Next Article in Journal
Volatile Oil Components of Laurel (Laurus nobilis L.) Leaves Obtained from Plants Cultivated under Salinity Stress Conditions
Previous Article in Journal
Aspects of In Vitro Plant Tissue Culture and Breeding of Asparagus: A Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Extensive Sampling Provides New Insights into Phylogenetic Relationships between Wild and Domesticated Zanthoxylum Species in China

1
College of Forestry, Northwest A&F University, Xianyang 712100, China
2
Research Centre for Engineering and Technology of Zanthoxylum State Forestry Administration, Xianyang 712100, China
3
Guizhou Academy of Forestry, Guiyang 550005, China
4
Sichuan Academy of Botanical Engineering, Neijiang 641200, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Horticulturae 2022, 8(5), 440; https://doi.org/10.3390/horticulturae8050440
Submission received: 24 March 2022 / Revised: 1 May 2022 / Accepted: 11 May 2022 / Published: 14 May 2022
(This article belongs to the Topic Plant Breeding, Genetics and Genomics)

Abstract

Zanthoxylum, belonging to the Rutaceae family, is widely distributed in tropical and subtropical regions. The genus has high economic value as spices, oils, medicinal plants, and culinary applications. Zanthoxylum has a long history of domestication and cultivation in China. However, the phylogenetic relationships and origin of wild and cultivated Zanthoxylum species in China remain largely unknown. Moreover, there is still no clear molecular phylogenetic system for Zanthoxylum species. Herein, 373 Zanthoxylum samples were collected from all presently known provenances of Zanthoxylum in China. In this study, four chloroplast DNA (cpDNA) markers (matK, ndhH, psbB, rbcL) were used to comprehensively analyze the genetic diversity, relatedness, and geographical origin of Chinese Zanthoxylum species. The results were as follows: (1) The aligned length of the four pairs of cpDNA sequences was 3836 bp, and 68 haplotypes were identified according to 219 variable polymorphic sites, including 90 singleton variable sites, 129 parsimony informative sites, 3 Indels (insertions and deletions). (2) Phylogenetic tree and haplotype network strongly supported the division of Zanthoxylum species consistent with the taxonomic recognition of five species: Z. bungeanum, Z. piasezkii, Z. piperitum, Z. armatum, and Z. micranthum. (3) Divergence time estimation suggested that Zanthoxylum genus originated from the Late Eocene, and most Zanthoxylum species diverged after the Middle Miocene. (4) Haplotype 16 (H16) was at the bottom of the phylogenetic tree, had higher haplotype diversity (Hd) and nucleotide polymorphism (Pi) than other haplotypes, and was located in the center of the network figure. Therefore, we deduced that the cultivated Zanthoxylum species may originate in Zhouqu County, Gansu Province, China. Meanwhile, our research provided a scientific basis for the identification and breeding programs of Chinese Zanthoxylum species.

1. Introduction

Zanthoxylum genus belongs to the Rutaceae family and consists of 250 species worldwide, including 45 species and 13 varieties in China [1]. Zanthoxylum is generally dioecious, but only a very few are monoecious and have apomixis characteristics [2]. The genus contains a variety of chemicals such as alkaloids, amides, flavonoids, lignans, terpenes, etc. Therefore, it is a promising source of natural insecticides [3] [4]. Therefore, it has attracted wide attention and research from domestic and foreign scholars. In addition, Zanthoxylum also contains calcium, phosphorus, iron, and other trace elements; these trace elements can form a variety of enzymes, play a very important role in human life activities, can promote the body’s metabolism, and enhance the body’s immunity (Xiong et al. 2018). Furthermore, the various parts of different Zanthoxylum species are used for making medicine to prevent toothache and treat colds, stomachache, and snake bites [5]. Meanwhile, Zanthoxylum has been used to develop new antitumor drugs [6] Guo et al. 2010). Most Zanthoxylum species have been used as spices in cooking due to the special aroma and flavor of pericarps, mainly owing to the tingling oral sensation created by alkylamines [7]. According to the China Condiment Industry Association, demand for processed Zanthoxylum products might increase by more than 20% each year, with annual demand exceeding 100,000 tons [8]. In addition, the Zanthoxylum species are suitable for planting on the mountain. It has gradually become one of the most important economic tree species in the project of converting farmland to forest in China. Hence, Zanthoxylum has high economic value and ecological value.
Z. bungeanum is native to southwestern China and has been cultivated for more than 2000 years. Wild Z. bungeanum was covered in Sichuan, Gansu, Shaanxi, Shanxi, Henan, and the mountain regions of Hunan and Hubei. To date, numerous excellent local cultivars have been cultivated during the process, such as Dahongpao (Z. bungeanum). Traditionally, the Zanthoxylum species have always been identified by their color, shape, fragrance, and mature period. For example, Z. bungeanum and Z. armatum belong to different Zanthoxylum species, but they are cultivated Zanthoxylum (Figure 1). People usually identify which species they belong to according to the color of their pericarps. However, the classification of species of Zanthoxylum is difficult when based solely on morphological characteristics. Furthermore, different Zanthoxylum species have the same name due to their similar morphological characteristics. Synonyms, homonyms, or incorrect historical records may also affect scientific research and result in financial loss. Throughout the long history of domestication and cultivation, a large number of exceptional local Zanthoxylum cultivars have been developed. At the same time, the morphological and agronomic characteristics of these Zanthoxylum cultivars also gradually began to change. Feng et al. (2016) untangled the evolutionary relationship between the group of Zanthoxylum species and inferred that Z. bungeanum and Z. armatum probably diverged during the Late Miocene, and the ancestors of Zanthoxylum first colonized Yunnan and Guizhou provinces [9]. However, there is no reasonable explanation for the origin of Zanthoxylum cultivars in China. Thus, it is necessary to understand the origin of cultivated Zanthoxylum species and the phylogenetic relationships of wild and cultivated Zanthoxylum species in China using more effective and specific methods, such as chloroplast DNA (cpDNA) markers.
The genetic properties of cpDNA are generally higher conservation than nuclear DNA and maternal inheritance in angiosperms [10], and there is a relatively high nucleic acid replacement rate in noncoding regions [11], so it is mostly used for species identification, species phylogenetic relationship research and species kinship analysis, as well as in molecular lineage geography and species origin research [12,13]. In recent years, cpDNA markers have been used extensively in systematic studies of other plants for investigating genetic relationships. For example, Wang et al. 2021 analyzed the genetic diversity of sweet potato germplasm based on three cpDNA spacer sequences, trnL-trnF, trnH-psbA, and trnT-trnL [14]. Phylogeny of Flemingia was inferred from molecular data of three cpDNA plastid markers (matK, rps16-trnQ, and psbA-trnH) [15]. The genetic diversity and population structure of the endemic species of Baikal Siberia Oxytropis triphylla, O. bargusinensis, and O. interposita were studied for the first time based on the nucleotide polymorphism of intergenic spacers psbA–trnH, trnL–trnF, and trnS–trnG of chloroplast DNA [16].
Herein, based on a wide-ranging sampling across China, we employed cpDNA markers to analyze the phylogenetic relationships between wild and cultivated Zanthoxylum species. The main objectives of this study were to: (i) estimate the genetic diversity of Zanthoxylum species and cultivars; (ii) determine the evolutionary relationships among Zanthoxylum species; (iii) resolve the geographical origin and spread routes of Chinese Zanthoxylum species.

2. Materials and Methods

2.1. Plant Materials

The fresh leaves of Zanthoxylum were collected from all presently known provenances of Zanthoxylum in China, including Gansu, Sichuan, Shandong, Shanxi, Shaanxi, Guizhou, Yunnan, and Henan. Silica gel desiccants (HG/T2765.4-2005, Qingdao Haiyang Chemical Co., Ltd., China) were used to dry the fresh leaves of Zanthoxylum. A total of 373 Zanthoxylum accessions of 103 cultivars were included in this study (Table S1). The collected samples were morphologically recognizable, and the name of each cultivar was designated by local farmers. Spatial coordinates were registered using a Global Positioning System (Table 1). ArcGIS was used to draw the sampling map (Figure 2).

2.2. DNA Extraction, PCR Amplification, and Chloroplast DNA Sequencing

The modified cetyltrimethylammonium bromide procedure was used for extracting genomic DNA from 0.070 to 0.075 g of ground leaves [17]. Four pairs of primers were selected for amplification (Table 2). Polymerase chain reaction (PCR) amplifications were carried out in 50 μL reaction mixtures containing 25 μL of 2 × Taq Master Mix (CWBIO Biotechnology Beijing Co., Ltd., China), 1.0 μL of genomic DNA (100 ng/μL), 0.5 μL of each primer (100 μmol/L), and 23 μL of double-distilled water. The conditions for PCR reactions were as follows: initial denaturation at 94 °C for 3 min; followed by 30 cycles of 30 s at 94 °C, 30 s at 56 °C (according to the optimum annealing temperature of primer), and 1.3 min at 72 °C; and then, a final extension step of 7 min at 72 °C, and 4 °C forever. PCR products were run on 0.8% agarose gels (Beijing Laibo Runke Biotechnology Co., Ltd., Beijing, China) by electrophoresis and sequenced by Tsingke Biotechnology Co., Ltd. (Xi’an, China).

2.3. Data Analyses

The sequences of all the DNA fragments with four pairs of primers (matK, ndhH, psbB, rbcL) were edited and manually aligned in Notepad++. DnaSP 6.0 software was used to examine the genetic diversity, haplotype diversity (Hd), nucleotide diversity (Pi), polymorphic variant sites, and haplotypes [18]. Subsequently, the pattern of genetic structure and evolutionary relationships among Zanthoxylum species were assessed using three different methods. The maximum-likelihood (ML) and neighbor-joining (NJ) methods with 1000 bootstrap were based on the Tamura 3-parameter model in MEGA 7 [19], and also MrBayes for Bayesian inference (BI) phylogenetic tree reconstruction, using Taddalia asiatica, Citrus limon, and Citrus sinensis as outgroups [20]. For MrBayes analysis, four chains, each with a different starting seed, were run for 10 million generations, sampling every 1000 generations. The first 4000 trees were discarded as burn-in. A 50% majority-rule consensus tree was calculated. The phylogenetic tree of haplotype was reconstructed using BEAST. The first 10% of the calculated generations were deleted as burn-in [9].
In addition, we also used DnaSP to carry out Tajima’s D and Fu’s Fs tests and used BEAST 1.8 to deduce the evolutionary relationship between 68 haplotypes [21]. In order to initialize BEAST, jModelTest and the Akaike information criterion were used to obtain the appropriate nucleotide substitution models, favoring a GTR + I + G model for each alignment. We tested whether a molecular clock could be fitted to our data by comparing the ML value with and without the molecular clock constraints implemented in MEGA7. The null hypothesis of equal evolutionary rate throughout the tree (strict molecular clock) was strongly rejected (with clock, lnL = −4890.756; without clock, lnL = −3276.201; p < 0.0001). Thus, an uncorrelated log-normal relaxed-clock model was chosen. Thus, a Yule process and an uncorrelated log-normal relaxed-clock model were treated as trees prior. We conducted five independent BEAST runs with Markov Chain Monte Carlo (MCMC) simulations of 100 million iterations with sampling every 1000 generations, following a burn-in of the initial 20% cycles. The five runs were then combined in LogCombiner. The ESS of each parameter was greater than 200. The maximum clade credibility tree (MCC) was generated with Tree Annotator 2.4, with the initial 10% of trees discarded as burn-in [22].
Genealogical relationships between cpDNA haplotypes were constructed using NETWORK v.4.2.0. 1. The program collapses sequences into haplotypes and calculates the frequencies of the haplotypes in the samples. The statistical parsimony was calculated for pairwise differences until the probability was greater than 95%. In this analysis, indels were regarded as one single character resulting from a mutation event. Finally, a neighbor-net tree was built from the concatenated dataset of 68 haplotypes with SplitsTree4. The parameters of split transformation, distance transformation, character transformation, variance, and bootstrap replicates were set to equal angle, neighbor net, uncorrected p, ordinary least squares, and 1000, respectively. Other parameters followed default settings [23].

3. Results

3.1. Sequence Characteristics and Haplotype Detection

The aligned length of the four pairs of cpDNA sequences was 3836 bp, 219 variable polymorphic sites (total number of mutations: 255), including 90 singleton variable sites, 129 parsimony informative sites, 3 Indels (insertions and deletions). Haplotype diversity (Hd) was 0.724, and nucleotide diversity (Pi) was 0.00203; Tajima’s D = −2.51347, p < 0.001; Tajima’s D = −2.51347, p < 0.001 (Table S2). 68 Haplotypes were recorded as H1–H68, with 24 Z. piasezkii (H10–H12, H14–H18, H20–H23, H25–H31, H64), 20 Z. armatum (H6, H33–H39, H41, H42, H48–H51, H54, H57, H60–H62, H68), 16 Z. bungeanum (H1–H5, H8, H13, H19, H40, H56, H58, H59, H63, H65–H67), 7 Z. piperitum (H7, H9, H43–H45, H52, H53), and 1 Z. micranthum (H55). Of the 68 haplotypes, nearly half (46/68) were unique (haplotypes that were represented by only one accession), only 9 haplotypes represented by more than 1 accession were found in multiple provinces, and the remaining 13 haplotypes were always confined to a single region. For Z. armatum, the haplotype H1 was the most numerous (193/373), including wild and cultivated Zanthoxylum accessions from all sampled provinces. H2 and H4 were cultivated Zanthoxylum, H2 was found in Gansu, and H4 was found in Sichuan provinces. H6 and H38 were derived from cultivated accessions, while only H54 was found in wild accessions. For Z. piasezkii, wild H16 was found in Gansu, and H22 was cultivated Zanthoxylum found in Sichuan provinces, but only wild H10 and H14 were found in Gansu. For Z. piperitum, H9 was mainly cultivated in Gansu and Sichuan, while others were found in Gansu or Sichuan. Additionally, other haplotypes only occurred in a single province. A great deal of regionally unique haplotypes indicated that most cultivars were probably developed directly from local wild populations, while only the elite cultivars could have the opportunity to be introduced elsewhere.

3.2. Genetic Diversity and Phylogenetic Relationships

In this study, Z. piasezkii had the highest haplotype and nucleotide diversity (Hd = 0.992, Pi = 0.00174), while Z. bungeanum had the lowest (Hd = 0.317, Pi = 0.00033) (Table S2). However, Gansu, Shanxi, and Yunnan showed the highest haplotype diversity (Hd = 1.0000) for Z. armatum, Henan harbored the highest haplotype diversity (Hd = 1.0000) for Z. bungeanum, and Sichuan harbored the highest haplotype diversity (Hd = 1.0000) for Z. piasezkii, which is probably caused by the high amount of introduced cultivars from other areas. However, the Z. bungeanum var. pubescens accessions in Sichuan and Z. piasezkii accessions in Shandong both had only one single haplotype; thus, their haplotype and nucleotide diversity were both zero. Moreover, Z. bungeanum gradually became single during the long-term cultivation process, so the level of genetic diversity of Z. bungeanum was reduced. The genetic diversity of some cultivated Zanthoxylum species was high. This may be because Zanthoxylum had started apomixis.
To confirm the phylogenetic relationship between wild and cultivated Zanthoxylum accessions, we constructed neighbor-joining (NJ) and maximum-likelihood (ML) trees [23]. The results were relatively consistent and showed that 373 Zanthoxylum samples were divided into five groups with a self-display value greater than 70% in the NJ cluster tree (Figure 3). Group I was Z. armatum, referred to as ‘Green Zanthoxylum’, including Qinghuajiao, Zhuyehuajiao, Tengjiao, Dingtanhuajiao, Shuanglingjiao, and Yaojiao. Group II was Z. micranthum, including Xiaohuahuajiao. Group III was Z. piasezkii introduced from Japan, including Goujiao, Yehuajiao, Chuanshanhuajiao, Yejiao, Yangjiao, and Niujiao. Group IV was Z. piperitum, including Putaoshanjiao, Huashanjiao, Jinlingjiao, Zhaocanghuajiao, and Meiguijiao. Group V was Z. bungeanum, which is widely cultivated in China, referred to as ‘Red Zanthoxylum’, including Dahongpao, Honghuajiao, Bayuejiao, Huangjinjiao, Meihuajiao, and Dangchanghuajiao.

3.3. Genetic Structure

To better understand the genetic structure among haplotypes, the MCC tree from BEAST analysis showed that 68 haplotypes were separated into 9 highly divergent and strongly supported clades; this result was roughly similar to the NJ and ML cluster trees (Figure 4). Clade I Z. piperitum, consisted of seven haplotypes derived from Gansu and Sichuan (H44, H53, H52, H9, H45, H7, H43). Z. piasezkii was mainly divided into four branches. Clade II included six haplotypes also derived from Gansu and Sichuan (H32, H12, H11, H24, H46, H47). Clade IV included eight haplotypes derived from Gansu, Shandong, and Sichuan (H14, H10, H64, H30, H16, H18, H15, H17). Clade VI included five haplotypes derived from Gansu (H27, H20, H25, H23, H21). Clade VIII included four haplotypes derived from Gansu (H28, H29, H26, H31). Z. bungeanum was divided into two parts, while the first part was again divided into three subclades, including ten haplotypes derived from all sampling provinces (H67, H1, H3, H63; H5, H59, H58; H4, H56, H2), and the second portion, including ten haplotypes derived from Gansu, Sichuan, and Shaanxi, namely northwest and southwest China (H40, H65; H8, H19; H13, H66). Haplotypes of Z. armatum could be mainly classified into two subclades, including 11 haplotypes derived from Shaanxi, Sichuan, Guizhou, and Gansu, namely northwest and southwest China (H61, H60, H62, H50, H48; H49, H6, H42; H35, H34, H51), and 9 haplotypes were derived from Guizhou, Sichuan, Yunnan, and Shanxi, namely north and southwest China (H38, H37, H41, H33; H39, H36, H57, H68, H54).
In addition, we provided a generation time of four years and calculated the divergence time by BEAST [24]. The results showed that the most recent common ancestor of Chinese Zanthoxylum plants was about 31.66 Ma, the most recent ancestor of the haplotypes of Zanthoxylum collected in this study was approximately 15.82 Ma (8.53–23.72), and the split between Z. piperitum and Z. piasezkii occurred an average of 8.92 Ma (3.61–15.19). Z. micranthum and Z. piasezkii occurred at approximately 3.50 Ma (0.40–7.83 Ma) (Figure 4). In Tajima’s D test, after the combination of four cpDNA regions of 373 Chinese Zanthoxylum, it was not significant at the p < 0.001 detection level, following the neutral model. To further investigate evolutionary relationships among 68 cpDNA haplotypes of Zanthoxylum accessions, we constructed a cpDNA haplotype network using NETWORK v.4.2.0.1 (Figure 5), the topology of which was perfectly consistent with the MCC tree.

4. Discussion

4.1. Effect of Human Activity on the Genetic Structure of Zanthoxylum

Due to the fact that the Chinese Zanthoxylum has extremely high medicinal and edible value in China, farmers also began to cultivate a large number of high-quality Zanthoxylum. Thus, different Zanthoxylum species were widely cultivated in different places and developed a large number of hybrids during domestication. At present, ‘Honghuajiao’ (Z. bungeanum) and ‘Qinghuajiao’ (Z. armatum) are largely cultivated in China. ‘Qinghuajiao’ is mainly cultivated in the southwest of China. The neighbor-joining (NJ) tree showed that ‘Dingtanhuajiao’ and ‘Tengjiao’ were Z. armatum. We believe that the Chinese Zanthoxylum may originate from the domestication of wild Zanthoxylum species. In addition, we found some haplotypes of Zanthoxylum existed in different provenances. Even the distance between the two provenances is very far. This result may be caused by the transplantation of Zanthoxylum by farmers. Additionally, H1 was widely distributed in all provenances, and some Zanthoxylum species also had only one haplotype (such as H3, H21, H40, and H58). This main reason was the effect of human activity. The cultivation history of Z. bungeanum was longer than Z. armatum. People have promoted the spread and exchange of genetic information in the process of transplantation and business and have thus affected the genetic structure of Zanthoxylum.
The nucleotide diversity and haplotype diversity should have decreased dramatically for cultivated populations compared with their wild ancestors in most crops [25]. We observed that Z. piasezkii had the highest haplotype and nucleotide diversity, while Z. bungeanum had the lowest (Table S2). It is possible that Z. piasezkii has a relatively short cultivation history and is mostly in the semi-wild state. Moreover, Z. bungeanum gradually became single during the long-term cultivation process, so the level of genetic diversity of Z. bungeanum was reduced. The genetic diversity of some cultivated Zanthoxylum species was high. This may be because Zanthoxylum had started apomixis. The reduction of the genetic diversity leads to weakened populations to adapt to their environment and evolutionary potential, which inevitably leads to poor population growth and makes the species critically endangered [26]. Therefore, it is urgent and important to strengthen the protection of wild Zanthoxylum.
Zanthoxylum is generally dioecious, but only a very few are monoecious and have apomixis characteristics (Fei 2021). However, it remains unclear whether Zanthoxylum can perform sexual reproduction. Our study was based on the collection of plant material carried out in situ germplasm. Although Z. bungeanum is widely distributed in China, most are cultivated Zanthoxylum. Z. bungeanum has few natural populations or is distributed in remote areas. This leads to the few wild germplasm that we can collect and makes sampling very difficult. Therefore, the results of this study may deviate from reality, and cannot fully reflect the genetic diversity of Zanthoxylum germplasm resources in China. Thus, we should continue to expand the sampling range in the future, and collect as many wild Zanthoxylum as possible.

4.2. The Origin of Cultivated Zanthoxylum Species

Moreover, the evolutionary network of haplotypes used in this study was an efficient approach that can be used to recover the directions of haplotypes transmissions at the local scale and spread at the larger scale, and particularly to identify the central haplotype that can be considered as the ancestral or founding haplotype [27]. Generally, ancestral or founding haplotypes are usually located at the center node of groups and are more frequently distributed. H1, H4, H16, H54, and H38 were the torso of the network figure, mainly distributed in Gansu and Sichuan. H16 was the center of the haplotype network, located in Zhouqu County, Gansu Province (Figure 5). Therefore, we inferred that ‘Honghuajiao’ (Z. bungeanum) may be distributed at the junction of Gansu and Sichuan provinces, greatly cultivated for the good shape and bright red color, and H16 was the center of origin of Chinese Zanthoxylum. This inference was the same as data that Gansu was the producing area of Chinese Zanthoxylum and concentrated in Tianshui, Longnan, and Wudu [28] [29]. H1 was derived from H16 and occurred in Gansu, Sichuan, Shaanxi, Shandong, Shanxi, Sichuan, Guizhou, and Yunnan. Given the geographic proximity, H1 most probably appeared first in Gansu and was introduced eastward by farmers. H38 originated in Gansu, Sichuan, and Yunnan and was derived directly from H16. In particular, Zhouqu belongs to Gannan Tibetan Autonomous Prefecture and is located in the southwest of Gansu Province. It connects between Tibet Plateau and Loess Plateau, Aba Prefecture in the south, and Longnan City and Linxia Prefecture in the east and north [30]. Zanthoxylum has a wide distribution range in China, and the continuous geographical distribution may increase the dispersal of seed and pollen flow between provenances. Thus, Zanthoxylum has a high level of genetic diversity.
We inferred that the cultivated Zanthoxylum species may originate in Zhouqu County, Gansu Province, and Zanthoxylum may expand from west to east in China. Historically, Gansu was a producing area of Chinese Zanthoxylum [31]. Meanwhile, the Qinghai–Tibet Plateau is located in the southwest of Gansu Province. It is known as the ‘roof of the world’ and the ‘third pole’ of the earth and is the largest, highest, and youngest plateau in the world [32]. Additionally, the Qinghai–Tibet Plateau is also one of the global hot spots of biodiversity and an important ‘gene bank’ for plant resources in China [33]. The climate change of the ancient Mediterranean since the Tertiary and the uplift of the Qinghai–Tibet Plateau has caused a change in the distribution pattern of the ancient Mediterranean flora and even the global plants (Sun and Li 2003). It has been shown that the Chinese Zanthoxylum existed in the Late Cretaceous–Eocene plant flora in the early stages of the Qinghai–Tibet Plateau [34].
According to the analysis of BEAST, we found that the Chinese Zanthoxylum originated from at least the Late Eocene, and the most recent ancestor of the haplotypes of Zanthoxylum collected in this study was approximately the Middle Miocene. As early as 1985, Hongrong has already proposed that the Chinese Zanthoxylum was originally wild and cultivated in the Qinghai–Tibet Plateau [35]. Therefore, we inferred that the Chinese Zanthoxylum plants may originate from the Qinghai–Tibet Plateau.

5. Conclusions

Zanthoxylum genus has come to be a very valuable genus to the discovery and utilization of medicinal and agrochemical natural products. Sampling covered the main distribution regions of Chinese Zanthoxylum and was enough to represent the genetic resources of Chinese Zanthoxylum. According to the historical records, combined with the genetic structure, genetic diversity, and haplotype distribution characteristics, we inferred that cultivated Zanthoxylum species originated in Zhouqu County, Gansu Province, China, and Chinese Zanthoxylum originated from Z. piasezkii. Based on the ancestral divergence time of the cpDNA molecular level, we speculated that Zanthoxylum originated at least in the middle Tertiary Miocene, and the neutral test of cpDNA fragments indicated that the Zanthoxylum population did not undergo a significant expansion process. This result is consistent with the findings of Gregor, who expounded that Zanthoxylum first appeared in the Eocene–Cretaceous Period [36]. Thus, Zanthoxylum may be affected by the uplift, the Quaternary glacial period, and anthrogenic activities, expanding from west to east in China [36]. Therefore, we provided evidence for the origin of Zanthoxylum species in the Qinghai–Tibet Plateau of the southwest.
We should protect the natural wild Zanthoxylum, which was distributed in different regions, and the cultivated species of Chinese Zanthoxylum with excellent characteristics. We can take measures to combine local and ex situ protection, strengthen management, and reduce the interference of human activities. At the same time, we should also collect as many of the wild Zanthoxylum species as possible. These will be conducive to protecting the genetic diversity of Chinese Zanthoxylum.
However, the origin of Chinese Zanthoxylum was analyzed only based on the evidence of the existing population genetic diversity and the geographical distribution of germplasm resources combined with geohistorical data. This study can only be an initial guess. Chinese Zanthoxylum remains to be studied deeply to provide new insights into the phylogenetic relationships between wild and cultivated Zanthoxylum species in China.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae8050440/s1, Table S1: List of Zanthoxylum accessions used in this study; Table S2: Haplotype composition, genetic diversity (Hd), nucleotide diversity (Pi), Tajima’s D, and Fu’s Fs of 373 accessions of Zanthoxylum. Figure 3 Neighbor-joining (NJ) tree of 373 wild and cultivated Zanthoxylum accessions based on the cpDNA sequences. Figure 4 The maximum clade credibility tree (MCC) was generated based on the dataset of 68 cpDNA haplotypes of 373 Zanthoxylum accessions. Figure 5 Median - joining network of 68 cpDNA haplotypes of Zanthoxylum.

Author Contributions

Conceptualization, X.C. and L.T.; methodology, S.F.; software, J.T.; validation, X.C. and L.T.; formal analysis, S.F.; investigation, G.W. and X.G.;resources, A.W.; data curation, X.C.; writing—original draft preparation, X.C.; writing—review and editing, X.C.; visualization, X.C.; supervision, A.W. and S.F.; project administration, A.W.; funding acquisition, A.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by [Technology Innovation Leading Program of Shaanxi] grant number [2020QFY07-01] and Biosafety and Genetic Resource Management Project grant number [KJZXSA202025].

Institutional Review Board Statement

We choose to exclude this statement and the study did not require ethical approval.

Informed Consent Statement

The study did not involve humans.

Data Availability Statement

We choose to exclude this statement and the study did not report any data.

Acknowledgments

This work was supported by the Technology Innovation Leading Program of Shaanxi (2020QFY07-01), the Biosafety and Genetic Resource Management Project (KJZXSA202025), Project Supported by the Department of Science and Technology of Guizhou Province ([2021]222), and the Guizhou Kehe Platform Talent ([2019]5643). We would like to thank Yinming Wu and his team at the Sichuan Academy of Botanical Engineering, Zongxing Wu, and Hui Xu of the Sichuan Academy of Forestry for help with sampling.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Li, W. Research progress of analysis of odor consitituents in Zanthoxylum bungeanum Maxim. China Food Addit. 2021, 32, 192–196. [Google Scholar] [CrossRef]
  2. Fei, X.T. Analysis of Apomixis Characteristics and Functional Verification of Key Genes in Zanthoxylum bungeanum; Northwest A&F University: Yangling, China, 2021. [Google Scholar]
  3. Xi, S.Y.; Guo, Y.X.; Ma, X.H.; Zhan, Z.L.; Jin, L. Research progress on chemical constituents and pharmacological effects of Zanthoxylum. West China J. Pharm. Sci. 2021, 36, 717–722. [Google Scholar] [CrossRef]
  4. Yang, X.F.; Long, Y.Y.; Wu, Y.; Ma, Y.M. Recent progress in research on active componets of Zanthoxylum L. Food Sci. 2017, 39, 303–312. [Google Scholar] [CrossRef]
  5. Lou, J.R.; Zheng, Z.F.; Li, Y.; Wang, W.X.; Yuan, C. Progress on anti-infectious activities of plants from genus Zanthoxylum. Chin. Tradit. Herb. Drugs 2018, 49, 5477–5484. [Google Scholar] [CrossRef]
  6. Yuan, H.M.; Peng, C.; Song, Y.; Zhou, C.; Huang, X.; Zhang, Y. Research progress on repellent activities of Zanthoxylum plants. Chin. J. Hyg. Insectic. Equip. 2021, 27, 569–577. [Google Scholar] [CrossRef]
  7. Pan, S.X.; Pu, B.; Fu, B.N.; Jiang, P.J. Research progress in the sensory classification and detection of numb-taste components of Zanthoxylum. Sci. Technol. Offood Ind. 2017, 38, 347–351. [Google Scholar] [CrossRef]
  8. Zhang, M.; Ma, Y.F.; Ge, B.G.; Sun, M.; Zhao, Y.; Zhu, W.T. Optimization Extraction Process of Pepper Seed Oil. China Fruit Veg. 2017, 37, 1008–1038. [Google Scholar] [CrossRef]
  9. Feng, S.; Liu, Z.; Chen, L.; Hou, N.; Yang, T.; Wei, A. Phylogenetic relationships among cultivated Zanthoxylum species in China based on cpDNA markers. Tree Genet. Genomes 2016, 12, 45. [Google Scholar] [CrossRef] [Scilit]
  10. Shaw, J.; Shafer, H.L.; Leonard, O.R.; Kovach, M.J.; Schorr, M.; Morris, A.B. Chloroplast DNA sequence utility for the lowest phylogenetic and phylogeographic inferences in angiosperms: The tortoise and the hare IV. Am. J. Bot. 2014, 101, 1987–2004. [Google Scholar] [CrossRef] [Scilit]
  11. Wang, R.S.; Wei, X.; Cao, L.R.; Qiao, W.H.; Zhang, W.X.; Yang, Q.W. Origin and evolution of cultivated rice (O. sativa L.) in China based on gene diversity of chloroplast genome. J. Plant Genet. Resour. 2011, 12, 686–693. [Google Scholar] [CrossRef]
  12. Badenes, M.L.; Parfitt, D.E. Phylogenetic relationships of cultivated Prunus species from an analysis of chloroplast DNA variation. Theor. Appl. Genet. 1995, 90, 1035–1041. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Xu, D.H.; Abe, J.; Kanazawa, A.; Gai, J.Y.; Shimamoto, Y. Identification of sequence variations by PCR-RFLP and its application to the evaluation of cpDNA diversity in wild and cultivated soybeans. Theor. Appl. Genet. 2001, 102, 683–688. [Google Scholar] [CrossRef] [Scilit]
  14. Wang, C.; Jiao, C.H.; Yang, X.S.; Zhang, W.Y.; Lei, J.; Chai, S.S.; Wang, L.J.; Tian, X.H. Genetic diversity analysis of sweet potato based on chloroplast genes trL-trnF, trnH-psbA and trnT-trnL sequences. J. South Agric. 2021, 52, 1536–1544. [Google Scholar] [CrossRef]
  15. Van Do, T.; Xu, B.; Gao, X.-F. Molecular phylogeny and character evolution of Flemingia (Leguminosae, Papilionoideae, Phaseoleae, Cajaninae) inferred from three cpDNA and nrITS sequence data. Oesterreichische Bot. Z. 2021, 307, 30. [Google Scholar] [CrossRef] [Scilit]
  16. Kholina, A.B.; Kozyrenko, M.M.; Artyukova, E.V.; Sandanov, D.V. Modern State of Populations of Endemic Oxytropis Species from Baikal Siberia and Their Phylogenetic Relationships Based on Chloroplast DNA Markers. Russ. J. Genet. 2018, 54, 805–815. [Google Scholar] [CrossRef] [Scilit]
  17. Porebski, S.; Bailey, L.G.; Baum, B.R. Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Mol. Biol. Rep. 1997, 15, 8–15. [Google Scholar] [CrossRef] [Scilit]
  18. Zheng, X.Y.; Cai, D.Y.; Daniel, P.; Joseph, P.; Liu, J.; Teng, Y.W. Phylogeny and evolutionary histories of Pyrus L. revealed by phylogenetic trees and networks based on data from multiple DNA sequences. Mol. Phylogenetics Evol. 2014, 80, 54–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets Molecular. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Scilit]
  20. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572–1574. [Google Scholar] [CrossRef] [Scilit]
  21. Drummond, A.J.; Rambaut, A. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol. Biol. 2007, 7, 214. [Google Scholar] [CrossRef] [Scilit]
  22. Feng, S.; Niu, J.; Liu, Z.; Tian, L.; Wang, X.; Wei, A. Genetic Diversity and Evolutionary Relationships of Chinese Pepper Based on nrDNA Markers. Forests 2020, 11, 543. [Google Scholar] [CrossRef] [Scilit]
  23. Gao, Y.; Wang, D.J.; Wang, K.; Cong, P.H.; Zhang, C.X.; Li, L.W.; Piao, J.C. Chloroplast DNA variation and genetic evolution of Malus sieversii (Ledeb.) M. Roem. J. Ofplant Genet. Resour. 2020, 21, 579–587. [Google Scholar] [CrossRef]
  24. Bandelt, H.J.; Forster, P.; Rohl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 1999, 16, 37–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Doebley, J.F.; Gaut, B.S.; Smith, B.D. The Molecular Genetics of Crop Domestication. Cell 2006, 127, 1309–1321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Wei, F.; Zhang, G.R.; Qin, Y.X.; Liu, F.Q.; Tang, S.Q. genetic diversity at chloroplast microsatellites (cpSSR) in Abies fanjingshanensis and A. yuanbaoshanensis. Guihaia 2014, 34, 596–600. [Google Scholar]
  27. Pusadee, T.; Jamjod, S.; Chiang, Y.; Rerkasem, B.; Schaal, B.A. Genetic structure and isolation by distance in a landrace of Thai rice. Proc. Natl. Acad. Sci. USA 2009, 106, 13880–13885. [Google Scholar] [CrossRef] [Scilit]
  28. Jiang, L.; Pan, C.H. Study on the distribution and use of Zanthoxylum since Ming and Qing Dynasties-focuses on local Chronicles. China Local Rec. 2019, 84–95+127. [Google Scholar]
  29. Crandall, K.; Templeton, A. Empirical tests of some predictions from coalescent theory with applications to intraspecific phylogeny reconstruction. Genetics 1993, 134, 959–969. [Google Scholar] [CrossRef] [Scilit]
  30. Hang, S.U.N. Tethys Retreat and Himalayas-Hengduanshan mountains uplift and their significance on the origin and development of the Sino-Himalayan elements and Alpine flora. Acta Bot. Yunnanica 2002, 24, 273–288. [Google Scholar] [CrossRef]
  31. Wang, M.; Shi, Y.; Dong, L.J. Germplasm resources and cultivation research of Zanthoxylum bungeanum. Heilongjiang Sci. 2021, 12, 96–97. [Google Scholar]
  32. Zhang, Y.; Wang, J.L.; Xia, M.Z.; Zhang, F.Q. Phylogeography of Populus cathayana from the Qinghai-Tibetan Plateau based on cp DNA sequence. J. Biol. 2020, 37, 45–49. [Google Scholar]
  33. Deng, T.; Wu, F.; Su, T.; Zhou, Z.K. Tibetan Plateau—Evolutionary hub of modern biodiversity formation. Sci. Sin. 2020, 50, 177–193. [Google Scholar]
  34. Mai, D.H. Development and regional differentiation of the European vegetation during the Tertiary. Plant Syst. Evol. 1989, 162, 79–91. [Google Scholar] [CrossRef] [Scilit]
  35. Lin, H.R. Preliminary study on the history of Zanthoxylum. J. Sichuan For. Sci. Technol. 1985, 69–73. [Google Scholar] [CrossRef]
  36. Sun, H.; Li, Z.M. Qinghai-Tibet Plateau uplift and its impact on Tethys flora. Adv. Earth Sci. 2003, 18, 852. [Google Scholar] [CrossRef]
Figure 1. Photograph of Zanthoxylum. (A) The fruits of Z. bungeanum; (B) the fruits of Z. armatum.
Figure 1. Photograph of Zanthoxylum. (A) The fruits of Z. bungeanum; (B) the fruits of Z. armatum.
Horticulturae 08 00440 g001
Figure 2. Distribution of 373 Zanthoxylum samples in 23 sampling sites in China. Small filled yellow circles represent the sampling site.
Figure 2. Distribution of 373 Zanthoxylum samples in 23 sampling sites in China. Small filled yellow circles represent the sampling site.
Horticulturae 08 00440 g002
Figure 3. Neighbor-joining (NJ) tree of 373 wild and cultivated Zanthoxylum accessions based on the cpDNA sequences.
Figure 3. Neighbor-joining (NJ) tree of 373 wild and cultivated Zanthoxylum accessions based on the cpDNA sequences.
Horticulturae 08 00440 g003
Figure 4. The maximum clade credibility tree (MCC) was generated based on the dataset of 68. cpDNA haplotypes of 373 Zanthoxylum accessions. Taddalia asiatica, Citrus limon, and Citrus sinensis were used as outgroups. Posterior probabilities based on maximum-likelihood (ML) analysis are labeled above nodes. Blue bars represent the 95% highest posterior density (HPD) credibility intervals for node ages (in Myr ago, Ma).
Figure 4. The maximum clade credibility tree (MCC) was generated based on the dataset of 68. cpDNA haplotypes of 373 Zanthoxylum accessions. Taddalia asiatica, Citrus limon, and Citrus sinensis were used as outgroups. Posterior probabilities based on maximum-likelihood (ML) analysis are labeled above nodes. Blue bars represent the 95% highest posterior density (HPD) credibility intervals for node ages (in Myr ago, Ma).
Horticulturae 08 00440 g004
Figure 5. Median-joining network of 68 cpDNA haplotypes of Zanthoxylum accessions.
Figure 5. Median-joining network of 68 cpDNA haplotypes of Zanthoxylum accessions.
Horticulturae 08 00440 g005
Table 1. Areas of sample collection along with GPS data and altitudinal information.
Table 1. Areas of sample collection along with GPS data and altitudinal information.
ProvinceCitiesLatitude/NLongitude/EElevation/m
GansuTianshui34.54105.821399.38
Longnan33.46104.961284.08
Tibetan Autonomous Prefecture of Gannan33.72104.262291.82
Hui Autonomous Prefecture of Linxia35.73103.121836.13
SichuanYa’an29.68102.392025.83
Leshan29.56103.76365.01
Neijiang29.58105.06335.00
Aba Tibetan and Qiang Autonomous Prefecture 31.76103.752113.09
Chengdu30.68103.60514.91
Meishan29.93103.44464.66
GuizhouLiupanshui26.04104.931446.93
Qianxinan Buyi and Miao Autonomous Prefecture 25.96105.001477.01
ShaanxiWeinan35.44110.211027.83
Baoji33.97106.661243.09
Yulin39.04111.10934.21
ShandongLinyi35.71118.09313.53
Zaozhuang34.89117.69197.16
Laiwu36.21117.68197.17
ShanxiXinzhou39.02113.611875.00
Yangquan38.09113.41948.36
YunnanKunming25.04102.672112.25
Yuxi24.44102.981643.95
HenanSanmenxia34.74111.81476.00
Table 2. Information of four pairs of cpDNA primers in this study.
Table 2. Information of four pairs of cpDNA primers in this study.
Primer NameForward Primer (5′-3′)Reverse Primer (5′-3′)Length
matKMF:CAACACGACTTCCTATACCCACMR:CAAATACCAAATCCGCCCTC1100 bp
ndhHNF:TATCTGCCTTATGTAACCCGTTGNR:TTTTGGGGCTTCTACTCTCAC816 bp
psbBPF:TATCGTGTTCATACCGTCGTPR:CGTGTCCAAAAGTAAACCAG1351 bp
rbcLRF:CACAAACAGAGACTAAAGCGRR:CAAAGATCTCGGTCAAAGCA1200 bp
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Chen, X.; Tian, L.; Tian, J.; Wang, G.; Gong, X.; Feng, S.; Wei, A. Extensive Sampling Provides New Insights into Phylogenetic Relationships between Wild and Domesticated Zanthoxylum Species in China. Horticulturae 2022, 8, 440. https://doi.org/10.3390/horticulturae8050440

AMA Style

Chen X, Tian L, Tian J, Wang G, Gong X, Feng S, Wei A. Extensive Sampling Provides New Insights into Phylogenetic Relationships between Wild and Domesticated Zanthoxylum Species in China. Horticulturae. 2022; 8(5):440. https://doi.org/10.3390/horticulturae8050440

Chicago/Turabian Style

Chen, Xue, Lu Tian, Jieyun Tian, Gang Wang, Xia Gong, Shijing Feng, and Anzhi Wei. 2022. "Extensive Sampling Provides New Insights into Phylogenetic Relationships between Wild and Domesticated Zanthoxylum Species in China" Horticulturae 8, no. 5: 440. https://doi.org/10.3390/horticulturae8050440

APA Style

Chen, X., Tian, L., Tian, J., Wang, G., Gong, X., Feng, S., & Wei, A. (2022). Extensive Sampling Provides New Insights into Phylogenetic Relationships between Wild and Domesticated Zanthoxylum Species in China. Horticulturae, 8(5), 440. https://doi.org/10.3390/horticulturae8050440

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop