization of DNA–DNA homology to determine the relatedness of two microorganisms or (ii) sequencing of 16S ribosomal RNA (rRNA) to identify the bacterial species [58,61]. In addition, molecular methods can be further directed into PCR and barcoding.

4.2.1. Polymerase Chain Reaction

So far, rapid and sensitive PCR amplification targeting a single gene is generally used against P. stewartii subsp. stewartii-specific primers. The most-targeted gene regions for this bacterium are cps and hrp, responsible for pathogenicity and virulence. The cps gene cluster comprises 12 genes (cpsA to cpsM) that encode proteins to synthesize capsular polysaccharide (CPS) stewartan built up from seven monosaccharides repeating unit counting glucose, galactose, and glucuronic acid. On the other hand, the hrp gene encodes proteins for a type-III secretion system (T3SS) required for water-soaked lesions and general pathogenicity [54].
The most commonly used primers are (fD1; rD1) [62], (ES16; ESIG2c), (cpsL1; cpsR2), and (hrp1d; hrp3c) [54] that target 16S rRNA and 16S-23S rRNA/internal transcribed spacer (ITS) partial gene sequences, cpsD and hrpS, correspondingly (Table 2). The cpsD and hrpS genes are chosen as targets as they appear unique to P. stewartii subsp. stewartii. DNA samples of infected jackfruit parts and ooze [21] can be used as templates, and the PCR program is set according to the manual procedure described by Coplin et al. [54]. After separation on an electrophoresed agarose gel (1%), amplification is observed at respective ~1.5 kb, ~0.92 kb, ~1.1 kb, and ~0.9 kb size amplicons. BLASTn and phylogenetic analyses will be conducted to see their similarities with P. stewartii subsp. stewartii reference strains in the GenBank databases.

4.2.2. Barcoding

Apart from PCR, barcoding is another molecular method to identify P. stewartii subsp. stewartii. EPPO recommended MLSA for a higher resolution of phylogenetic relationships of species within a genus or family [59]. It is an up-to-date method in prokaryotic taxonomy utilizing housekeeping genes or partial sequences of gyrB (encodes DNA gyrase subunit B), rpoB (encodes RNA polymerase beta subunit), atpD (encodes ATP synthase F1, β-subunit), and infB (encodes translation initiation factor IF-2) genes to build phylogenetic trees and deduce phylogenies [61]. A minimum of four genes are required in MLSA since a single gene would introduce bias and not reflect the general phylogenetic relationships other than the evolution of that single gene. Furthermore, MLSA deals precisely with internal fragments of four protein-coding genes at once (concatenated), reflecting the genuine phylogenetic relationship of bacterial taxa [63].
A recent report on the genetic diversity of P. stewartii subsp. stewartii isolated from jackfruit-bronzing samples was published by Abidin et al. [26], following the protocol described by Brady et al. [64]. Results were interpreted in two phylogenetic trees based on (i) single and (ii) concatenated gyrB, rpoB, atpD, and infB genes. Although phylogenetic trees based on a single gene scored maximum similarities (99% to 100%) between subspecies stewartii and indologenes, the concatenated genes-based phylogenetic tree is capable of pointing out the closer relation with P. stewartii subsp. stewartii, although the P. stewartii subsp. indologenes were in the same cluster. In a simple explanation, the P. stewartii subsp. stewartii strains from diseased jackfruits were polyphyletic in the 16S rRNA gene tree, thus forming a distinct monophyletic cluster in the MLSA analysis [65].
Essentially, the genus Pantoea is linked to the MLSA scheme to clarify the problematic taxonomic situation within the family Enterobacteriaceae due to some indistinguishable paraphyletic genera from 16S rRNA gene phylogeny. As a result, the former genera were amended, and different species were reclassified into new genera. All Pantoea strains were involved in the massive analysis by referring to the DNA groups II, IV, and V [66]. A huge amendment was made to the genus Pantoea, by which new species were included and former species were reclassified. Pantoea citrea, Pantoea punctata, and Pantoea terrea were transferred to the genus Tatumella [67]. The scheme also brought in the Pectobacterium cypripedii to the genus Pantoea as Pantoea cypripedii [68].

5. Pathogenomics and Pathogenicity of Pantoea stewartii subspecies stewartii

For this review, two available reports of (i) the complete genome sequence of P. stewartii subsp. stewartii DC283 (NCBI Ref. No: CP017581.1) [55] and (ii) draft genome sequence of P. stewartii subsp. stewartii SQT1 (NCBI Ref. No: PRJEB36196) [69] were compared and further discussed (Table 3). The P. stewartii subsp. stewartii DC283 was isolated from the corn plant of the USA, which is associated with Stewarts’ wilt disease. The genome size is 5,314,092 bp with 53.8% GC content, 5625 coding sequences (CDSs), and 100 RNAs. Meanwhile, P. stewartii subsp. stewartii strain SQT1 was isolated from Malaysian jackfruit suffering from a bronzing disease. The draft genome sequence is relatively shorter (4,783,993 bp long) with 67 contigs and contains less G+C content (53.7%), CDSs (4609), and RNAs (71). Rapid annotation using subsystem technology (RAST) has identified that 52% of genes fall into 27 active variants of subsystems. This review expanded the subsystem categories to the secondary metabolism to discover specific genes or gene clusters of pathogenicity and virulence of the jackfruit-bronzing pathogen.
Based on pathogenicity and virulence of the P. stewartii subsp. stewartii DC283 strain, the T3SS of ‘membrane transport’ and exopolysaccharides (EPS) of ‘cell wall and capsule’ categories are the key pathogenicity factors contributing to Stewart’s wilt disease developing symptoms [70], with an essential type-III effector protein from the AvrE family, WtsE. Other virulence factors, such as quorum sensing, biofilms, endoglucanase, cell-wall-degrading enzymes, and transcription factors, are necessary for successful colonization and infection of host tissue [71,72,73]. The T3SS is associated with the water-soaked formation during the wilt phase, while EPS is produced during the leaf blight phase and causes wilt seedlings, dry and necrotic leave lesions, and stunting and pitch rot mature corn plants [74,75]. The structure of EPS stewartan from the corn pathogen bacterium was published in 1990-ties [76,77], with high-molecular-weight (~1.4 MDa) heteropolysaccharide and over 1000 repeating units [78]. Furthermore, a fragile yet robust flagellar was one of the imperative characteristics of a bacterium that mediates its surface-based motility, which is essential for community development [70,79]. In comparison, ATP-binding cassette (ABC) transporter, type-VI secretion system (T6SS), and EPS are the main pathogenicity tools used by the P. stewartii subsp. stewartii SQT1 to deliver virulence factor into the host cells.

5.1. Membrane Transport: ATP-Binding Cassette Transporters and Type-VI Secretion System

Secretion of proteins across phospholipid membranes is one of the essential component strategies for many bacterial pathogens to invade susceptible hosts and promote virulence. They primarily draw attachment to eukaryotic cells, scavenge resources in an environmental niche, intoxicate target cells and disrupt their functions. The largest and most diversified superfamily, ABC transporters, play a pivotal role in bacterial pathogenicity and cell survival for the P. stewartii subsp. stewartii SQT1. The ABC transport system comprises three proteins transporting substrates across cellular membranes using ATP binding and hydrolysis [80,81,82]. Two main transporter subgroups (importer and exporters) mediate the uptake of nutrients into the cell and extrude toxins and drugs. The third subgroup involves diverse cell functions [83]. Rather than saprophytes or animal pathogens, ABC transporter homologs are abundant in phytobacterial pathogens, strengthening their importance for pathogenesis.
The soft rot Pectobacteriaceae and Agrobacterium tumefaciens encode approximately 80 and 160 ABC transporters per genome [84], while the P. stewartii subsp. stewartii SQT1 encodes an average of 46 ABC transporters. The genera Pectobacterium and Pantoea are members of the order Enterobacterales, which is well-known for producing agriculturally harmful phytopathogens (Figure 6). Dipeptide permease (Dpp) is the major peptide transporter detected, followed by oligopeptide permease (Opp). Branched-chain amino acid (Liv) and alkyl phosphonate (phn) are the least peptide transporters in the genome. The peptide transport systems are commonly used to import peptides for nutrient sources and get cellular function signals [81]. The detection of dipeptide permease (DppABCDF) and oligopeptide permease (OppABCF) systems is comparable with two hetero-oligomeric oligopeptide transporters found in Escherichia coli [85], yet E. coli uses Opp as the core peptide transport system.
The mechanisms driving these events are never adequately elucidated, and information on the regulatory network of bacterial peptide transporters involved in pathogenesis is limited. Figure 7 shows the key inducer for peptide transporter expression and the principal bacterial virulence-associated with peptide transporters [81,82,86,87].
T6SS is another central protein secretion system in the ‘membrane transport’ category despite ABC transporters. T6SS is a complex structure composed of 13 to 15 proteins conserved in all T6SS clusters across species of Gram-negative bacteria [88,89,90,91]. T6SS is critical in delivering toxins into eukaryotic and prokaryotic cells, either host or competitors [89,90,91], and is always referred to as nanomachine. Horizontal gene transfer is the leading way of T6SS traits acquisition and is not the standard duplication [92]. Many studies have reported the implication of T6SS in virulence by modifying the cytoskeleton of the eukaryotic host and in broad, violent, and purposeful inter-bacterial competition to prevent the growth of rival cells [93,94,95]. Bacterial pathogens mediate virulence into neighboring bacteria to compete for a specific host niche [96,97,98,99,100], particularly the space and resources [101]. These toxins are crucial for significant fitness during host colonization as they generate immunity proteins to avoid self-intoxication or being targeted by sister cells [95,101,102]. The secretion system is distributed intoT6SS-I, T6SS-II, and T6SS-III, which are directly involved in respective cell subversion/pathogenesis, virulence, and bacterial competition [103].
Based on subsystem feature counts on the RAST seed viewer, the P. stewartii subsp. stewartii SQT1 consists of 18 of 27 T6SS genes (Figure 8) and half encodes proteins with unknown functions. VgrG (valine-glycine-repeats G) appears to be this genome’s most plausible secreted protein. T6SS secreted the VgrG protein in Vibrio cholera and Hcp (hemolysin co-regulated protein) [104]. Hcp structurally creates hexameric rings with a central channel surrounding the VgrG tube. The VgrG punctures the outer cell membrane, allowing the Hcp tube to extrude and consequently breach the host cell membrane to transport the effectors/toxins into target cells. These proteins are notably essential components of the system and substrates of the T6SS [105].
Another significant gene, icmF (intracellular multiplication F), was identified in the T6SSs of P. stewartii subsp. stewartii SQT1. The icmF was previously reported on the inner membrane of Legionella pneumophila and located downstream of dotU (defect in organelle trafficking U) gene [89,106]. Many studies suggested that both icmF and dotU may work together and interact in assisting the assembly and stability of a functional dot–icm complex [107,108,109,110] and are even required for virulence [111,112]. These genes are the only T6SS components with transmembrane domains that render a membrane channel traversing the bacterial cell envelope [89,102]. The dotU was not observed in the draft genome sequence; however, two dotU homologs were found; impK (impaired in nodulation K) and vasF (virulence associate secretion F), each encoded by imp and vas clusters. The outer membrane (OM) ImpK protein-coding gene is among eight genes encoding proteins with unknown functions (ImpA, ImpB, ImpC, ImpD, ImpF, ImpH, ImpI, ImpJ), and three other genes encode for avirulence locus ImpE protein, ImpG protein, and phosphatase ImpM protein. The imp are homologous to vas and encode related proteins [113]. ImpG protein had homology with VasA, while uncharacterized proteins ImpH, ImpI, and ImpJ are homologous to VasB, VasC, and VasE. A vasD gene encoding type-VI secretion lipoprotein is also present, but not the vasH (sigma-54 dependent transcriptional regulator), vasI (type VI secretion protein) and vasL (type-VI secretion-related protein). The vas system is required for secreting proteins lacking an N-terminal signal peptide and has no effects on proteins with signal peptides such as chitinase and neuraminidase [89,104].
clpB (caseinolytic peptidase B) and pvc109 (pyoverdine chromophore 109) are other T6SSs spotted in the draft genome sequence. The Clp family belongs to the AAA+ superfamily of ATPases [114]. They form ring-shaped oligomers necessary for their ATPase activities and mode of action, particularly for macromolecular structural disruption [115,116]. A homolog of clpB, clpV is considered one of the core components of T6SS and acts as the T6SS motor [117,118]. Meanwhile, uncharacterized Pvc109 protein is similar to VCA109 and functions as a base plate assembly protein [119]. Significant gene cluster pppA encoding Ser/Thr phosphatases was also detected. The pppA is located next to the clpB on the contig 6, but ppKA encoding Ser/Thr kinases was not found. Both pppA and ppkA were encoded in the first cluster, HIS-I (Hcp1 secretion island I) of P. aeruginosa. Yet in a second cluster (HIS-II), stk and stp genes were discovered to have similar encoding functions as ppkA and pppA. The PpkA and PppA work antagonistically in regulating Hcp1 secretion [120].
The T6SS complex also revealed the presence of fha encoding a protein with an FHA (forkhead-associated) domain, which is known to have an affinity for phosphothreonine [121,122]. Several studies have found a link between fha1 and HCP1 secretion and its phosphorylation is associated with PpkA and PppA. The Fha phosphorylation may initiate a signal transduction cascade that leads to T6SS assembly and function [120]. However, not every T6SS gene cluster possesses the PpkA/PppA/Fha1 complex at the post-translational level, with some having only part of it and others having none.
E. amylovora and P. ananatis are the close relative of the P. stewartii subsp. stewartii to illustrate the macromolecular machines of T6SS [88] in virulence mechanism and interbacterial competition [91]. During disease interactions of E. amylovora with its plant host, T6SSs have altered metabolic and motility processes, and most importantly, they impacted the disease’s progression [123]. While in P. ananatis, a compromised virulence phenotype was observed due to the incapability of the T6SS mutant to cause disease in onion (A. cepa) plants [124].
Following ABC transporter and T6SS are the type-II, -IV, and -V secretion systems. The T2SSs and T5SSs secrete proteins in two steps: (i) Sec/Tat secretion pathways and (ii) second secretion pathway. Meanwhile, T4SS is a Sec/Tat-independent and transport substrate across both bacterial membranes in a single step, resembling the T6SS [125].

5.2. Cell Wall and Capsule: Capsular- and Exopolysaccharides

CPS and EPS gene clusters suggest the active production of EPS stewartan from P. stewartii subsp. stewartii SQT1. Gram-negative bacteria are naturally covered in a surface-bound polysaccharide layer or capsule for protection against recognition by plant defense mechanisms, bind water to moisten the bacteria, and retain nutrients and ions released from damaged plant cells. These circumstances create a favorable environment for bacterial multiplication, aids the bacterial dissemination through plant tissues, and develop the characteristic symptoms of infection [126]. The CPS is released and free from the cell surface molecules as free EPS in certain circumstances, thus explaining the slime-forming or mucoid trait of many bacterial species (Figure 9) [127,128]. EPS is the primary pathogenicity factor for P. stewartii subsp. stewartii [70,129] and plays a vital role in bacterial survival and persistence, particularly in cell aggregation, cell adhesion, biofilm formation, and protection from hostile environments [128,129,130,131]. These acidic complex EPSs mask pathogens’ recognition through plant defense reactions and promote bacterial growth and movement in planta [132].
EPS biosynthesis is similar to the Wzy-dependent pathway of O-antigens and groups 1 and 4 of CPS [133,134]. None of the O-antigen flippase, Wzx (related to MurJ of peptidoglycan assembly), or oligosaccharide repeat unit polymerase (Wzy) existed in the P. stewartii subsp. stewartii SQT1 genome exports the LPS across the plasma membrane to the periplasmic space. Interestingly, the detection of OM lipoprotein carrier protein (LolA), OM protein (YaeT), and four lipoproteins (YfgL, YfiO, NlpB and SmpA) suggested the involvement of the Lol system in transporting LPS to the OM (Figure S1) [135,136].
A set of polysaccharides export lipoprotein (Wza), low molecular weight protein-tyrosine-phosphatase (Wzb), and tyrosine-protein kinase (Wzc) were later discovered. The Wza and Wzb typically span the periplasmic space and promote the export of EPS polymer. The Wzb alone helps support the oligomerization of dephosphorylated Wzc with its phosphatase activity [137,138,139]. The remaining two proteins found in P. stewartii subsp. stewartii SQT1 was a putative CPS transport protein (YegH) and a putative uncharacterized protein (YmcB).
CPS and O-antigen are critical components of cell walls and have been recognized as significant pathogenic factors in pathogenic bacteria [140]. CPS is best known for pathogenesis, yet it is intricate in promoting bacteria adherence to host organisms, facilitating biofilm formation, and conferring resistance to host innate immunity [141]. The O-antigen is the outer surface of lipopolysaccharide (LPS) and is built up together with lipid A (endotoxin) and core oligosaccharide (shown in Figure 9). There is abundant literature defining the association of the O-antigen with bacterial virulence in humans, animals, and plants [142,143,144,145,146].

6. Potential Mitigation Strategies for Jackfruit-Bronzing Disease

The peak incidences of jackfruit-bronzing were reported after or during the rainy season when the humidity ratio is relatively high. Healthy jackfruit trees are more tolerant to this disease, while stressed trees, mostly of nutrition imbalances, soil types, terrain conditions, and injury, are more vulnerable [25]. Therefore, adequate fertilization levels should be well maintained, concerning calcium and potassium, but not nitrogen and phosphorus. Excess soil moisture should be avoided to prevent the susceptibility of jackfruit trees to bronzing disease [147]. Cultural practices and chemical control are powerful mitigation strategies that could be integrated into managing the jackfruit-bronzing disease (Figure 10).

6.1. Cultural Practices

6.1.1. Monitoring and Sanitation

Jackfruit-bronzing attacks the fruit’s internal part, and the visual symptom can only be seen when the fruit is cut open. Continuous monitoring of the incidence could be practiced in commercial growing areas by checking on the male inflorescence and internal fruit symptoms by inspecting the peduncle [25]. Direct monitoring, such as eradicating the infected trees, is necessary and should be at the forefront of management control. It is recommended that jackfruits be inspected at regular intervals of two weeks from each tree in the jackfruit plantation. Considering environment factors, clone types, tree age, and entry point of the pathogen, one month or longer monitoring intervals may practically apply. In certain areas where bacterial diseases are already present, immediate control should be taken in limiting any access into and out of the infected plantation, whether humans, animals, or any tools and equipment [148]. Destroying diseased fruits, disinfecting and sanitizing the suspected trees and their surroundings, pruning the low branches, and restricting the number of fruits are such practices that should be implemented. All actions must be done cautiously to avoid any wounds or injuries, particularly to the developing jackfruits.
Additionally, a shallow waterway could be built around the infected tree to drain superficial liquid or water-containing bacterial inoculum to limit bacterial dispersal. If the bacterial is spread to the secondary host trees, the male inflorescence’s de-budding process should be performed in an instance. Finally, infected wrapping bags should be disinfected and removed from the plantation areas. While in disease-free areas, it is a must to avoid the entry of the causal pathogen by practicing reasonable sanitation procedures and using clean and sanitized planting tools and materials [149].

6.1.2. Disease-Free Seeds

The disease may potentially be transmitted by infected plant material and infected seeds. A disease-free seed from a certified source is the best choice to prevent the spread of the bronzing disease. The certified seed is generally handled under procedures acceptable to the Department of Agriculture (DOA) and Forestry to maintain good genetic purity and identity [150]. The disease-free seed needs to be produced in areas where the disease is absent not to introduce the disease. If the seed is infected following the visual inspections for symptoms, an ELISA-based seed health test could be performed for confirmation. At the same time, regular inspections should be carried out on seed parent plants and the jackfruit growing field [151].

6.1.3. Resistant Varieties

Besides the disease-free seeds, jackfruit-resistant varieties are another imperative prevention strategy that commercial jackfruit growers may apply. In North America, planting resistant varieties (C123) has effectively controlled Stewart’s wilt disease, which is caused by the same causal pathogen [152]. The disease resistance gene is inherited and shown in four inbred lines of dent corn by quantitative and qualitative analyses [153]. In Malaysia, there are a total of 15 jackfruit varieties; J2, J27, J28, J29, J30, J31 (NS1), J32 (Mantin), J33 (Tekam Yellow), J34 (Hong), J35 (Crystal Jackfruit 1), J36 (Crystal Jackfruit 6), J37 (Mastura), J38 (Subang Lao Zhang), J39 (Subang Chap Boy) and J40 (CJ3) registered for the national crop list [154]. A recent publication has reported the jackfruit variety J39 was the most resistant to the bronzing disease. Meanwhile, variety J34 was most susceptible to the disease [24] with sweet pulps and nearly 15% brix composition. Choosing the jackfruits with much less flavor variety and a low brix may help thwart the incidence of jackfruit-bronzing disease composition [2,21,23].

6.1.4. Biological Control

The biological control method is one of the sound and effective means to control the growth of P. stewartii subsp. stewartii. No biological agents are available to inhibit or mitigate bacterial infection [151]. Forty years back, there was an effort to isolate a bacteriophage of P. stewartii subsp. stewartii from C. pulicaria and characterize it according to the host range. However, it has not been developed adequately enough to be used [155]. Only eight of the 13 pathogen strains were tested, partially completed phage characterization. It was hypothesized that virulent bacteriophages might efficiently eliminate P. stewartii subsp. stewartii inside its beetle vector under field settings, but no further assertions or additional discussion was uncovered from the research effort.

6.1.5. Intercropping

Intercropping may be enforced to combat the risk of jackfruit-bronzing and weeds and insects [156,157]. Comparatively, intercrops are more effective in utilizing light, water, and nutrients, making a lesser amount available to weeds. In addition, intercrops reduce the number of susceptible hosts by acting as a physical barrier to the susceptible or host plants [158,159]. In this way, the diversity of pests and diseases is enlarged, thus plummeting the speed of pest adaption. Jackfruit and eggplant perhaps could be grown for the intercropping system [160] or jackfruit and pineapple [161], or jackfruit, pineapple, and aroid plant [162]. People in Bangladesh are used to the agroforestry cropping system, whereby more than one crop is planted in proximity for productivity, yield stability, and profit. The concept of multispecies systems has been practiced for decades [163]. The systems may include annual and perennial crops on a gradient of complexity from 2 species to more. Intercropping offers benefits such as upgraded soil health, decreased non-point source pollution by lowering nitrogen losses, excellent overall production, enhanced pest and disease control, enhanced ecological services, increased economic profitability, and improved ecological services.
The systems provide benefits such as increased overall productivity, better pest and disease control, improved ecological services, increased economic profitability, improved soil health, and reduce non-point source pollution by reducing nitrogen losses [164].

6.2. Chemical Control

6.2.1. Bactericides

Chemical control using copper-based bactericides is one of the imperative mitigation strategies for the jackfruit-bronzing disease proposed by the DOA of Malaysia [25]. Copper is essential for normal plant development and growth [165,166]. However, it is harmful to cells at high doses as it could disrupt the enzyme active sites, interfere with the energy transport system, and compromise the integrity of cell membranes [167]. The copper sprays must be applied evenly to the jackfruit surface before the disease infections. The copper starts functioning by water on the jackfruit’s surface, forming exudates that weaken the acids and lower the pH. The solubility increases the dissolving and releasing of copper ions. When it comes into contact with bacteria, the ions make entry into the cell walls and disrupt the cellular enzyme activity. This bactericide spray is more effective yet less toxic by applying it frequently at low rates rather than infrequent applications at high rates. The fruit temperatures are low, humidity is low, and the fruit is not wet [168]. A relative of P. stewartii subsp. stewartii, P ananatis has shown sensitivity towards copper compounds and was relatively effective with copper bactericides to control the center rot disease of onion (A. cepa) [169,170]. In particular, the copper prophylactic sprays have shown excellent efficacy in preventing plant diseases caused by Xanthomonas spp., such as canker and bacterial spot of citrus [171], the bacterial blight of walnut (Juglans) [172], leaf blight of onion (A. cepa) [173], the bacterial spot in pepper (Capsicum) and bell pepper (Capsicum annuum Group) [174,175], bacterial spot and bacterial speck of tomato (Solanum lycopersicum L.) [176] and many more. In Nepal, the copper prophylactic spray has been effective against greening and canker of citrus, black rot of crucifers (Brassicaceae), and bacterial leaf spot of pumpkin (Cucurbita moschata)diseases [177]. On the other hand, long-term usage of copper may result in copper-resistant bacterial strains, making disease management more difficult. Once the targeted plant pathogen acquires resistance genes, the frequency of resistant strains in the pathogen population rapidly increases, and subsequent applications become less effective in disease management [178].

6.2.2. Insecticide and Antibiotic Treatment

Both insecticide and antibiotic treatments have been applied to control P. stewartii subsp. stewartii on corn crop mainly in the US and some parts of Indonesia. Clothianidin, imidacloprid, and thiamethoxam are systemic insecticides reported to lower systemic infection by up to 85% [179,180,181,182]. Unlike insecticides used in-furrow at planting or applied as foliar treatments, antibiotics have only been studied in vitro. Antibiotic treatment can be applied to the short-lived jackfruit seeds for 30 days. To defend jackfruits from infection before the bacterium is transmitted [183,184,185]. Xinzhimeisu (the mixture of Streptomycin and Terramycin), Wuyijunsu (Streptomyces ahygroscopicus var. wuyiensis) and Zhongshengjunsu (antibiotic 120) are several antibiotics that used to treat the corn seeds from P. stewartii subsp. stewartii infection [186]. Antibiotics-seeds soaking technique at the optimum temperature of 40 °C to 47 °C for 90 min can destroy the bacterium pathogen and stimulate the seed germination [187].

7. Conclusions and Future Prospects

Jackfruit-bronzing disease is a recent trending threat to the jackfruit industries in Southeast Asia. Uncontrolled spread may weaken the enthusiasm of jackfruit growers and diminish the jackfruit plantation areas. In Malaysia, the DOA has reported that the planted areas of jackfruit cultivation significantly reduced from 6245 to 4900 Ha from 2015 to 2018, reducing the harvested area from 3220 to 2980 Ha. In 2020, the plantation areas were reduced to 4675 Ha and maintained the same hectares in 2021. In line with the increasing population, sustainable jackfruit production needs to be secured to meet domestic and foreign demands. Moreover, further research is required to understand the pathogen’s nature and pathogenicity better.
Single-plex PCR targeting a single gene is the primary technique to identify P. stewartii subsp. stewartii from symptomatic jackfruit either by using the universal 16S rRNA and 16S rRNA ITS primers or housekeeping genes (e.g., gyrB, atpD, infB, and rpoB) that are conserved in the genus and unique to each lineage, or subspecies-specific primers (e.g., hrp and cps) in narrowing down to the subspecies level. The amplified band sizes are expected at 0.9 kb to 1.5 kb on the electrophoresed gel. The diagnostic procedure proceeds with DNA sequencing and gene sequence analysis (BLASTn) before depositing into the GenBank. To gain information on the P. stewartii subsp. stewartii’s evolutionary relationships, phylogenetic analysis is performed to analyze the genetic differences. More recently, multiplex PCR, loop-mediated isothermal amplification (LAMP), and quantitative PCR have been applied for multi-detection and the random detection of target sequences for large-scale studies to balance the needs, cost, and handling time.
Insights into the pathogen genome have shown that CPS and EPS as P. stewartii subsp. stewartii’s core pathogenicity factors in disease infection. Besides, the Dpp and Opp have been discovered as the significant peptide of ABC transporters in virulence. Hence, there is a possibility that these two may not be the primary peptide transporters for the pathogen, the TPP, or any other mode of transportation that requires more evidence from in-depth experimental trials. The genomes of wild-type and mutant strains of P. stewartii subsp. stewartii SQT1 must also be investigated in host plants, as the precise T6SS effectors are currently unknown. This genomic information is vital to determine the sources and patterns of transmission during specific disease outbreaks and to revolutionize infectious disease epidemiology research. At the same time, it helps to understand the correlation between taxonomy and mechanisms of virulence imposed by this pathogen and scrutinize new environmentally-friendly control strategies further to combat the jackfruit-bronzing disease globally.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae8080702/s1, Figure S1: Lipoprotein transport through the bacterial cell envelope. Following transport through the Sec system, the OM protein (YaeT) and four lipoproteins (YfgL, YfiO, NlpB, and SmpA) form a complex essential for OM protein biogenesis [136].

Author Contributions

R.I.: conceptualization, original draft preparation, and editing. S.I.I., M.Y.I.-S. and D.Z.: manuscript reviewing. S.I.I. and M.Y.I.-S.: supervision. D.Z.: project administration and supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Ministry of Higher Education of Malaysia (MOHE) through Fundamental Research Grant Scheme (FRGS/1/2018/WAB01/UPM/02/9) and GP-IPS/2018/ 9638500.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

Authors are thankful to the staffs of the Department of Plant Protection UPM, for their technical support and the officers of the Department of Agriculture (DOA) Malaysia, for their assistance in sampling processes.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Anvar Hussain, N.A.; Hoque, M.; Agarwal, S.; Syed, I.; Raihan, M. Jackfruit (Artocarpus heterophyllus). In Antioxidants in Fruits: Properties and Health Benefits; Nayik, G.A., Amir, G., Eds.; Springer Nature Singapore Pte Ltd.: Singapore, 2020; pp. 461–477. ISBN 9789811572845. [Google Scholar]
  2. Ismail, N.; Kaur, B. Consumer preference for jackfruit varieties in Malaysia. J. Agribus. Mark. 2013, 6, 37–51. [Google Scholar]
  3. Hossain, A.K.M.A.; Haq, N. Practical manual 10. Jackfruit: Artocarpus heterophyllus (Field manual for extension and farmers); Southampton Centre for Underutilised Crops: Southampton, UK, 2006; ISBN 0854328343. [Google Scholar]
  4. Swami, S.B.; Thakor, N.J.; Haldankar, P.M.; Kalse, S.B. Jackfruit and its many functional components as related to human health: A review. Compr. Rev. Food Sci. Food Saf. 2012, 11, 565–576. [Google Scholar] [CrossRef]
  5. Balamaze, J.; Muyonga, J.H.; Byaruhanga, Y.B. Production and utilization of jackfruit (Artocarpus heterophyllus) In Uganda. African J. Food, Agric. Nutr. Dev. 2019, 19, 14289–14302. [Google Scholar] [CrossRef]
  6. CABI. Artocarpus heterophyllus (Jackfruit). Available online: https://www.cabi.org/isc/datasheet/1832#tosummaryOfInvasiveness (accessed on 8 September 2021).
  7. Ranasinghe, R.A.S.N.; Maduwanthi, S.D.T.; Marapana, R.A.U.J. Nutritional and health benefits of jackfruit (Artocarpus heterophyllus Lam.): A review. Int. J. Food Sci. 2019, 2019, 1–12. [Google Scholar] [CrossRef]
  8. Sawe, B.E. World Leaders in Jackfruit Production. Available online: https://www.worldatlas.com/articles/world-leaders-in-jackfruit-production.html (accessed on 22 January 2022).
  9. Norris, A.; Van Hag, L.; Su, C.; Attenborough, E.; Buckingham, E.; Perry, O.; Marcsik, D. Processing Jackfruit into Ready-to-Eat Products and Ingredients; AgriFutures Australia: Wagga Wagga, NSW, Australia, 2021. [Google Scholar]
  10. Menteri, J.P. Annual Report Performance Management and Delivery Unit (Pemandu). 2013. Available online: http://www.pemandu.gov.my/ (accessed on 12 April 2020).
  11. Department of Agriculture, Booklet Statistic Tanaman (Sub-Sektor Tanaman Makanan). 2021. Available online: www.doa.gov.my (accessed on 18 April 2022).
  12. MAFI Agrofood Statistics. 2019. Available online: https://www.mafi.gov.my/documents/20182/361765/Perangkaan+Agromakanan+2019.pdf/6546231e-053e-4afb-b38d-90bc01913dbd (accessed on 18 April 2022).
  13. Statista Research Department Production volume of jackfruit in the Philippines from 2011 to 2020. Available online: https://www.statista.com/statistics/590131/production-of-jackfruit-philippines/ (accessed on 19 April 2022).
  14. Jaffar, N.S.; Osman, M.S.; Koyube, M.N.K. New bacterial fruit rot disease of jackfruit caused by Dickeya fangzhongdai in Malaysia. Malays. J. Microbiol. 2019, 15, 214–219. [Google Scholar] [CrossRef]
  15. Borines, L.M.; Palermo, V.G.; Guadalquiver, G.A.; Dwyer, C.; Drenth, A.; Daniel, R.; Guest, D.I. Jackfruit decline caused by Phytophthora palmivora (Butler). Australas. Plant Pathol. 2014, 43, 123–129. [Google Scholar] [CrossRef]
  16. Shakywar, R.C. Diseases of jackfruit crops and their management. In Diseases of Fuits and Vegetable Crops; Apple Academic Press: Palm Bay, FL, USA, 2020; pp. 95–106. ISBN 9780429322181. [Google Scholar]
  17. Keshari, N.; Mallikarjun, G. Plant parasitic nematodes: A major constraint in fruit production. In Nematodes - Recent Advances, Management and New Perspectives; IntechOpen: London, UK, 2022; pp. 1–33. [Google Scholar]
  18. Long, H.B.; Sun, Y.F.; Bai, C.; Peng, D.L. First report of the root-knot nematode Meloidogyne enterolobii infecting jackfruit tree in China. Plant Dis. 2015, 99, 1868. [Google Scholar] [CrossRef]
  19. Pradhan, P.; Thakur, D.; Sahoo, N.K. Nematodes associate with big fruit trees and their community analysis survey of state Odisha, India. J. Entomol. Zool. Stud. 2020, 8, 1046–1048. [Google Scholar]
  20. Zulperi, D.; Manaf, N.; Ismail, S.I.; Karam, D.S.; Yusof, M.T. First report of Pantoea stewartii subspecies stewartii causing fruit bronzing of jackfruit (Artocarpus heterophyllus), a new emerging disease in Peninsular Malaysia. Plant Dis. 2017, 101, 831. [Google Scholar] [CrossRef]
  21. Gapasin, R.M.; Garcia, R.P.; Advincula, C.T.; De la Cruz, C.S.; Borines, L.M. Fruit bronzing: A new disease affecting jackfruit caused by (Smith) Mergaert Pantoea stewartii et al. Ann. Trop. Res. 2014, 36, 17–31. [Google Scholar] [CrossRef]
  22. Hernández-Morales, A.; Pérez-Casillas, J.M.; Soria-Guerra, R.E.; Velázquez-Fernández, J.B.; Arvizu-Gómez, J.L. First report of Pantoea stewartii subsp. stewartii causing jackfruit bronzing disease in Mexico. J. Plant Pathol. 2017, 99, 799–818. [Google Scholar] [CrossRef]
  23. Abidin, N.; Zulperi, D.; Ismail, S.I.; Yusof, M.T.; Ismail-suhaimy, N.W. Diagnostic approach and genetic diversity of jackfruit bronzing bacterium in Malaysia. Asian J. Plant Pathol. 2018, 12, 46–55. [Google Scholar] [CrossRef]
  24. Abidin, N.; Ismail, S.I.; Vadamalai, G.; Yusof, M.T.; Hakiman, M.; Karam, D.S.; Zulperi, D. Pathogenic variability of the jackfruit-bronzing bacterium Pantoea stewartii subspecies stewartii infection to jackfruit varieties and its pivotal plant hosts in Malaysia. Agronomy 2021, 11, 2113. [Google Scholar] [CrossRef]
  25. Cangao, C.A. Rust-Like Symptoms and Rot on Jackfruit: A Combination of Disease and Abiotic Factors? Available online: https://www.itfnet.org/v1/2016/05/pineapple-agronomy/#:~:text=Pineappleswillgrowina,toachievethedesiredlevel (accessed on 27 December 2021).
  26. Abidin, N.; Ismail, S.I.; Vadamalai, G.; Yusof, M.T.; Hakiman, M.; Karam, D.S.; Ismail-Suhaimy, N.W.; Ibrahim, R.; Zulperi, D. Genetic diversity of Pantoea stewartii subspecies stewartii causing jackfruit-bronzing disease in Malaysia. PLoS ONE 2020, 15, 1–18. [Google Scholar] [CrossRef]
  27. Ibrahim, R.; Ismail-Suhaimy, N.W.; Shu-Qing, T.; Ismail, S.I.; Abidin, N.; Hakiman, M.; Karam, D.S.; Ahmad-Hamdani, M.S.; Yusof, M.T.; Zulperi, D. Molecular characterization and phylogenetic analysis of Pantoea stewartii subspecies stewartii causing bronzing disease of jackfruit in Malaysia based on cps and hrp gene sequences. J. Plant Pathol. 2020, 102, 193–199. [Google Scholar] [CrossRef]
  28. Bolda, M. Strawberry Fruit Bronzing Occurring on Coast. Available online: http://ucanr.edu/ (accessed on 10 September 2021).
  29. Jenkins, J.E.E.; Wiggell, D.; Fletcher, J.T. Tomato fruit bronzing. Ann. Appl. Biol. 1965, 55, 71–81. [Google Scholar] [CrossRef]
  30. Koike, S.T.; Zalom, F.G.; Larson, K.D. Bronzing of strawberry fruit as affected by production practices, environmental factors, and thrips. HortScience 2009, 44, 1588–1593. [Google Scholar] [CrossRef]
  31. Azad, H.R.; Holmes, G.J.; Cooksey, D.A. A new leaf blotch disease of sudangrass caused by Pantoea ananas and Pantoea stewartii. Plant Dis. 2000, 84, 973–979. [Google Scholar] [CrossRef]
  32. Choi, O.; Kim, J. Pantoea stewartii causing stewart’s wilt on Dracaena sanderiana in Korea. J. Phytopathol. 2013, 161, 578–581. [Google Scholar] [CrossRef]
  33. Arayaskul, N.; Poompouang, S.; Lithanatudom, P.; K, L.S. First report of a leaf blight in rice (Oryza sativa) caused by Pantoea ananatis and Pantoea stewartii in Thailand. Plant Dis. 2020, 104, 562. [Google Scholar] [CrossRef]
  34. Kini, K.; Agnimonhan, R.; Afolabi, O.; Milan, B.; Soglonou, B.; Gbogbo, V.; Koebnik, R.; Silué, D. First report of a new bacterial leaf blight of rice caused by Pantoea ananatis and Pantoea stewartii in Benin. Plant Dis. 2017, 101, 242. [Google Scholar] [CrossRef]
  35. Kini, K.; Agnimonhan, R.; Afolabi, O.; Soglonou, B.; Silué, D.; Koebnik, R. First report of a new bacterial leaf blight of rice caused by Pantoea ananatis and Pantoea stewartii in Togo. Plant Dis. 2017, 101, 241. [Google Scholar] [CrossRef]
  36. Mergaert, J.; Verdonck, L.; Kersters, K. Transfer of Erwinia ananas (synonym, Erwinia uredovora) and Erwinia stewartii to the genus Pantoea emend. as Pantoea ananas (Serrano 1928) comb. nov. and Pantoea stewartii (Smith 1898) comb. nov., respectively, and description of Pantoea stewartii subsp. Int. J. Syst. Bacteriol. 1993, 43, 162–173. [Google Scholar] [CrossRef]
  37. CABI. Pantoea Stewartii (Bacterial Wilt of Maize). In: Crop Protection Compendium. Available online: https://www.plantwise.org/knowledgebank/datasheet/21939 (accessed on 10 September 2021).
  38. Anderson, T.R. An outbreak of Stewart’s bacterial wilt of corn in Ontario, Canada. Plant Dis. 1986, 70, 603f. [Google Scholar] [CrossRef]
  39. Dillard, H.R.; Kline, W.L. An outbreak of Stewart’s bacterial wilt of corn in New York State. Plant Dis. 1989, 73, 273. [Google Scholar] [CrossRef]
  40. Albarracín Orio, A.G.; Brücher, E.; Plazas, M.C.; Sayago, P.; Guerra, F.; De Rossi, R.; Ducasse, D.A.; Guerra, G.D. First report of Stewart’s wilt of maize in Argentina caused by Pantoea stewartii. Plant Dis. 2012, 96, 1819. [Google Scholar] [CrossRef]
  41. Haliatur, R.; Sinaga, M.; Memen, S. Giyanto First report of Stewart’s wilt of maize caused by Pantoea stewartii subsp. stewartii in Bogor district, Indonesia. J. Int. Soc. Southeast Asian Agric. Sci. 2014, 20, 131–141. [Google Scholar]
  42. Azizi, M.M.F.; Ismail, S.I.; Hata, E.M.; Zulperi, D.; Ina-Salwany, M.Y.; Abdullah, M.A.F. First report of Pantoea stewartii subsp. indologenes causing leaf blight on rice in Malaysia. Plant Dis. 2019, 103, 1407. [Google Scholar] [CrossRef]
  43. Vinodhini, J.; Kannan, R.; Sankareswari, R.U.; Akila, R.; Pillai, M.A. Characterization of new bacterial leaf blight of rice caused by Pantoea stewartii subsp. indologenes in Southern districts of Tamil Nadu. Int. J. Environ. Agric. Biotechnol. 2017, 2, 3279–3284. [Google Scholar] [CrossRef]
  44. Stumpf, S.; Kvitko, B.; Gitaitis, R.; Dutta, B. Isolation and characterization of novel Pantoea stewartii subsp. indologenes strains exhibiting center rot in onion. Plant Dis. 2018, 102, 727–733. [Google Scholar] [CrossRef]
  45. Zhang, S.; Xu, Z.Y.; Le, R.; Hu, H.Q. First report of leaf blight wilt on Dracaena sanderiana by Pantoea stewartii subsp. indologenes in China. Plant Dis. 2020, 104, 1854. [Google Scholar] [CrossRef]
  46. EPPO. Pantoea Stewartii subsp. Stewartii (ERWIST). Available online: https://gd.eppo.int/taxon/ERWIST/distribution (accessed on 29 August 2021).
  47. EFSA; van der Gaag, D.J.; Schenk, M.; Delbianco, A.; Vos, S. Pest survey card on Pantoea stewartii subsp. stewartii. EFSA Support. Publ. 2020, 17, 1878E. [Google Scholar] [CrossRef]
  48. Arora, T.; Parle, A. Jackfruit: A health boon. Int. J. Res. Ayurveda Pharm. 2016, 7, 59–64. [Google Scholar] [CrossRef]
  49. Md Sabtu, N.; Ishak, M.H.I.; Idris, N.H. The spatial epidemiology of jackfruit pest and diseases: A review. Int. J. Built Environ. Sustain. 2019, 6, 169–175. [Google Scholar] [CrossRef]
  50. Adnan, M. Management of insect pests and diseases of jackfruit (Artocarpus heterophyllus L.) in agroforestry system: A review. Acta Entomol. Zool. 2021, 2, 37–46. [Google Scholar] [CrossRef]
  51. Williams, K.P.; Gillespie, J.J.; Sobral, B.W.S.; Nordberg, E.K.; Snyder, E.E.; Shallom, J.M.; Dickerman, A.W. Phylogeny of gammaproteobacteria. J. Bacteriol. 2010, 192, 2305–2314. [Google Scholar] [CrossRef]
  52. Goszczynska, T.; Moloto, V.M.; Venter, S.N.; Coutinho, T.A. Isolation and identification of Pantoea ananatis from onion seed in South Africa. Seed Sci. Technol. 2006, 34, 655–668. [Google Scholar] [CrossRef]
  53. Mamede, M.C.; Tebaldi, N.D.; Mota, L.C.B.M.; Martins, O.M.; Coelho, L. Detection of Pantoea ananatis in corn seeds on semi-selective medium. Trop. Plant Pathol. 2018, 43, 254–256. [Google Scholar] [CrossRef]
  54. Coplin, D.L.; Majerczak, D.R.; Zhang, Y.; Kim, W.S.; Jock, S.; Geider, K. Identification of Pantoea stewartii subsp. stewartii by PCR and strain differentiation by PFGE. Plant Dis. 2002, 86, 304–311. [Google Scholar] [CrossRef]
  55. Duong, D.A.; Stevens, A.M.; Jensen, R.V. Complete genome assembly of Pantoea stewartii subsp. stewartii DC283, a corn pathogen. Genome Announc. 2017, 5, 1–2. [Google Scholar] [CrossRef]
  56. Kini, K.; Dossa, R.; Dossou, B.; Mariko, M.; Koebnik, R.; Silué, D. A semi-selective medium to isolate and identify bacteria of the genus Pantoea. J. Gen. Plant Pathol. 2019, 85, 424–427. [Google Scholar] [CrossRef]
  57. Cother, E.J.; Reinke, R.; McKenzie, C.; Lanoiselet, V.M.; Noble, D.H. An unusual stem necrosis of rice caused by Pantoea ananas and the first record of this pathogen on rice in Australia. Australas. Plant Pathol. 2004, 33, 495–503. [Google Scholar] [CrossRef]
  58. Sandle, T. Microbial identification. In Pharmaceutical Microbiology; Woodhead Publishing: Sawston, UK, 2016; pp. 103–113. ISBN 9780081000229. [Google Scholar]
  59. EPPO. PM 7/60 (2) Pantoea stewartii subsp. stewartii. EPPO Bull. 2016, 46, 226–236. [Google Scholar] [CrossRef]
  60. Balint-Kurti, P. The plant hypersensitive response: Concepts, control and consequences. Mol. Plant Pathol. 2019, 20, 1163–1178. [Google Scholar] [CrossRef]
  61. Glaeser, S.P.; Kämpfer, P. Multilocus sequence analysis (MLSA) in prokaryotic taxonomy. Syst. Appl. Microbiol. 2015, 38, 237–245. [Google Scholar] [CrossRef]
  62. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef]
  63. Gevers, D.; Cohan, F.M.; Lawrence, J.G.; Spratt, B.G.; Coenye, T.; Feil, E.J.; Stackebrandt, E.; Van de Peer, Y.; Vandamme, P.; Thompson, F.L.; et al. Re-evaluating prokaryotic species. Nat. Rev. Microbiol. 2005, 3, 733–739. [Google Scholar] [CrossRef]
  64. Brady, C.; Cleenwerck, I.; Venter, S.; Vancanneyt, M.; Swings, J.; Coutinho, T. Phylogeny and identification of Pantoea species associated with plants, humans and the natural environment based on multilocus sequence analysis (MLSA). Syst. Appl. Microbiol. 2008, 31, 447–460. [Google Scholar] [CrossRef]
  65. Brady, C.; Cleenwerck, I.; Venter, S.; Coutinho, T.; De Vos, P. Taxonomic evaluation of the genus Enterobacter based on multilocus sequence analysis (MLSA): Proposal to reclassify E. nimipressuralis and E. amnigenus into Lelliottia gen. nov. as Lelliottia nimipressuralis comb. nov. and Lelliottia amnigena comb. nov., respectively, E. gergoviae and E. pyrinus into Pluralibacter gen. nov. as Pluralibacter gergoviae comb. nov. and Pluralibacter pyrinus comb. nov., respectively, E. cowanii, E. radicincitans, E. oryzae and E. arachidis into Kosakonia gen. nov. as Kosakonia cowanii comb. nov., Kosakonia radicincitans comb. nov., Kosakonia oryzae comb. nov. and Kosakonia arachidis comb. nov., respectively, and E. turicensis, E. helveticus and E. pulveris into Cronobacter as Cronobacter zurichensis nom. nov., Cronobacter helveticus comb. nov. and Cronobacter pulveris comb. nov., respectively, and emended description of the genera Enterobacter and Cronobacter. Syst. Appl. Microbiol. 2013, 36, 309–319. [Google Scholar] [CrossRef]
  66. Brenner, D.J.; Fanning, G.R.; Leete Knutson, J.K. Attempts to classify herbicola group-Enterobacter agglomerans strains by deoxyribonucleic acid hybridization and phenotypic tests. Int. J. Syst. Bacteriol. 1984, 34, 45–55. [Google Scholar] [CrossRef]
  67. Brady, C.L.; Venter, S.N.; Cleenwerck, I.; Vandemeulebroecke, K.; De Vos, P.; Coutinho, T.A. Transfer of Pantoea citrea, Pantoea punctata and Pantoea terrea to the genus Tatumella emend. as Tatumella citrea comb. nov., Tatumella punctata comb. nov. and Tatumella terrea comb. nov. and description of Tatumella morbirosei sp. nov. Int. J. Syst. Evol. Microbiol. 2010, 60, 484–494. [Google Scholar] [CrossRef]
  68. Brady, C.L.; Cleenwerck, I.; Venter, S.N.; Engelbeen, K.; De Vos, P.; Coutinho, T.A. Emended description of the genus Pantoea, description of four species from human clinical samples, Pantoea septica sp. nov., Pantoea eucrina sp. nov., Pantoea brenneri sp. nov. and Pantoea conspicua sp. nov., and transfer of Pectobacterium cypripedii (Hor. Int. J. Syst. Evol. Microbiol. 2010, 60, 2430–2440. [Google Scholar] [CrossRef]
  69. Ibrahim, R.; Ismail-Suhaimy, N.W.; Shu-Qing, T.; Ismail, S.I.; Ina-Salwany, M.Y.; Yusof, M.T.; Hakiman, M.; Karam, D.S.; Zulperi, D. Draft genome sequencing data of a pathogenic Pantoea stewartii subspecies stewartii strain SQT1 causing bronzing disease of jackfruit in Malaysia. Data Br. 2020, 30, 105634. [Google Scholar] [CrossRef]
  70. Roper, M.C. Pantoea stewartii subsp. stewartii: Lessons learned from a xylem-dwelling pathogen of sweet corn. Mol. Plant Pathol. 2011, 12, 628–637. [Google Scholar] [CrossRef]
  71. Bartholomew, H.P.; Reynoso, G.; Thomas, B.J.; Mullins, C.M.; Smith, C.; Gentzel, I.N.; Giese, L.A.; Mackey, D.; Stevens, A.M. The transcription factor Lrp of Pantoea stewartii subsp. stewartii controls capsule production, motility, and virulence important for in planta growth. Front. Microbiol. 2022, 12, 1–9. [Google Scholar] [CrossRef]
  72. Figaj, D.; Ambroziak, P.; Przepiora, T.; Skorko-Glonek, J. The role of proteases in the virulence of plant pathogenic bacteria. Int. J. Mol. Sci. 2019, 20, 672. [Google Scholar] [CrossRef]
  73. Mohammadi, M.; Burbank, L.; Roper, M.C. Pantoea stewartii subsp. stewartii produces an endoglucanase that is required for full virulence in sweet corn. Mol. Plant-Microbe Interact. 2012, 25, 463–470. [Google Scholar] [CrossRef]
  74. Koutsoudis, M.D.; Tsaltas, D.; Minogue, T.D.; Von Bodman, S.B. Quorum-sensing regulation governs bacterial adhesion, biofilm development, and host colonization in Pantoea stewartii subspecies stewartii. Proc. Natl. Acad. Sci. USA 2006, 103, 5983–5988. [Google Scholar] [CrossRef]
  75. Pataky, J.K. Stewart’s Wilt of Corn. Available online: https://www.apsnet.org/edcenter/disandpath/prokaryote/pdlessons/Pages/StewartWilt.aspx (accessed on 4 September 2021).
  76. Nimtz, M.; Mort, A.; Wray, V.; Domke, T.; Zhang, Y.; Coplin, D.L.; Geider, K. Structure of stewartan, the capsular exopolysaccharide from the corn pathogen Erwinia stewartii. Carbohydr. Res. 1996, 288, 189–201. [Google Scholar] [CrossRef]
  77. Yang, B.Y.; Gray, J.S.S.; Montgomery, R. The structure of stewartan, a capsular polysaccharide produced by Erwinia stewartii strain DC283. Carbohydr. Res. 1996, 296, 183–201. [Google Scholar] [CrossRef]
  78. Jumel, K.; Geider, K.; Harding, S.E. The solution molecular weight and shape of the bacterial exopolysaccharides amylovoran and stewartan. Int. J. Biol. Macromol. 1997, 20, 251–258. [Google Scholar] [CrossRef]
  79. Herrera, C.M.; Koutsoudis, M.D.; Wang, X.; Von Bodman, S.B. Pantoea stewartii subsp. stewartii exhibits surface motility, which is a critical aspect of stewart’s wilt disease development on maize. Mol. Plant-Microbe Interact. 2008, 21, 1359–1370. [Google Scholar] [CrossRef] [PubMed]
  80. Lewis, V.G.; Ween, M.P.; McDevitt, C.A. The role of ATP-binding cassette transporters in bacterial pathogenicity. Protoplasma 2012, 249, 919–942. [Google Scholar] [CrossRef] [PubMed]
  81. Tanaka, K.J.; Song, S.; Mason, K.; Pinkett, H.W. Selective substrate uptake: The role of ATP-binding cassette (ABC) importers in pathogenesis. Biochim. Biophys. Acta - Biomembr. 2018, 1860, 868–877. [Google Scholar] [CrossRef]
  82. Zeng, Y.; Charkowski, A.O. The role of ATP-binding cassette transporters in bacterial phytopathogenesis. Phytopathology 2021, 111, 600–610. [Google Scholar] [CrossRef]
  83. Wilkens, S. Structure and mechanism of ABC transporters. F1000Prime Rep. 2015, 7, 1–9. [Google Scholar] [CrossRef]
  84. Wood, D.W.; Setubal, J.C.; Kaul, R.; Monks, D.E.; Kitajima, J.P.; Okura, V.K.; Zhou, Y.; Chen, L.; Wood, G.E.; Almeida, J.; et al. The genome of the natural genetic engineer Agrobacterium tumefaciens C58. Science 2001, 294, 2317–2323. [Google Scholar] [CrossRef]
  85. Masulis, I.S.; Sukharycheva, N.A.; Kiselev, S.S.; Andreeva, Z.S.; Ozoline, O.N. Between computational predictions and high-throughput transcriptional profiling: In depth expression analysis of the OppB trans-membrane subunit of Escherichia coli OppABCDF oligopeptide transporter. Res. Microbiol. 2020, 171, 55–63. [Google Scholar] [CrossRef]
  86. Garai, P.; Chandra, K.; Chakravortty, D. Bacterial peptide transporters: Messengers of nutrition to virulence. Virulence 2017, 8, 297–309. [Google Scholar] [CrossRef]
  87. Oshiro, E.E.; Tavares, M.B.; Suzuki, C.F.; Pimenta, D.C.; Angeli, C.B.; de Oliveira, J.C.F.; Ferro, M.I.T.; Ferreira, L.C.S.; Ferreira, R.C.C. Distribution and biological role of the oligopeptide-binding protein (OppA) in Xanthomonas species. Genet. Mol. Biol. 2010, 33, 341–347. [Google Scholar] [CrossRef][Green Version]
  88. De Maayer, P.; Venter, S.N.; Kamber, T.; Duffy, B.; Coutinho, T.A.; Smits, T.H.M. Comparative genomics of the type VI secretion systems of Pantoea and Erwinia species reveals the presence of putative effector islands that may be translocated by the VgrG and Hcp proteins. BMC Genomics 2011, 12, 2–15. [Google Scholar] [CrossRef]
  89. Filloux, A.; Hachani, A.; Bleves, S. The bacterial type VI secretion machine: Yet another player for protein transport across membranes. Microbiology 2008, 154, 1570–1583. [Google Scholar] [CrossRef]
  90. Mulder, D.T.; Cooper, C.A.; Coombes, B.K. Type VI secretion system-associated gene clusters contribute to pathogenesis of Salmonella enterica serovar typhimurium. Infect. Immun. 2012, 80, 1996–2007. [Google Scholar] [CrossRef]
  91. Shyntum, D.Y.; Venter, S.N.; Moleleki, L.N.; Toth, I.; Coutinho, T.A. Comparative genomics of type VI secretion systems in strains of Pantoea ananatis from different environments. BMC Genomics 2014, 15, 1–15. [Google Scholar] [CrossRef]
  92. Bernal, P.; Llamas, M.A.; Filloux, A. Type VI secretion systems in plant-associated bacteria. Environ. Microbiol. 2018, 20, 1–15. [Google Scholar] [CrossRef]
  93. Hernandez, R.E.; Gallegos-Monterrosa, R.; Coulthurst, S.J. Type VI secretion system effector proteins: Effective weapons for bacterial competitiveness. Cell. Microbiol. 2020, 22, 1–9. [Google Scholar] [CrossRef]
  94. Mariano, G.; Monlezun, L.; Coulthurst, S.J. Dual role for DsbA in attacking and targeted bacterial cells during type VI secretion system-mediated competition. Cell Rep. 2018, 22, 774–785. [Google Scholar] [CrossRef]
  95. Russell, A.B.; Hood, R.D.; Bui, N.K.; Leroux, M.; Vollmer, W.; Mougous, J.D. Type VI secretion delivers bacteriolytic effectors to target cells. Nature 2011, 475, 343–349. [Google Scholar] [CrossRef]
  96. Kapitein, N.; Mogk, A. Deadly syringes: Type VI secretion system activities in pathogenicity and interbacterial competition. Curr. Opin. Microbiol. 2013, 16, 52–58. [Google Scholar] [CrossRef]
  97. Robitaille, S.; Trus, E.; Ross, B.D. Bacterial defense against the type VI secretion system. Trends Microbiol. 2021, 29, 187–190. [Google Scholar] [CrossRef]
  98. Pissaridou, P.; Allsopp, L.P.; Wettstadt, S.; Howard, S.A.; Mavridou, D.A.I.; Filloux, A. The Pseudomonas aeruginosa T6SS-VgrG1b spike is topped by a PAAR protein eliciting DNA damage to bacterial competitors. Proc. Natl. Acad. Sci. USA 2018, 115, 12519–12524. [Google Scholar] [CrossRef]
  99. Records, A.R.; Gross, D.C. Sensor kinases RetS and LadS regulate Pseudomonas syringae type VI secretion and virulence factors. J. Bacteriol. 2010, 192, 3584–3596. [Google Scholar] [CrossRef]
  100. Zheng, J.; Shin, O.S.; Cameron, D.E.; Mekalanos, J.J. Quorum sensing and a global regulator TsrA control expression of type VI secretion and virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA 2010, 107, 21128–21133. [Google Scholar] [CrossRef] [PubMed]
  101. Russell, A.B.; Peterson, S.B.; Mougous, J.D. Type VI secretion system effectors: Poisons with a purpose. Nat. Rev. Microbiol. 2014, 12, 137–148. [Google Scholar] [CrossRef] [PubMed]
  102. Ho, B.T.; Dong, T.G.; Mekalanos, J.J. A view to a kill: The bacterial type VI secretion system. Cell Host Microbe 2014, 15, 9–21. [Google Scholar] [CrossRef]
  103. Hachani, A.; Wood, T.E.; Filloux, A. Type VI secretion and anti-host effectors. Curr. Opin. Microbiol. 2016, 29, 81–93. [Google Scholar] [CrossRef]
  104. Pukatzki, S.; Ma, A.T.; Revel, A.T.; Sturtevant, D.; Mekalanos, J.J. Type VI secretion system translocates a phage tail spike-like protein into target cells where it cross-links actin. Proc. Natl. Acad. Sci. USA 2007, 104, 15508–15513. [Google Scholar] [CrossRef] [PubMed]
  105. Leiman, P.G.; Basler, M.; Ramagopal, U.A.; Bonanno, J.B.; Sauder, J.M.; Pukatzki, S.; Burley, S.K.; Almo, S.C.; Mekalanos, J.J. Type VI secretion apparatus and phage tail-associated protein complexes share a common evolutionary origin. Proc. Natl. Acad. Sci. USA 2009, 106, 4154–4159. [Google Scholar] [CrossRef] [PubMed]
  106. Purcell, M.; Shuman, H.A. The Legionella pneumophila icmGCDJBF genes are required for killing of human macrophages. Infect. Immun. 1998, 66, 2245–2255. [Google Scholar] [CrossRef]
  107. Gomez-Valero, L.; Chiner-Oms, A.; Comas, I.; Buchrieser, C.; Hershberg, R. Evolutionary dissection of the Dot/Icm system based on comparative genomics of 58 Legionella species. Genome Biol. Evol. 2019, 11, 2619–2632. [Google Scholar] [CrossRef] [PubMed]
  108. Ma, L.S.; Lin, J.S.; Lai, E.M. An IcmF family protein, ImpLM, is an integral inner membrane protein interacting with ImpKL, and its Walker a motif is required for type VI secretion system-mediated Hcp secretion in Agrobacterium tumefaciens. J. Bacteriol. 2009, 191, 4316–4329. [Google Scholar] [CrossRef]
  109. Sexton, J.A.; Miller, J.L.; Yoneda, A.; Kehl-Fie, T.E.; Vogel, J.P. Legionella pneumophila DotU and IcmF are required for stability of the Dot/Icm complex. Infect. Immun. 2004, 72, 5983–5992. [Google Scholar] [CrossRef]
  110. VanRheenen, S.M.; Duménil, G.; Isberg, R.R. IcmF and DotU are required for optimal effector translocation and trafficking of the Legionella pneumophila vacuole. Infect. Immun. 2004, 72, 5972–5982. [Google Scholar] [CrossRef]
  111. Li, B.; Wang, X.; Chen, J.; Liu, H.; Ali, K.A.; Wang, Y.; Qiu, W.; Sun, G. IcmF and DotU are required for the virulence of Acidovorax oryzae strain RS-1. Arch. Microbiol. 2018, 200, 897–910. [Google Scholar] [CrossRef]
  112. Zusman, T.; Feldman, M.; Halperin, E.; Segal, G. Characterization of the icmH and icmF genes required for Legionella pneumophila intracellular growth, genes that are present in many bacteria associated with eukaryotic cells. Infect. Immun. 2004, 72, 3398–3409. [Google Scholar] [CrossRef]
  113. Bladergroen, M.R.; Badelt, K.; Spaink, H.P. Infection-blocking genes of a symbiotic Rhizobium leguminosarum strain that are involved in temperature-dependent protein secretion. Mol. Plant-Microbe Interact. 2003, 16, 53–64. [Google Scholar] [CrossRef]
  114. Ma, L.S.; Narberhaus, F.; Lai, E.M. IcmF family protein TssM exhibits ATPase activity and energizes type VI secretion. J. Biol. Chem. 2012, 287, 15610–15621. [Google Scholar] [CrossRef]
  115. Miller, J.M.; Enemark, E.J. Fundamental characteristics of AAA+ protein family structure and function. Archaea 2016, 2016, 1–12. [Google Scholar] [CrossRef]
  116. Ogura, T.; Wilkinson, A.J. AAA+ superfamily ATPases: Common structure-diverse function. Genes Cells 2001, 6, 575–597. [Google Scholar] [CrossRef]
  117. Basler, M. Type VI secretion system: Secretion by a contractile nanomachine. Philos. Trans. R. Soc. B Biol. Sci. 2015, 370. [Google Scholar] [CrossRef]
  118. Bönemann, G.; Pietrosiuk, A.; Diemand, A.; Zentgraf, H.; Mogk, A. Remodelling of VipA/VipB tubules by ClpV-mediated threading is crucial for type VI protein secretion. EMBO J. 2009, 28, 315–325. [Google Scholar] [CrossRef]
  119. Shrivastava, S.; Mande, S.S. Identification and functional characterization of gene components of type VI secretion system in bacterial genomes. PLoS ONE 2008, 3, e2995. [Google Scholar] [CrossRef]
  120. Mougous, J.D.; Gifford, C.A.; Ramsdell, T.L.; Mekalanos, J.J. Threonine phosphorylation post-translationally regulates protein secretion in Pseudomonas aeruginosa. Nat. Cell Biol. 2007, 9, 797–803. [Google Scholar] [CrossRef]
  121. Pennell, S.; Westcott, S.; Ortiz-Lombardía, M.; Patel, D.; Li, J.; Nott, T.J.; Mohammed, D.; Buxton, R.S.; Yaffe, M.B.; Verma, C.; et al. Structural and functional analysis of phosphothreonine-dependent FHA domain interactions. Structure 2010, 18, 1587–1595. [Google Scholar] [CrossRef]
  122. Venegas, L.A.; Pershad, K.; Bankole, O.; Shah, N.; Kay, B.K. A comparison of phosphospecific affinity reagents reveals the utility of recombinant Forkhead-associated domains in recognizing phosphothreonine-containing peptides. N. Biotechnol. 2016, 33, 537–543. [Google Scholar] [CrossRef]
  123. Kamber, T.; Pothier, J.F.; Pelludat, C.; Rezzonico, F.; Duffy, B.; Smits, T.H.M. Role of the type VI secretion systems during disease interactions of Erwinia amylovora with its plant host. BMC Genomics 2017, 18, 1–12. [Google Scholar] [CrossRef]
  124. Shyntum, D.Y.; Theron, J.; Venter, S.N.; Moleleki, L.N.; Toth, I.K.; Coutinho, T.A. Pantoea ananatis utilizes a type VI secretion system for pathogenesis and bacterial competition. Mol. Plant-Microbe Interact. 2015, 28, 420–431. [Google Scholar] [CrossRef]
  125. Green, E.R.; Mecsas, J. Bacterial secretion systems: An overview. Microbiol. Spectr. 2016, 4, VMBF-0012-2015. [Google Scholar] [CrossRef]
  126. Bernhard, F.; Schullerus, D.; Bellemann, P.; Nimtz, M.; Coplin, D.L.; Geider, K. Genetic transfer of amylovoran and stewartan synthesis between Erwinia amylovora and Erwinia stewartii. Microbiology 1996, 142, 1087–1096. [Google Scholar] [CrossRef][Green Version]
  127. Dolph, P.J.; Majerczak, D.R.; Coplin, D.L. Characterization of a gene cluster for exopolysaccharide biosynthesis and virulence in Erwinia stewartii. J. Bacteriol. 1988, 170, 865–871. [Google Scholar] [CrossRef]
  128. Whitfield, C.; Szymanski, C.M.; Aebi, M. Eubacteria. In Essentials of Glycobiology [Internet], 3rd ed.; The Consortium of Glycobiology Editors, La Jolla, California; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2017; pp. 1–11. [Google Scholar]
  129. Limoli, D.H.; Jones, C.J.; Wozniak, D.J. Bacterial extracellular polysaccharides in biofilm formation and function. Microbiol. Spectr. 2015, 3, 1–30. [Google Scholar] [CrossRef] [PubMed]
  130. Bogino, P.C.; de las Mercedes Oliva, M.; Sorroche, F.G.; Giordano, W. The role of bacterial biofilms and surface components in plant-bacterial associations. Int. J. Mol. Sci. 2013, 14, 15838–15859. [Google Scholar] [CrossRef] [PubMed]
  131. Von Bodman, S.B.; Majerczak, D.R.; Coplin, D.L. A negative regulator mediates quorum-sensing control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc. Natl. Acad. Sci. USA 1998, 95, 7687–7692. [Google Scholar] [CrossRef] [PubMed]
  132. Langlotz, C.; Schollmeyer, M.; Coplin, D.L.; Nimtz, M.; Geider, K. Biosynthesis of the repeating units of the exopolysaccharides amylovoran from Erwinia amylovora and stewartan from Pantoea stewartii. Physiol. Mol. Plant Pathol. 2011, 75, 163–169. [Google Scholar] [CrossRef]
  133. Knirel, Y.A.; Van Calsteren, M.R. Bacterial exopolysaccharides. In Comprehensive Glycoscience, 2nd ed.; Elsevier Inc.: Amsterdam, The Netherlands, 2021; pp. 21–95. ISBN 9780128194751. [Google Scholar]
  134. Laws, A.; Gu, Y.; Marshall, V. Biosynthesis, characterisation, and design of bacterial exopolysaccharides from lactic acid bacteria. Biotechnol. Adv. 2001, 19, 597–625. [Google Scholar] [CrossRef]
  135. Sklar, J.G.; Wu, T.; Gronenberg, L.S.; Malinverni, J.C.; Kahne, D.; Silhavy, T.J. Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc. Natl. Acad. Sci. USA 2007, 104, 6400–6405. [Google Scholar] [CrossRef]
  136. Kim, S.; Malinverni, J.C.; Sliz, P.; Silhavy, T.J.; Harrison, S.C.; Kahne, D. Structure and function of an essential component of the outer membrane protein assembly machine. Science 2007, 317, 961–964. [Google Scholar] [CrossRef]
  137. Drummelsmith, J.; Whitfield, C. Gene products required for surface expression of the capsular form of the group 1 K antigen in Escherichia coli (O9a:K30). Mol. Microbiol. 1999, 31, 1321–1332. [Google Scholar] [CrossRef]
  138. Kim, M.K.; Lee, Y.H.; Kim, H.; Lee, J.; Ryu, J.S. Characterization of the wzc gene from Pantoea sp. strain PPE7 and its influence on extracellular polysaccharide production and virulence on Pleurotus eryngii. Microbiol. Res. 2015, 170, 157–167. [Google Scholar] [CrossRef]
  139. Pereira, S.B.; Santos, M.; Leite, J.P.; Flores, C.; Eisfeld, C.; Büttel, Z.; Mota, R.; De, F.R.R.; Gales, P.L.; Cabral, J.H.M.; et al. The role of the tyrosine kinase Wzc (Sll0923) and the phosphatase Wzb (Slr0328) in the production of extracellular polymeric substances (EPS) by Synechocystis PCC 6803. Microbiologyopen 2019, 8, 1–15. [Google Scholar] [CrossRef]
  140. Guo, H.; Yi, W.; Song, J.; Wang, P.G. Current understanding on biosynthesis of microbial polysaccharides. Curr. Top. Med. Chem. 2008, 8, 141–151. [Google Scholar] [CrossRef]
  141. Newman, M.A.; Von Roepenack, E.; Daniels, M.; Dow, M. Lipopolysaccharides and plant responses to phytopathogenic bacteria. Mol. Plant Pathol. 2000, 1, 25–31. [Google Scholar] [CrossRef]
  142. Clifford, J.C.; Rapicavoli, J.N.; Roper, M.C. A rhamnose-rich O-antigen mediates adhesion, virulence, and host colonization for the xylem-limited phytopathogen Xylella fastidiosa. Mol. Plant-Microbe Interact. 2013, 26, 676–685. [Google Scholar] [CrossRef]
  143. Kabanova, A.P.; Shneider, M.M.; Korzhenkov, A.A.; Bugaeva, E.N.; Miroshnikov, K.K.; Zdorovenko, E.L.; Kulikov, E.E.; Toschakov, S.V.; Ignatov, A.N.; Knirel, Y.A.; et al. Host specificity of the Dickeya bacteriophage PP35 is directed by a tail spike interaction with bacterial O-antigen, enabling the infection of alternative non-pathogenic bacterial host. Front. Microbiol. 2019, 10, 1–11. [Google Scholar] [CrossRef]
  144. Lee, C.; Mannaa, M.; Kim, N.; Kim, J.; Choi, Y.; Kim, S.H.; Jung, B.; Lee, H.H.; Lee, J.; Seo, Y.S. Stress tolerance and virulence-related roles of lipopolysaccharide in Burkholderia glumae. Plant Pathol. J. 2019, 35, 445–458. [Google Scholar] [CrossRef]
  145. Lerouge, I.; Vanderleyden, J. O-antigen structural variation: Mechanisms and possible roles in animal/plant-microbe interactions. FEMS Microbiol. Rev. 2002, 26, 17–47. [Google Scholar] [CrossRef]
  146. Rapicavoli, J.N.; Blanco-Ulate, B.; Muszyński, A.; Figueroa-Balderas, R.; Morales-Cruz, A.; Azadi, P.; Dobruchowska, J.M.; Castro, C.; Cantu, D.; Roper, M.C. Lipopolysaccharide O-antigen delays plant innate immune recognition of Xylella fastidiosa. Nat. Commun. 2018, 9, 1–12. [Google Scholar] [CrossRef]
  147. Plantwise. Pest Management Decision Guide: Green List. Bacterial Wilt of Maize. Available online: www.plantwise.org (accessed on 20 January 2022).
  148. Blomme, G.; Dita, M.; Jacobsen, K.S.; Vicente, L.P.; Molina, A.; Ocimati, W.; Poussier, S.; Prior, P. Bacterial diseases of bananas and enset: Current state of knowledge and integrated approaches toward sustainable management. Front. Plant Sci. 2017, 8, 1–25. [Google Scholar] [CrossRef]
  149. Galanti, R.; Lutgen, H. Greenhouse and Nursery Sanitation. Available online: https://www.ctahr.hawaii.edu/site/Info.aspx (accessed on 22 January 2022).
  150. Afzal, I.; Shabir, R.; Rauf, S. Seed production technologies of some major field crops. In Agronomic Crops; Hasanuzzaman, M., Ed.; Springer: Singapore, 2019; Volume 1, pp. 655–678. ISBN 9789813291515. [Google Scholar]
  151. UK CABI. Pantoea Stewartii (Bacterial Wilt of Maize). Invasive Species Compendium. Available online: httpsL//www.cabi.org/isc/datasheet/21939 (accessed on 24 January 2022).
  152. Braun, E.J. Ultrastructural investigation of resistant and susceptible maize inbreds infected with Erwinia stewartii. Phytopathology 1982, 72, 159–166. [Google Scholar] [CrossRef]
  153. Parker, G.B.; Hooker, A.L. Inheritance of resistance to Erwinia stewartii in four inbred lines of dent corn: Qualitative and quantitative analyses. Maydica 1993, 38, 223–229. [Google Scholar]
  154. Department of Agriculture. Varieties Registered for National Crop List. Available online: http://pvpbkkt.doa.gov.my/ (accessed on 22 January 2022).
  155. Woods, T.; Israel, H.; Sherf, A. Isolation and partial characterization of a bacteriophage of Erwinia stewartii from the corn flea beetle, Chaetocnema pulicaria. Prot. Ecol. 1981, 3, 229–236. [Google Scholar]
  156. Maitra, S.; Hossain, A.; Brestic, M.; Skalicky, M.; Ondrisik, P.; Gitari, H.; Brahmachari, K.; Shankar, T.; Bhadra, P.; Palai, J.B.; et al. Intercropping—a low input agricultural strategy for food and environmental security. Agronomy 2021, 11, 343. [Google Scholar] [CrossRef]
  157. Teshome, S. Review on strategy of developing intercropping practices. Int. J. Curr. Res. Acad. Rev. 2019, 7, 61–67. [Google Scholar] [CrossRef]
  158. Ming He, H.; Na Liu, L.; Munir, S.; Bashir, N.H.; Wang, Y.; Yang, J.; Li, C. yun Crop diversity and pest management in sustainable agriculture. J. Integr. Agric. 2019, 18, 1945–1952. [Google Scholar] [CrossRef]
  159. Poddar, N.; Yele, Y.; Kumari, A. Cropping system approach in IPM. In Adaptive Crop Protection Management Strategies; Prasad, D., Lal, G., Ahmad, I., Eds.; Write and Print Publications: New Delhi, India, 2020; pp. 358–371. ISBN 9789388317085. [Google Scholar]
  160. Rahaman, M.A.; Rahman, A.; Miah, M.G.; Hoque, M.A.; Rahman, M.M. Productivity and profitability of jackfruit-eggplant agroforestry system in the terrace ecosystem of Bangladesh. Turkish J. Agric. - Food Sci. Technol. 2018, 6, 124. [Google Scholar] [CrossRef]
  161. Hasan, M.; Ahmed, M.; Miah, M. Agro-economic performance of jackfruit-pineapple agroforestry system in Madhupur tract. J. Agric. Rural Dev. 1970, 6, 147–156. [Google Scholar] [CrossRef]
  162. Islam, M.S.; Kamruzzaman, M.; Rahman, K.T. Economic aspect of different agroforestry practices in Tangail district. Ann. Bangladesh Agric. 2018, 22, 107–118. [Google Scholar]
  163. Malézieux, E.; Crozat, Y.; Dupraz, C.; Laurans, M.; Makowski, D.; Ozier-Lafontaine, H.; Rapidel, B.; De Tourdonnet, S.; Valantin-Morison, M. Mixing plant species in cropping systems: Concepts, tools and models: A review. Sustain. Agric. 2009, 29, 329–353. [Google Scholar] [CrossRef]
  164. Bybee-Finley, K.A.; Ryan, M.R. Advancing intercropping research and practices in industrialized agricultural landscapes. Agriculture 2018, 8, 80. [Google Scholar] [CrossRef]
  165. Yruela, I. Copper in plants. Brazilian J. Plant Physiol. 2005, 17, 145–156. [Google Scholar] [CrossRef]
  166. Yruela, I. Copper in plants: Acquisition, transport and interactions. Funct. Plant Biol. 2009, 36, 409–430. [Google Scholar] [CrossRef] [PubMed]
  167. Borkow, G.; Gabbay, J. Copper as a biocidal tool. Curr. Med. Chem. 2005, 12, 2163–2175. [Google Scholar] [CrossRef] [PubMed]
  168. Hardy, S.; Keith, F.; Barkley, P. Using Copper Sprays to Control Diseases in Citrus. Available online: http://mvcitrus.org.au/ (accessed on 22 January 2022).
  169. Gitaitis, R.D.; Walcott, R.R.; Wells, M.L.; Diaz Perez, J.C.; Sanders, F.H. Transmission of Pantoea ananatis, causal agent of center rot of onion, by tobacco thrips, Frankliniella fusca. Plant Dis. 2003, 87, 675–678. [Google Scholar] [CrossRef] [PubMed]
  170. Nischwitz, C.; Gitaitis, R.; Sanders, H.; Langston, D.; Mullinix, B.; Torrance, R.; Boyhan, G.; Zolobowska, L. Use of fatty acid methyl ester profiles to compare copper-tolerant and copper-sensitive strains of Pantoea ananatis. Phytopathology 2007, 97, 1298–1304. [Google Scholar] [CrossRef]
  171. Balogh, B.; Canteros, B.I.; Stall, R.E.; Jones, J.B. Control of citrus canker and citrus bacterial spot with bacteriophages. Plant Dis. 2008, 92, 1048–1052. [Google Scholar] [CrossRef]
  172. Ninot, A.; Aletà, N.; Moragrega, C.; Montesinos, E. Evaluation of a reduced copper spraying program to control bacterial blight of walnut. Plant Dis. 2002, 86, 583–587. [Google Scholar] [CrossRef]
  173. Gent, D.H.; Schwartz, H.F. Management of Xanthomonas leaf blight of onion with a plant activator, biological control agents, and copper bactericides. Plant Dis. 2005, 89, 631–639. [Google Scholar] [CrossRef]
  174. Martin, H.L.; Hamilton, V.A.; Kopittke, R.A. Copper tolerance in Australian populations of Xanthomonas campestris pv. vesicatoria contributes to poor field control of bacterial spot of pepper. Plant Dis. 2004, 88, 921–924. [Google Scholar] [CrossRef][Green Version]
  175. Romero, A.M.; Kousik, C.S.; Ritchie, D.F. Resistance to bacterial spot in bell pepper induced by acibenzolar-S-methyl. Plant Dis. 2001, 85, 189–194. [Google Scholar] [CrossRef]
  176. Louws, F.J.; Wilson, M.; Campbell, H.L.; Cuppels, D.A.; Jones, J.B.; Shoemaker, P.B.; Sahin, F.; Miller, S.A. Field control of bacterial spot and bacterial speck of tomato using a plant activator. Plant Dis. 2001, 85, 481–488. [Google Scholar] [CrossRef]
  177. Poudel, N.S.; Neupane, S. Bacterial diseases of plants in Nepal: A review. Asian J. Agric. Hortic. Res. 2018, 2, 1–10. [Google Scholar] [CrossRef]
  178. Lamichhane, J.R.; Osdaghi, E.; Behlau, F.; Köhl, J.; Jones, J.B.; Aubertot, J.N. Thirteen decades of antimicrobial copper compounds applied in agriculture. A review. Agron. Sustain. Dev. 2018, 38, 1–18. [Google Scholar] [CrossRef]
  179. Djaenuddin, N.; Muis, A. Padi. J. Penelit. dan Pengemb. Pertan. 2018, 37, 41–48. [Google Scholar]
  180. Kuhar, T.P.; Stivers-Young, L.J.; Hoffmann, M.P.; Taylor, A.G. Control of corn flea beetle and Stewart’s wilt in sweet corn with imidacloprid and thiamethoxam seed treatments. Crop Prot. 2002, 21, 25–31. [Google Scholar] [CrossRef]
  181. Munkvold, G.P.; McGee, D.C.; Iles, A. Effects of imidacloprid seed treatment of corn on foliar feeding and Erwinia stewartii transmission by the corn flea beetle. Plant Dis. 1996, 80, 747–749. [Google Scholar] [CrossRef]
  182. Pataky, J.K.; Michener, P.M.; Freeman, N.D.; Whalen, J.M.; Hawk, J.A.; Weldekidan, T.; Teyker, R.H. Rates of seed treatment insecticides and control of Stewart’s wilt in sweet corn. Plant Dis. 2005, 89, 262–268. [Google Scholar] [CrossRef][Green Version]
  183. Crane, J.H.; Balerdi, C.F.; Campbell, R.J. The jackfruit (Artocarpus heterophyllus Lam.) in Florida. Edis 2006, 18, 1–13. [Google Scholar] [CrossRef]
  184. Elevitch, C.R.; Manner, H.I. Artocarpus heterophyllus (jackfruit). Species Profiles Pac. Isl. Agrofor. 2006, 10, 1–25. [Google Scholar]
  185. Witherup, C.; Zuberi, M.I.; Hossain, S.; Zerega, N.J.C. Genetic diversity of Bangladeshi jackfruit (Artocarpus heterophyllus) over time and across seedling sources. Econ. Bot. 2019, 73, 233–248. [Google Scholar] [CrossRef]
  186. Nalis, S. Keefektifan perlakuan microwave, air panas, panas kering dan bakterisida untuk menekan infeksi Pantoea stewartii subsp. stewartii pada benih jagung manis. Master’s Dissertation, Institut Pertanian Bogor, Bogor Regency, Indonesia, 2015. [Google Scholar]
  187. Guo, Y.; Liang, Z.; Huang, H. Elimination of bacterial wilt from imported corn seeds with agricultural antibiotics. Chinese J. Biol. Control 1991, 7, 30–33. [Google Scholar]
Figure 1. Top countries for jackfruit production. Data from [8].
Figure 1. Top countries for jackfruit production. Data from [8].
Horticulturae 08 00702 g001
Figure 2. (a) Corn plant and (b) pineapple fruitlet inoculated with jackfruit-bronzing bacterium P. stewartii subsp. stewartii showing typical leaf blight symptoms and localized lesions [24]. Adapted with permission from [21].
Figure 2. (a) Corn plant and (b) pineapple fruitlet inoculated with jackfruit-bronzing bacterium P. stewartii subsp. stewartii showing typical leaf blight symptoms and localized lesions [24]. Adapted with permission from [21].
Horticulturae 08 00702 g002
Figure 3. Symptoms of jackfruit-bronzing are present on the internal fruit parts. (a) Yellowish orange to reddish discoloration of the affected pulps and rags. (b) The pulps (blue arrows) and rags (red arrows) on clean tissues before isolation. The apparent brown specks symptoms on the infected (c) pulps and (d) rags (Figures were from personal collection).
Figure 3. Symptoms of jackfruit-bronzing are present on the internal fruit parts. (a) Yellowish orange to reddish discoloration of the affected pulps and rags. (b) The pulps (blue arrows) and rags (red arrows) on clean tissues before isolation. The apparent brown specks symptoms on the infected (c) pulps and (d) rags (Figures were from personal collection).
Horticulturae 08 00702 g003
Figure 4. Host plants of the phytopathogens P. stewartii, P. stewartii subsp. indologenes, and P. stewartii subsp. stewartii. Pantoea stewartii (red dotted arrows) causes leaf blotch of Sudan grass, Stewart’s wilt of D. sanderiana and BLB of rice (O. sativa); P. stewartii subsp. indologenes (green dotted arrows) causes rot of pineapple (A. comosus), leaf spot of millets (S. italic and P. americanum), center rot disease of onion (A. cepa), leaf blight wilt of D. sanderiana and BLB of rice (O. sativa); P. stewartii subsp. stewartii (blue arrows) causes Stewart’s wilt of corn and bronzing disease of jackfruit (A. heterophyllus).
Figure 4. Host plants of the phytopathogens P. stewartii, P. stewartii subsp. indologenes, and P. stewartii subsp. stewartii. Pantoea stewartii (red dotted arrows) causes leaf blotch of Sudan grass, Stewart’s wilt of D. sanderiana and BLB of rice (O. sativa); P. stewartii subsp. indologenes (green dotted arrows) causes rot of pineapple (A. comosus), leaf spot of millets (S. italic and P. americanum), center rot disease of onion (A. cepa), leaf blight wilt of D. sanderiana and BLB of rice (O. sativa); P. stewartii subsp. stewartii (blue arrows) causes Stewart’s wilt of corn and bronzing disease of jackfruit (A. heterophyllus).
Horticulturae 08 00702 g004
Figure 5. (a) Creamy and (b) yellowish colony morphology of P. stewartii subsp. stewartii on a King’s B agar medium isolated from jackfruit (A. heterophyllus) samples suffering from a bronzing disease in Malaysia (Figures were from personal collection).
Figure 5. (a) Creamy and (b) yellowish colony morphology of P. stewartii subsp. stewartii on a King’s B agar medium isolated from jackfruit (A. heterophyllus) samples suffering from a bronzing disease in Malaysia (Figures were from personal collection).
Horticulturae 08 00702 g005
Figure 6. The phylogenomic tree depicted typical strains of Erwiniaceae and Pactobacteriaceae within the order Enterobacterales. The order is well-known as agriculture-harming phytopathogens, predominantly the genera Pantoea, Erwinia (Erwiniaceae), Pectobacterium, Dickeya, and Brenneria (Pectobacteriaceae). These clades include the species of the genera Mixta, Tatumella, Sodalis, and Lonsdalea. The causal agent of crown gall disease, Agrobacterium tumefaciens is an outgroup.
Figure 6. The phylogenomic tree depicted typical strains of Erwiniaceae and Pactobacteriaceae within the order Enterobacterales. The order is well-known as agriculture-harming phytopathogens, predominantly the genera Pantoea, Erwinia (Erwiniaceae), Pectobacterium, Dickeya, and Brenneria (Pectobacteriaceae). These clades include the species of the genera Mixta, Tatumella, Sodalis, and Lonsdalea. The causal agent of crown gall disease, Agrobacterium tumefaciens is an outgroup.
Horticulturae 08 00702 g006
Figure 7. ABC peptide transporters use the nutritional starvation condition as the main inducer for their expression, which leads to major bacterial virulence such as plant cell wall degradation, chemotaxis, intracellular survival, antimicrobial resistance, infectivity, and multiplication in host plants (red arrows). The mechanisms involving component systems regulating the expression of peptide transporters are not included in this diagram.
Figure 7. ABC peptide transporters use the nutritional starvation condition as the main inducer for their expression, which leads to major bacterial virulence such as plant cell wall degradation, chemotaxis, intracellular survival, antimicrobial resistance, infectivity, and multiplication in host plants (red arrows). The mechanisms involving component systems regulating the expression of peptide transporters are not included in this diagram.
Horticulturae 08 00702 g007
Figure 8. Genetic organization of 18 annotated T6SS gene clusters in P. stewartii subsp. stewartii SQT1; Contig 6 (VasD, ImpJ/Vas E, ImpK/Vas F, IcmF-related protein, ImpM, ImpA, ImpB, ImpC, ImpD, ImpI/Vas C, ImpE, ImpF, ImpG/Vas A, ImpH/Vas B, ClpB); contig 4 (ClpB, VgrG); contig 12 (ImpA, ImpG/Vas A, ImpH/Vas B, Pvc109). PppA, ImpA, ImpG/Vas A, and ImpH/Vas B are found on contig 6 and contig 12, while ClpB is found on contig 6 and 4.
Figure 8. Genetic organization of 18 annotated T6SS gene clusters in P. stewartii subsp. stewartii SQT1; Contig 6 (VasD, ImpJ/Vas E, ImpK/Vas F, IcmF-related protein, ImpM, ImpA, ImpB, ImpC, ImpD, ImpI/Vas C, ImpE, ImpF, ImpG/Vas A, ImpH/Vas B, ClpB); contig 4 (ClpB, VgrG); contig 12 (ImpA, ImpG/Vas A, ImpH/Vas B, Pvc109). PppA, ImpA, ImpG/Vas A, and ImpH/Vas B are found on contig 6 and contig 12, while ClpB is found on contig 6 and 4.
Horticulturae 08 00702 g008
Figure 9. Conceptual organization of the cell envelopes of Gram-negative bacteria. An outer leaflet of the asymmetric OM is composed of LPS essential for the permeability barrier’s integrity. LPS structure (blue arrow) is composed of lipid A and core oligosaccharides capped with a long O-antigen polysaccharide chain. The bacteria are covered in a CPS layer; at times, this CPS is released from the cell in large amounts as free EPS. Adapted with permission from [128]. Copyright © 2022, The Consortium of Glycobiology Editors, La Jolla, California.
Figure 9. Conceptual organization of the cell envelopes of Gram-negative bacteria. An outer leaflet of the asymmetric OM is composed of LPS essential for the permeability barrier’s integrity. LPS structure (blue arrow) is composed of lipid A and core oligosaccharides capped with a long O-antigen polysaccharide chain. The bacteria are covered in a CPS layer; at times, this CPS is released from the cell in large amounts as free EPS. Adapted with permission from [128]. Copyright © 2022, The Consortium of Glycobiology Editors, La Jolla, California.
Horticulturae 08 00702 g009
Figure 10. Potential mitigation strategies of jackfruit-bronzing disease. Cultural practices include monitoring and sanitation, disease-free seed, resistant varieties, biological control, and intercropping (red arrows). Chemical control includes bactericides, insecticides, and antibiotic treatment (blue arrows).
Figure 10. Potential mitigation strategies of jackfruit-bronzing disease. Cultural practices include monitoring and sanitation, disease-free seed, resistant varieties, biological control, and intercropping (red arrows). Chemical control includes bactericides, insecticides, and antibiotic treatment (blue arrows).
Horticulturae 08 00702 g010
Table 1. Phenotypic characterization P. stewartii subsp. stewartii.
Table 1. Phenotypic characterization P. stewartii subsp. stewartii.
TestOutcomeReference
Gram staining(-) Gram-negative, short straight rods (0.4−0.7 × 0.9−1.7 µm) [21,26,59]
Kovac’s oxidase test(-) No color change
Capsule staining(-) Non-capsulated
Endospore staining(-) Non-endospore former
Motility(-) Non-motility
Tween80 hydrolysis(-) No opaque haloes
Acetoin and indole production(-) No production
Nitrate reduction(-) No reduction
Growth on cis-aconitate(-) No growth
Acid from carbohydrates(-) Maltose, arbutin, salicin
Catalase reaction(+) Produce bubbles
Oxygen requirement(+) Facultative anaerobe
Potato test(+) Produce lesion or pit
Starch hydrolysis(+) Utilize starch in the medium
Gelatin liquefaction(+) Hydrolyze gelatin
Tobacco hypersensitivity(+) Necrosis of infiltrated tissues
Acid from carbohydrates(+) Glucose, galactose, fructose and sucrose, raffinose
Table 2. Primers and their sequences, targeted gene regions, and amplicon sizes used in single-plex PCR to identify the jackfruit-bronzing bacterium P. stewartii subsp. stewartii.
Table 2. Primers and their sequences, targeted gene regions, and amplicon sizes used in single-plex PCR to identify the jackfruit-bronzing bacterium P. stewartii subsp. stewartii.
Primer NamePrimer Sequence (5′-3)Target GeneAmplicon
Size (bp)
References
ES16
ESIG2c
GCGAACTTGGC-AGAGAT
GCGCTTGCGTGT-TATGAG
16S−23S rRNA/ITS920 [20,21,26,54]
cpsL1
cpsR2
CCTGTCAGTCTCGAACC
ATCTCGAACCGGTAACC
cpsD1100 [21,22,27,54]
hrp1d
hrp3c
GCACTCATTCCGACCAC
GCGGCATACCTAACTCC
hrpS900 [22,27,54]
fD1
rD1
AGAGTTTGATCCTGGCTCAG
AAGGAGGTGATCCAGCC
16S rRNA1500 [22,62]
Table 3. Genome features of the complete genome sequence of P. stewartii subsp. stewartii DC283 and draft genome sequence of P. stewartii subsp. stewartii SQT1.
Table 3. Genome features of the complete genome sequence of P. stewartii subsp. stewartii DC283 and draft genome sequence of P. stewartii subsp. stewartii SQT1.
StrainGenome Features
Size (bp)GC Content (%)Coding SequencesRNAsReference
P. stewartii subsp. stewartii DC2835,314,09253.85625100 [55]
P. stewartii subsp. stewartii SQT14,783,99353.7460971 [69]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ibrahim, R.; Ismail, S.I.; Ina-Salwany, M.Y.; Zulperi, D. Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit? Horticulturae 2022, 8, 702. https://doi.org/10.3390/horticulturae8080702

AMA Style

Ibrahim R, Ismail SI, Ina-Salwany MY, Zulperi D. Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit? Horticulturae. 2022; 8(8):702. https://doi.org/10.3390/horticulturae8080702

Chicago/Turabian Style

Ibrahim, Rohaya, Siti Izera Ismail, Md Yasin Ina-Salwany, and Dzarifah Zulperi. 2022. "Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit?" Horticulturae 8, no. 8: 702. https://doi.org/10.3390/horticulturae8080702

APA Style

Ibrahim, R., Ismail, S. I., Ina-Salwany, M. Y., & Zulperi, D. (2022). Biology, Diagnostics, Pathogenomics and Mitigation Strategies of Jackfruit-Bronzing Bacterium Pantoea stewartii subspecies stewartii: What Do We Know So Far about This Culprit? Horticulturae, 8(8), 702. https://doi.org/10.3390/horticulturae8080702

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop