Taxonomical, Molecular and Phytochemical Characterization of an Endangered Medicinal Plant Species Gathered from the Puebla-Tlaxcala Valley in Mexico

Abstract

Despite the wide and accepted implementation of contemporary pharmaceutical medicine, the use of medicinal plants still prevails in several regions around the world, including Mexico. According to the World Health Organization (WHO), the use of incorrect species in natural and complementary medicine is a threat to consumer safety. Therefore, there is a need to characterize properly those plant species used in traditional medicine. In this study, a medicinal plant called Calanca, which is traded in the local market of a small community within the State of Puebla (Mexico), was characterized by different approaches. Conventional and molecular taxonomy analyses showed that Calanca belonged to the Asteraceae family, genus Chrysactinia. On one hand, molecular markers (rbcL, matK and ITS) helped to identify Calanca at the species level, being identified as C. mexicana. On the other hand, although not used for molecular taxonomy, additional gene markers were amplified and submitted to the GenBank database to expand the toolkit for C. mexicana identification. In addition, soil taxonomy and quantitative chemical analyses provided insights into the relationship between growing conditions and the chemical compounds produced by C. mexicana. Chemical compounds associated with medicinal properties such as phenolic acids, flavonoids, terpenes, and anthocyanins were identified in C. mexicana extracts. Finally, greenhouse conditions for the cultivation of this species were also investigated. Overall, this comprehensive characterization provides the essential botanical and chemical foundation required for future toxicological and clinical safety assessments, while establishing a robust framework for the long-term conservation of this endangered medicinal resource.

1. Introduction

The use of plants for healing has been a practice since the origin of human civilization. Mesopotamian, Chinese and Indian writings are among the oldest descriptions of medicinal plants’ usage for the treatment of ailments [1]. According to the World Health Organization (WHO), medicinal plants can be defined as those that possess therapeutic properties or exert beneficial pharmacological effects on the human or animal body [2,3]. Nowadays, despite the wide and accepted implementation of contemporary pharmaco-medicine, the use of medicinal plants still prevails in several regions around the world. Whether used in the form of infusions, crude extracts or purified extracts obtained from fresh or dried parts of the medicinal plant (root, stem, wood, bark, leaves, flowers, fruits, seeds or, in some cases, whole plants), herbal remedies serve as an alternative and/or complementary approach to Western medicine [1]. It is estimated that, among the total plant species on earth, around 12–18% are valuable sources of herbal products and thereby used for medicinal purposes [4,5]. Most members of the Asteraceae family, for instance, have therapeutic applications thanks to their anti-inflammatory, antimicrobial, antioxidant and hepatoprotective activities [6]. These pharmacological effects can be attributed to a wide range of phytochemical compounds such as polyphenols, phenolic acids, flavonoids, acetylenes and triterpenes [7]. In this sense, interest and attention to medicinal plants compounds have been renewed given the diminished efficacy of synthetic drugs and the frequent contraindications associated with their usage.

In Mexico, there is rich tradition of using medicinal plants that predates European conquest. Native plants, as well as many other species introduced from diverse parts of the world, make Mexico’s medicinal herbal repertoire one of the most diverse, containing approximately 3000 to 5000 plants [8,9]. The plant known as Calanca (also known as false Damiana) is an endemic species of Mexico that belongs to the genus Chrysactinia (C. mexicana) [10]. Although six species of the Chrysactinia genus have been identified [11], C. mexicana is known for its drought tolerance and its wonderfully aromatic foliage after crushing its leaves. This plant species is distributed in central and northeastern Mexico, and it is the most characterized species from the Chrysactinia genus [11,12]. However, Calanca can be confused very easily with true Damiana (Turnera diffusa) by non-expert eyes [13]. Although both plant species share some chemical similarity, T. diffusa has been mainly associated with stimulating sexual activity in different experimental models [14,15]. In the case of Calanca (C. mexicana), it is a perennial plant that reaches up to 80 cm in height, showing leaves with an intense dark green color, elongated, lanceolate and slightly toothed margins. Moreover, Calanca is locally used as part of natural and complementary medicine (NCM) because it is attributed to having properties such as diuretic, spasmolytic and stimulant. Thereby it is commonly used to treat respiratory diseases, skin infections and rheumatism [16].

In that sense, the phytochemical profile and biological activity of C. mexicana have been determined for some compounds. Oral administration of the aqueous extract of C. mexicana (10 mg/kg), for example, resulted in an antidepressant effect in mice. Such effect was attributed to caffeic, coumaric and ferulic acid [17]. In another case, the antispasmodic effect of C. mexicana was validated in rabbit ileum, where authors of the study attributed the antispasmodic effect to piperitone, eucalyptol and alpha-terpineol [18]. Similarly, Medina-de la Cruz and co-workers found that the same set of phytochemicals, plus delta-3-carene and linalool, exhibited an antimicrobial activity in vitro against S. cerevisiae (3.71 mg/mL) and C. glabrata (4.64 mg/mL) [19]. Altogether, these examples support previous studies that have shown the potential of C. mexicana to be used as part of NCM [16,20,21].

However, precisely due to its popular medicinal use, Calanca is currently facing overexploitation [22]. For instance, an increased use by local people, as well as the negative effects of climate change, has put its population at risk in the Puebla-Tlaxcala Valley. This convergence of anthropogenic overexploitation and the impacts of climate change have significantly threatened the wild populations of Calanca within a small community of the State of Puebla, Mexico, in which local populations continue to rely heavily on medicinal plants as a primary resource for healing various illnesses. Moreover, considering the morphological similarity between Calanca and related species in the Asteraceae family, its misidentification represents a direct hazard to traditional medicine consumers [23]. Consequently, there is a need to establish a comprehensive botanical and phytochemical fingerprint to ensure the authenticity and sustainable use of this endangered resource.

In this study, the Calanca plant from a small community called Tecali de Herrera was characterized at taxonomical, molecular, edaphic and phytochemical levels, not only for the purpose of safeguarding consumers through precise botanical validation but also providing its metabolic profile, as well as assessing the conditions for its greenhouse thriving. The novelty of this study lies in the multidisciplinary integration of botanical validation, multi-locus DNA barcoding, soil taxonomy, and phytochemical profiling of this endangered species, providing a framework for its safe medicinal use and sustainable cultivation in the future.

2. Material and Methods

2.1. Sampling of Plant Material and Soil Analysis

Plant samples were collected during June 2022, September 2023 and September 2024 in the surroundings of Tecali de Herrera, located at an altitude of 2180 m above sea level, with geographical coordinates of 18°55′42′′ N, 97°58′23′′ W (Figure 1A). This being an herbaceous plant, collected samples included the whole plant, namely, roots, stems, branches, leaves and flowers. Images of plant specimens were captured via smartphone camera at a maximum resolution of 1920 × 1080 px (Figure 1). Some collected plants were mounted onto paper and sent to the Genetics and Environment Research Center of the Autonomous University of Tlaxcala, under herbarium number 9304. Additional samples were stored for molecular characterization and phytochemical analysis, whereas a set of plants were designated for propagation in a greenhouse. Plants were collected from a hot and dry site with rugged terrain, primarily in ravines and on hill slopes (Figure 1A). Following the zig-zag method, soil samples were collected using a shovel at a depth of 20 cm (about 7 in), which corresponded to the root zone. Several subsamples were taken along the transect and combined to form a composite sample, which was subsequently homogenized and air-dried at room temperature. Standard analytical procedures were used to determine key fertility parameters, including pH, organic matter content, electrical conductivity, available phosphorus, exchangeable cations and texture classification, following the guidelines of soil analysis protocols [24].

2.2. Taxonomic Characterization

Taxonomic identification based on morphological characteristics was carried out following the methodology published by [11,25]. Features such as plant size, shape and size of leaves, presence of glands on leaves, inflorescences’ shape and fruits, among other characteristics, were considered for taxonomic identification and deposited in the Autonomous University of Tlaxcala collection.

2.3. Extraction of Total DNA and DNA Barcoding

Harvested leaves from plant samples were washed with simple distilled water and quickly stored at −80 °C. DNA was extracted from ground leaves (50 mg) following the CTAB method [26]. The polymerase chain reaction (PCR) technique was used to amplify a single nuclear gene (ITS) and two plastid genes (matK and rbcL) as molecular markers. Oligonucleotide sequences, as well as the expected size of PCR products, are shown in

Table 1. Oligonucleotides used to amplify DNA markers in this study.

Target Gene	Oligonucleotide Sequence	Expected PCR Product (bp)	Reference
matK	FW 5′ CGTACAGTACTTTTGTGTTTACGAG 3′	850	[27]
	RV 5′ ACCCAGTCCATCTGGAAATCTTGGTTC3′
ITS	FW 5’ TATGCTTAAAYTCAGCGGGT 3′	628	[28]
	RV 5’ AACAAGGTTTCCGTAGGTGA 3′
rbcL	FW 5’ ATGTCACCACAAACAGAGACTAAAGC 3′	550	[29]
	RV 5′ GTAAAATCAAGTCCACCRCG 3′
trnH-psbA	FW 5′ CGCGCATGGTGGATTCACAATCC 3′	550	[30]
	RV 5′ GTTATGCATGAACGTAATGCTC 3′
trnK-rps16	FW 5′ TACTCTACCATTGAGTTAGCAAC 3′	645	[31]
	RV 5′ AAAGGTGCTCAACCTACAAGAAC 3′
rpoC1	FW 5′ GGCAAAGAGGGAAGATTTCG 3′	550	[29]
	RV 5′ CCATAAGCATA TCTTGAGTTGG 3′
trnLP6	FW 5′ CGAAATCGGTAGACGCTACG 3′	653	[32]
	RV 5′ GGGGATAGAGGGACTTGAAC 3′

. PCR fragments were visualized by agarose gel electrophoresis (1%), stained with Midori Green Advance DNA Stain © NIPPON Genetics EUROPE GmbH dye. PCR products were purified using the Zymo Research Corporation DNA Clean & Concentrator-5 Purification Kit (Zymo Research, Irvine, CA, USA)) following the protocol provided by the manufacturer. Then, gel-extracted PCR products were sequenced in both directions by the Sanger method used at the Potosinian Institute for Scientific and Technological Research (IPICYT).

2.4. Multiple Sequence Alignment and Phylogenetic Analysis

For molecular identification and the assessment of genetic relationships, the PCR-amplified and sequenced loci of ITS, matK and rbcL were aligned against sequences in the National Centre of Biotechnology Information (NCBI) database [33]. Furthermore, plant species close to Calanca, as well as relatively distant plant species, were selected to perform an alignment using Clustal W algorithm implemented on the software package MEGA 12 (v12.0.11) [34]. Plant species included in the genetic distance and phylogenetic analyses were selected according to the tree developed by [35], choosing plant species belonging to families in the same order as C. mexicana (Asterales), as well as distant plant family members. In that sense, Chrysactinia pinnata (Asteraceae) and Flaveria ramosissima (Asteraceae) were used as relatively close plant species to C. mexicana, whereas Trachelium caeruleum (Campanulaceae), Solanum lycopersicum (Solanaceae) and Arabidopsis thaliana (Brassicales) were used as relatively distant plant species. Pteridium aquilinum (Dennstaedtiaceae), a pteridophyte, was included as an outgroup (Table S1). Phylogenetic trees were constructed using the neighbor-joining method, using MEGA 12 software [34]. Branch support was calculated using 2000 bootstrap replicates for each DNA barcode-derived phylogenetic tree.

2.5. Phytochemical Extraction

Phytochemicals from leaves of Calanca were extracted by consecutive maceration using solvents of increasing polarity, namely, hexane (H), then dichloromethane (DM) and finally methanol (M) in a solid–liquid ratio of 1:10. Then, solvents were evaporated under reduced pressure to dryness using a Büchi evaporator (model R-3 with peristaltic pump model V-700). The plant extracts, from now on referred to as H, DM and M, were filtered using a 0.20-μm nylon Whatman membrane [36]. The extracts obtained from Calanca were stored at 4 °C until the flow injection analysis–Fourier transform ion cyclotron resonance mass spectrometry (FIA-ESI-FT ICR-MS) analysis was carried out.

2.6. Phytochemical Analysis Through Mass Spectrometry

The phytochemical composition of Calanca extracts was performed by a FIA-ESI-FT ICR-MS analysis [37]. Ultrahigh-resolution mass spectra (MS) were acquired on a Solarix XR 7T (Bruker, Bremen, Germany), which was calibrated in positive and negative electrospray ionization (ESI) mode using sodium trifluoroacetate as the standard. Extracts were diluted with methanol HPLC (1:10) and injected into the instrument with a Hamilton 250 μL syringe at a flow rate of 120 μL/h by positive and negative ESI (3500 V, 2499 nA capillary; −500 V, 38.309 nA end plate offset, 8 M resolving power). Full-scan MS data were acquired over an m/z range of 50–2000, with 24 average scans and 0.1 Accum (s). The source gas tune was N₂, at 0.6 bar nebulization, with 4 L/min dry gas and a dry temperature of 200 °C. Data Analysis v.6.0 was used for analysis of the generated data [37]. The structural formulas of Calanca phytochemicals were obtained using the ChemSpider database, whereas their theoretical m/z was obtained using Bruker Compass MetaboScape 2022 b v.9.0.1.

2.7. Greenhouse Surviving Evaluation and Seed Germination of Calanca Plants

Calanca plants collected in June 2022 (n = 10), September 2023 (n = 20) and 2024 (n = 20), were transplanted with an intact rhizosphere into 40 L pots. Native soil was used in this process. Acclimatization was carried out in a shade-house greenhouse condition. Seeds were obtained in June 2022, July 2023 and April 2024, followed by germination assays on moist filter paper under controlled temperature for 7 days; viability was determined by tetrazolium staining and microscopy. Germination and viability data were analyzed with ANOVA and Tukey’s test (p < 0.05).

3. Results

3.1. Plant and Soil Taxonomic Analyses by Conventional Approaches

Based on diagnostic morphological characteristics, the Calanca plants collected from the vicinity of Tecali de Herrera were taxonomically identified as Chrysactinia mexicana A. Gray by a trained specialist. This identification was validated by comparing the specimens against the established taxonomic descriptions for the species within the regional flora. Characteristics such as plant size, leaf shape and size, and inflorescence shape were considered by the taxonomist (Figure 1B). Briefly, as illustrated in Figure 1, the collected specimens are perennial subshrubs reaching a height of around 20–40 cm, exhibiting a nearly glabrous and highly aromatic habit. The branches retain the bases of fallen leaves, which are imbricate and generally alternate. The leaves are somewhat fleshy, linear-cylindrical (5–20 mm long and 1–2 mm wide), and dark green, characterized by the presence of prominent, translucent oil glands at the apex (Figure 1B). On the other hand, Calanca plants contained small inflorescences characterized by solitary, pedunculate heads (4–5 mm high) lacking a caliculum. The involucre is broadly campanulate, comprising approximately 12 linear-oblong bracts, each featuring a distinct oil gland. The floral composition includes 12 yellow ray florets (6–10 mm long) and 20–30 yellow disc florets. The resulting fruits are linear, striated, blackish achenes (3–4 mm long) with a persistent pappus of whitish-to-tawny bristles. Finally, a defining diagnostic feature of C. mexicana is the intense, characteristic fragrance released upon the mechanical disruption of the foliar essential oil glands.

Given that Calanca plants were collected from a semi-arid environment, the characterization of the soil could provide clues about its nutrient content and, therefore, its putative influence on plant growth and/or production of phytochemicals. The results obtained from soil analysis are presented in

Table 2. Soil fertility analysis of the sampling area.

Parameters	Results			Unit	Interpretation	Range
Texture	Clay	Silt	Sand	%	Sandy loam (coarse)	Medium soil type
	11.6	27.3	61.1
Bulk density	1.34			g/cm3	Sandy loam	1.1–1.60
Organic matter	1.8			%	Medium	1.6–3.5
Porosity	8.96			%	Very low	30–60
pH	8.1			---	Slightly basic	7.5–8.5
Electric conductivity	2.27			dS/m	Moderately saline	2.1–4.0
Nitrogen	0.9			mg/L	Very low	<0.5
P	0.1			mg/L	Very low	<0.5
K+	0.1			mg/L	Very low	<0.5
Mg2+	0.8			mg/L	Very low	<0.5
CaCO3	220			mg/L	Moderate	>100
SO42+	0.8			mg/L	Very low	<0.5

. At the site, the soil was calcareous, which was confirmed upon its analysis, containing 220 mg per liter of calcium carbonate (Table 2). In addition, according to the content of sand (61.1%), silt (27.3%), and clay (11.6%), its texture was characteristic of sandy loam soil. The bulk density of 1.34 g/cm³ and a porosity of 8.96% were indicative of a compacted soil, with potentially low water-holding capacity (Table 2). Chemically, the soil exhibited a slightly alkaline pH (8.1) and an electrical conductivity (EC) of 2.27 dS/m, which characterizes the substrate as moderately saline. Notably, the nutrient analysis revealed significant deficiencies; levels of nitrogen (0.9 mg/L), phosphorus (0.1 mg/L), and potassium (0.1 mg/L) were all categorized as very low. (Table 2). Finally, the assessment of organic matter indicated that its content was medium (1.8%). In summary, these findings reveal that Calanca thrives in nutrient-limited conditions, which may be a key driver in the production of secondary metabolites.

3.2. Molecular Taxonomy of Calanca: Information from Gene Markers

Two plastid barcodes (rbcL and matK) and a single nuclear gene marker (ITS) were selected to molecularly identify the Calanca plant. The standard DNA barcode regions of rbcL and matK, as well as ITS, were amplified using oligonucleotides described in Table 1. All gene markers were amplified successfully and showed the expected PCR product in each case (Figure 2). The size of matK and ITS amplicons were 850 bp and 628 bp, respectively, whereas that of rbcL was 550 bp (Figure 2).

Direct bidirectional sequencing using the same set of primers used for amplification gave partial sequences of these genetic markers, which then were assembled to obtain consensus sequences (Table S1). Consensus sequences for matK (PX505685), ITS (PX446373) and rbcL (PX505686) were 649, 429 and 523 nt in length, respectively. Comparison of these consensus sequences with the GenBank database (BLASTn) showed that the closest species was C. mexicana, with a query coverage of 100% and an identity percentage of 99–100% (Table S2). Specifically, C. mexicana A. Gray voucher Edwin L. Bridges 13067 showed the strongest match when using ITS and matK DNA sequences (

Table 3. BLASTn results for the barcodes sequences against NCBI databases. (A) ITS, (B) matK, (C) rbcL.

(A) ITS
Query Subject	Subject Species	Subject ID	Acc. Length	Query Coverage %	Identity %	E-Value
Chrysactinia mexicana voucher Edwin L. Bridges 13067 18S ribosomal RNA gene, partial sequence	Chrysactinia mexicana	KJ524912.1	701	100	99.77	0
Chrysactinia mexicana internal transcribed spacer 1, partial sequence	Chrysactinia mexicana	AF413607.1	642	100	99.53	0
(B) matK
Query Subject	Subject Species	Subject ID	Acc. Length	Query Coverage %	Identity %	E-Value
Chrysactinia mexicana voucher Edwin L. Bridges 13067 maturase K (matK) gene, complete cds	Chrysactinia mexicana	KJ525212.1	1824	100	99.69	0
Chrysactinia mexicana voucher BRIT:Gostel459 maturase K (matK) gene, partial cds	Chrysactinia mexicana	OL537844.1	847	100	99.69	0
(C) rbcL
Query Subject	Subject Species	Subject ID	Acc. Length	Query Coverage %	Identity %	E-Value
Chrysactinia mexicana voucher BRIT:Gostel459 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds	Chrysactinia mexicana	OL537591.1	553	100	100	0
Flaveria pringlei chloroplast rbcL gene for the rubisco large subunit (EC 4.1.1.39)	Flaveria pringlei	X55829.1	1842	100	100	0

A and B, respectively). Such a specimen was collected in Sonora, Mexico and submitted by the University of Texas at Austin (KJ524912.1). On the other hand, rbcL also aligned with C. mexicana, though with a different voucher, BRIT:Gostel459 (submitted by the Smithsonian Institution as OL537591.1) (Table 3C).

According to the percentages of identity and E-values, the rbcL marker exhibited the least discriminating power since 9 out of the first 10 matches showed 100 percent identity and E-values of zero (Table S2). Despite this drawback, and according to the other barcodes, C. mexicana turned out to be the species with the greatest similarity to the sample collected in Tecali de Herrera, Puebla (Mexico). Taken together, the high-stringency matches (100% identity) obtained with matK and ITS sequences, together with the morphological characteristics previously described, definitively categorized the specimen collected in Tecali de Herrera as C. mexicana (A. Gray).

3.3. Molecular Phylogenetic Analysis and Taxonomic Positioning of C. mexicana Isolated in This Study

To visualize the phylogenetic placement of the barcode sequences obtained in this study in relation to other plants, namely, close and distant plant species, DNA marker sequences were selected and aligned using Clustal W algorithm. To enrich the comparison, additional sequences of matK (MT214879.1) and rbcL (not published) belonging to C. mexicana were obtained. In the case of the rbcL marker, this was taken from a thesis of the National Autonomous University of Mexico (Biology Institute).

As shown in the species tree inference using the ITS barcode (Figure S1A), the phylogenetic analysis revealed that the C. mexicana sequence obtained in this study (Cme_Tecali-ITS) exhibited high genetic affinity with the specimen from Austin, Texas (Cme_Texas-ITS; KJ524912.1). On the other hand, as expected by phylogenetic relationships, C. pinnata (Cpi-ITS; AF413608.1) and F. ramosissima (Fra-ITS; DQ122523.1) were clustered with C. mexicana isolates, whereas T. caeruleum (Tca-ITS; DQ304570.1), S. lycopersicum (Sly-ITS; OR809190) and A. thaliana (Ath-ITS; AJ232900.1) were positioned in different branches. Furthermore, P. aquilinum (Paq-ITS; OL434459), as expected, was found in the root of the phylogenetic tree (Figure 3). In the case of matK markers, besides the matK from the sample of Texas (Cme_Texas-matK; KJ525212.1), two additional matK sequences of C. mexicana were identified, being those from the National Autonomous University of Mexico (Cme_UNAM-matK; MT214879.1) and that of the Smithsonian Institute (Cme_Smith-matK; OL537844.1). The resulting phylogenetic tree using matK sequences gave the same picture as that obtained with the ITS sequences, namely, that all C. mexicana sequences were clustered together, whereas non-related plants species were separated in different branches (Figure S1B). Finally, the phylogenetic tree using rbcL sequences resulted in basically the same topology such as that of ITS and matK, only with a minor difference regarding the positioning of A. thaliana and S. lycopersicum (Figure S1C). Thus, among the single-locus trees, the ITS region provided higher variability, allowing for a clearer separation of the Calanca specimens from closely related genera, whereas rbcL and matK provided a broad taxonomic placement within the Asteraceae family but showed limited resolution at the specific level for the Chrysactinia genus.

Given the minor topological variations between the single-locus trees, a concatenated multi-locus analysis was performed to resolve such discrepancies. This approach, al-though aimed at enhancing phylogenetic robustness, reduced the taxonomic representativeness, as only the Cme-Smith isolate contained all three markers. However, the concatenated tree yielded a highly robust topology with maximum bootstrap support (100%) for the C. mexicana clade (Figure 3), minimizing the phylogenetic inconsistencies observed in single-locus topologies. The resulting tree unequivocally placed Calanca (Cme_Tecali) within the C. mexicana lineage, providing the necessary botanical certainty for the subsequent phytochemical characterization.

3.4. Additional Gene Markers of C. mexicana: Non-Published Barcodes

Despite the recommendation of matK and rbcL by [38] as core barcodes for plant identification, the discrimination effectiveness of these loci is variable among plant species. Consequently, incorporating supplementary markers is essential to increase the discriminatory power and ensure the accuracy of species-level identification. Here we designed and amplified chloroplast markers such as trnH-psbA, trnK-rps16, rpoC1 and trnL-P6 to provide a more comprehensive multi-locus molecular profile of the Chrysactinia genus. Although PCR products of 550, 645, 645 and 653 bp were expected, respectively, only the first marker fulfilled these criteria; the remaining loci yielded amplicons of minor size (Figure 4). The obtained PCR products were sequenced and subsequently deposited in the GenBank database (trnH-psbA, PX505687; trnK-rps16, PX505688; rpoC1, PX505689; and trnL-P6, PX505690). To our knowledge, our work is the first to publish these gene markers of C. mexicana, which will allow its unequivocal identification in the future.

3.5. Quantitative Determination of the Chemical Constituency

To complement the molecular characterization of Calanca, an untargeted phytochemical screening of the species using varying solvent polarities was performed. By fractioning the extracts into hexane (H), dichloromethane (DM) and methanol (M) phases, a broad spectrum of secondary metabolites was expected to be captured through the high resolving power and mass accuracy of Flow Injection Analysis Electrospray Ionization Fourier Transform Ion Cyclotron Resonance Mass Spectrometry (FIA-ESI-FTICR-MS). This technique detects chemical compounds in the positive and negative modes of ionized elemental formulas.

Phytochemical screening via FIA-ESI-FTICR-MS revealed that most metabolites were detected in the negative ionization mode (

Table 4. Phytochemical compounds identified in C. mexicana by FIA-ESI-FTICR-MS. (A) Negative mode, (B) Positive mode.

(A) Negative Mode
Compound		Element Formula	Theoretical		Measured (m/z)			Error (ppm)
Group	Name (Reported molecules)	[M − H]−	A*	(m/z)	H	DM	M	H	DM	M
Phenolic acids	3,5-O-dicaffeoylquinic acid	C25H23O12	27	515.113932	NF	NF	515.11991	-	-	11.61
	Chlorogenic acid	C16H17O9	100	352.078884	NF	352.07873	NF	-	0.44	-
			17.31	353.082238	353.08656	353.08821	353.08803	12.24	16.91	16.40
	Caffeic acid	C9H7O4	100	178.02606	178.02265	NF	NF	19.15	-	-
Flavonoids	6-hydroxykaempferol 7-acetylglucoside	C21H19O12	22.71	463.082632	NF	463.08933	463.08861	-	14.46	12.91
	6-hydroxykaempferol 7-O-ß-glucoside
	(4S)-7-acetoxypiperitone	C8H12NO3	100	169.073345	169.07005	NF	NF	19.49	-	-
Terpenes	alpha-pinene	C10H15	100	134.109002	NF	134.10829	NF	-	5.31	-
	beta-pinene
	Myrcene
	alfa-terpinene
	Terpinolene		10.82	135.112357	135.11981	135.11578	NF	55.16	25.33	-
	gamma-terpinene
	d-carene
	cis-limonene
	Piperitone	C10H15O	100	150.103916	150.10618	NF	NF	15.08	-	-
	alpha-Thujone
	Eucalyptol	C10H17O	100	152.119567	NF	152.11663	NF	-	19.31	-
	Terpinen-4-ol
	Alfa-terpineol		10.82	153.122921	153.12082	153.1215	153.1208	13.72	9.28	13.85
	Linalool
	a-terpineol
	exo-2-Hydroxycineole	C10H17O2	100	168.114481	NF	168.117	NF	-	14.98	-
			10.82	169.117836	169.11549	169.11494	NF	13.87	17.12	-
Anthocyanins	Petunidin 3,5-diglucoside	C28H32ClO17	32.00	676.121479	676.12149	NF	NF	0.02	-	-
	Cyanidin 3-O-rutinoside	C27H30O15	100	593.150097	593.15412	593.15306	593.1527	6.78	5.00	4.39
			29.20	594.153451	NF	594.15655	594.15602	-	5.22	4.32
	Malvidin 3-O-glucoside	C23H24O12	100	491.118403	491.12197	NF	NF	7.26	-	-
			24.88	492.121757	492.12559	NF	NF	7.79	-	-
(B) Positive Mode
Compound		Element Formula	Theoretical		Measured (m/z)			Error (ppm)
Group	Name	[M − H]+	A*	(m/z)	H	DM	M	H	DM	M
Terpenes	Piperitone	C10H17O	100	154.135217	154.13652	154.13766	154.13637	8.45	15.85	7.48
	alpha-Thujone

Note: Error was calculated as absolute valor. Abbreviations: A*, abundance; NF, not found. Supplementary Figure S2 includes the full-scan mass spectra and extracted ion signals.

A and Figure S2). Among these, chlorogenic acid (m/z 353.082238), eucalyptol (m/z 153.122921) and cyanidin 3-O-rutinoside were identified as core constituents, appearing consistently across all hexane (H), dichloromethane (DM) and methanol (M) extracts. On one hand, focusing on extract-specific phytochemicals, compounds such as caffeic acid (m/z 178.02606; a phenolic acid), (4S)-7-acetoxypiperitone (m/z 169.073345; a flavonoid), piperitone (m/z 150.103916; a terpene), petudinin 3,5-diglucoside (m/z 674.124429; an anthocyanin) and malvidin 3-O-glucoside (m/z 491.11053; another anthocyanin) were detected only within the H fraction (Table 4A). On the other hand, alpha-pinene (m/z 134.09002; a terpene) and 3,5-O-dicaffeoylquinic acid (m/z 515.113932; a phenolic acid) were found only in DM and M fractions, respectively, whereas beta-pinene (m/z 135.112357; a terpene) and exo-2-hydroxycineole (m/z 168.114481; another terpene) were detected in both H and DM fractions (Table 4A). Finally, 6-hydroxykaempferol 7-O-β-glucoside (m/z 463.082632; a flavonoid) and a variant of cyanidin 3-O-rutinoside (m/z 594.153451; an anthocyanin) were found within the DM and M fractions of C. mexicana. In contrast, positive-mode (ESI+) analysis yielded a lower number of detectable metabolites. However, piperitone was ubiquitously detected in all three fractions, suggesting that piperitone represents a key marker for the species regardless of solvent polarity (Table 4B). In summary, the multi-solvent extraction combined with high-resolution FIA-ESI-FTICR-MS revealed a diverse metabolic profile characterized by a high prevalence of terpenes, phenolic acids and anthocyanins. The consistent detection of core markers like chlorogenic acid and piperitone across various polarities provides a robust chemical signature for C. mexicana, which could serve as baseline for its future standardization and quality control.

3.6. Adaptive Capacity of C. mexicana Under Greenhouse Conditions

Transitioning from field collection to a controlled environment is a critical step in developing a sustainable conservation strategy for Calanca. Therefore, we evaluated its potential for ex situ propagation through greenhouse establishment and seed viability assays. The evaluation of ex situ propagation showed that greenhouse survival of Calanca plants increased significantly from 40% in 2022 to 75% in 2023 and 2024 (

Table 5. Adaptive capacity and germination percent of C. mexicana under greenhouse conditions.

Year Collection	Greenhouse Surviving (%)	Seed Germination (%)	Tetrazolium Test (%)
			Empty Seeds (%)	Non-Viable Seeds (%)
2022	40	8	76	16
2023	75	4	85	11
2024	75	6	84	10

Annual quantity of seed samples: 100 units.

). In contrast, seed germination remained consistently low (4–8%), with no significant differences among years (p > 0.05). The tetrazolium test revealed that the low viability was primarily due to a high incidence of empty seeds (76–85%) and non-viable embryos (10–16%) (Table 5). Altogether, these findings emphasize that while C. mexicana demonstrates seasonal adaptability, specialized agronomic management under greenhouse conditions is essential to overcome inherent viability constraints. Specifically, low reproductive efficiency is the primary bottleneck for successful large-scale cultivation.

4. Discussion

Knowledge of medicinal plant species regarding their classification and distribution is necessary not only to safeguard biodiversity but also to ensure their safe use by consumers. It is noteworthy that, despite global efforts to characterize medicinal plants, only 1% of these plant species in the world have been studied [39]. Consequently, integrated research, encompassing phytochemistry, soil taxonomy and propagation, is essential to validate traditional usage and develop standardized therapeutic applications in the future. In this study, Calanca, a locally traded medicinal plant from Puebla, Mexico, was unequivocally identified as Chrysactinia mexicana through a combined morpho-taxonomic and multi-locus molecular approach. On the other hand, since medicinal plants absorb nutrients from the soil, physicochemical characterization of the soil was performed. More importantly, the phytochemical constituency of this medicinal plant was analyzed as baseline for its future standardization and quality control. Finally, survival of Calanca plants in greenhouse conditions, as well as its germination rates and vegetative propagation, were also assessed.

4.1. Molecular Identification of Calanca (C. mexicana)

To identify and classify a plant species, traditional plant assessments have relied on plant morphological characteristics; however, the inherent phenotypic plasticity of the Asteraceae family often complicates species-level identification based solely on these features [23,40]. Our molecular data addressed these limitations by confirming that Calanca was indeed C. mexicana (Table 3). In agreement with previous barcoding studies [30,38,41], the ITS and matK regions proved to be the most discriminatory markers for C. mexicana identification, whereas rbcL displayed limited species-level resolution (Table 3 and Figure S1). Specifically, it was observed that while the rbcL locus served as a reliable universal framework for order- and family-level placement, it lacked the nucleotide substitution rate necessary to distinguish between closely related Chrysactinia species (Figure S1). This limitation of rbcL in closely related taxa is well-documented in medicinal plant barcoding, where low sequence divergence often results in collapsed clades [42]. Importantly, the concatenation of these markers significantly improved phylogenetic robustness (Figure 3), allowing for a clear differentiation of the Tecali de Herrera isolate from both closely related species (Figure 3). In fact, the higher discriminatory power of the multi-locus approach aligns with previous studies highlighting their utility in identifying complex lineages [43,44]. Ultimately, these findings demonstrate that while morphology remains a fundamental first step, the integration of concatenated DNA barcodes provides the high-resolution evidence necessary to resolve the persistent morphological ambiguities within the Chrysactinia genus.

4.2. Expansion of the Genetic Toolkit for C. mexicana Identification

Although the medicinal Calanca plant was able to be identified using the standard DNA markers (ITS, matK and rbcL), it is noteworthy that additional markers could augment the existing molecular framework and avoid the common issue of incomplete lineage sorting. Therefore, four additional markers (trnH-psbA, rpoC1, trnK-rps16 and trnL-P6) were characterized (Figure 4). Although rpoC1 and trnH-psbA are often cited as primary barcodes [41], their integration with the standard DNA markers provides a more comprehensive genetic fingerprint for C. mexicana. Specifically, the trnK-rps16 and trnL-P6 regions offer the ultimate resolution that may facilitate more rapid identification in future studies, where standard coding genes fail [30,38]. In summary, these additional sequences, now available in GenBank, will serve as a definitive diagnostic tool for future botanical authentication of C. mexicana in both wild conservation contexts and commercial medicinal supply chains.

4.3. Phytochemical Diversity of C. mexicana

C. mexicana is the most extensively characterized member of its genus [11,12,40], largely due to its therapeutic value. Therefore, an interest in its chemical constituency is understandable and justified, mainly because some of these chemical components provide health benefits. However, the inherent complexity of its bioactive profile requires high-sensitivity analytical tools. In that sense, the use of FIA-ESI-FTICR-MS in this study represented an excellent approach to capturing a broad spectrum of secondary metabolites. The H and DM fractions exhibited the highest phytochemical richness (Table 4 and Figure S2). Compounds such as phenolic acids, flavonoids, terpenes and anthocyanins were identified in C. mexicana extracts (Table 4), several of which have been previously reported in this species. For instance, core constituents such as eucalyptol and piperitone, which are responsible for the species’ characteristic mint-like aroma [19,20], were predominantly identified in the H fraction. In addition, eucalyptol and piperitone have documented antimicrobial and anti-inflammatory properties [16,17,40,45]. The presence of hydroxycinnamic acids, specifically, caffeic acid, chlorogenic acid, and 3,5-O-dicaffeoylquinic acid, aligns with the findings of [45], who highlighted their role in mitigating oxidative stress. Furthermore, the detection of anthocyanins such as cyanidin 3-O-rutinoside and malvidin 3-O-glucoside (Table 4) suggests that Calanca could exert antioxidant activity [46]. Beyond piperitone, the presence of terpenes such as α-pinene, β-pinene and exo-2-hydroxycineole in the DM and M fractions is far from only contributing to the characteristic aroma of C. mexicana; these constituents are also associated with a broad pharmacological spectrum, including antimicrobial [47], anti-inflammatory [48], antidepressant [49] and even anti-carcinogenic [50] activities. Variations observed in this study compared to previous reports, such as the absence of quercetin 3-O-glucoside [45] or linalool [16], likely reflect the influence of local environmental pressures or specific genetic lineages. Ultimately, the diverse array of terpenes, phenolic acids and anthocyanins identified here provides more than just a list of constituents; it contributes to the establishment of a metabolic fingerprint for the species that serves not only to reinforce the traditional medicinal value of C. mexicana but also to establish an essential baseline for the future standardization and quality control of Calanca products, distinguishing this medicinal plant from closely related taxa or potential adulterants.

4.4. Edaphic Influence on the Phytochemical Constituency of C. mexicana

The native soil of the Tecali de Herrera region, characterized as slightly alkaline, sandy loam with low nutrient availability and low water-holding capacity, is consistent with the “Stress-Induced Accumulation” hypothesis, where nutrient-poor or water-limited conditions acts as a natural driver for the synthesis of stress-responsive compounds, namely, carbon-based secondary metabolites [51,52,53]. For instance, the accumulation of phenylpropanoids and anthocyanins is a well-documented strategy for photoprotection and osmotic adjustment in semi-arid, calcareous environments [51,52,53,54,55]. Specifically, alpha-pinene and related terpenes play a dual role, reducing membrane oxidative damage and decreasing leaf transpiration rates, a vital survival mechanism in coarse-textured, sandy loam soils with low water-retention capacity such as the soil of Tecali de Herrera [41]. Furthermore, the moderate salinity observed in this study is likely an elicitor to produce volatile organic compounds such as documented in related genera (Tagetes and Artemisia), where mild salt stress correlates with an increase in essential oil yield and a higher density of glandular trichomes [54]. Thus, the phytochemical richness detected in the H and DM fractions, which showed the highest abundance of specialized metabolites (Table 4), are congruent with these environmental drivers. Moreover, these results suggest that the medicinal properties attributed to Calanca by local populations are intrinsically linked to the harsh environmental conditions of its habitat. Taking together, the integration of edaphic data with phytochemical findings provides a coherent explanation for the plant’s metabolite profile and how environmental factors potentially modulate its bioactive potential, thereby establishing the foundations to understand the soil–metabolite relationship, a necessary baseline for standardized greenhouse cultivation aimed to replicate these stress-like conditions to maintain the plant’s therapeutic efficacy.

4.5. Propagation of C. mexicana and Challenges: Conservation Implications

Finally, our greenhouse trials demonstrated that C. mexicana is a viable candidate for ex situ cultivation. The significant increase in survival from 40% to 75% emphasizes the importance of seasonal timing (September vs. June; Table 5) and controlled irrigation to reduce transplant shock [56]. However, sexual propagation remains a significant challenge. The high frequency of empty seeds and low embryo viability (Table 5) suggests deep-seated reproductive limitations. Whether these are driven by pollinator scarcity or physiological resource constraints remains to be elucidated.

Consequently, while future research must prioritize identifying the drivers of low seed-fill to support seed-based restoration, vegetative propagation via tillers currently offers the most reliable pathway for ex situ establishment. Also, by adopting a management framework similar to successful protocols for other endangered Asteraceae [57], our results serve as basis for the transition of C. mexicana from vulnerable wild populations to standardized greenhouse environments. This shift not only will alleviate the pressure of anthropogenic overexploitation but also will ensure consistent, high-quality botanical supply for the communities that continue to depend on its medicinal properties.

5. Conclusions

This study provides a comprehensive multidisciplinary framework for the characterization and conservation of C. mexicana. First, we have expanded the genetic repertoire of the species through the addition of complementary DNA barcodes (trnH-psbA, rpoC1, trnK-rps16 and trnL-P6), significantly strengthening species-level resolution for future taxonomic identification. Furthermore, the high-resolution metabolomic profiling via FIA-ESI-FTICR-MS established a robust chemical signature, characterized by a diverse array of terpenes, phenolic acids and anthocyanins, that validates its traditional medicinal use and provides a baseline for future standardization. Crucially, according to the published literature, this phytochemical richness is likely due to the alkaline, nutrient-poor edaphic conditions of its native habitat, which would act as environmental drivers for the synthesis of specialized bioactive metabolites. Finally, our greenhouse trials suggest that seed-based strategies will remain a significant bottleneck. Collectively, by integrating molecular, edaphic, phytochemical and agronomic data, our findings provide a scientific foundation for the sustainable management, quality control and pharmacological exploration of C. mexicana.