Next Article in Journal
Evaluation of In Vitro Regeneration Aptitude Through Histological Detection in Ocimum basilicum L.
Next Article in Special Issue
Genome Editing Using a New Self-Compatible Model Strain of the Genus Chrysanthemum
Previous Article in Journal
Fruit Characterization of Passiflora ligularis in Different Andean Regions of Ecuador
Previous Article in Special Issue
A Comprehensive Review of BBX Protein-Mediated Regulation of Anthocyanin Biosynthesis in Horticultural Plants
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Plant Growth Regulators Promote Petaloidy and Modulate Related Gene Expression in Ornamental Pomegranate

1
College of Culture and Tourism, Weifang University, Weifang 261000, China
2
College of Landscape Architecture, Nanjing Forestry University, Nanjing 210037, China
3
Southern Modern Forestry Collaborative Innovation Center, Nanjing Forestry University, Nanjing 210037, China
4
College of Traditional Chinese Medicine, Shandong Second Medical University, Weifang 261053, China
5
College of Landscape Engineering, Suzhou Polytechnic Institute of Agriculture, Suzhou 215008, China
6
College of Forestry, Nanjing Forestry University, Nanjing 210037, China
7
College of Art and Design, Nanjing Forestry University, Nanjing 210037, China
*
Authors to whom correspondence should be addressed.
Horticulturae 2025, 11(9), 1059; https://doi.org/10.3390/horticulturae11091059
Submission received: 30 July 2025 / Revised: 1 September 2025 / Accepted: 2 September 2025 / Published: 3 September 2025

Abstract

Double-petal ornamental pomegranate presents for its enhanced ornamental value. Thus, cultivation techniques that promote petaloidy while modulating related gene expression are desired. To screen out the efficient treatments of plant growth regulator and key genes that enhance petaloidy, this study treated the flower buds of double- and single-petal ornamental pomegranate varieties with different concentrations of plant growth regulators naphthaleneacetic acid (NAA), methyl jasmonate (MeJA), abscisic acid (ABA), and ethephon (ETH) and quantified the number of petalized stamens (NOPSs) and the number of petals (NOPs) in both varieties. Furthermore, we investigated the expression levels of the genes flavin-containing monooxygenase (YUC), IAA-amino acid hydrolase (ILR1),indole-3-acetic acid-amido synthetase (GH3.17), auxin transporter (LAX2), auxin response factor (ARF), auxin-induced in root cultures protein (AIR12), jasmonic acid-amido synthetase (JAR1), and ABA stress ripening-induced protein (ASR) under the different treatments and analyzed their role in regulating relevant phenotypic traits. Plant growth regulator experiments demonstrated that NAA (10 mg/L) significantly increased the number of petalized stamens (NOPSs) and petals (NOPs), MeJA (100 mg/L) significantly increased the number of petalized stamens, while neither ABA nor ETH induced this morphological shift. qRT-PCR analysis confirmed that NAA upregulated ILR1, LAX2, ARF, and JAR1 in the stamens of single-petal flowers (StSi) and double-petal flowers (StDo) and petals of single-petal flowers (PeSi) and double-petal flowers (PeDo), with their expression levels strongly positively correlated with NOPS in both single- and double-petal flowers and NOP in double-petal flowers. MeJA upregulated ILR1, GH3.17, LAX2, ARF, and JAR1 in StDo and PeDo and was strongly positively correlated with NOPS and NOP in double-petal flowers. Consequently, NAA (10 mg/L) and MeJA (100 mg/L) were efficient treatments, and ILR1, GH3.17, LAX2, ARF, and JAR1 were identified as key genes in NAA- and MeJA-mediated petaloidy in ornamental pomegranates. Our results provide theoretical support for identifying the formation mechanism and improving industrial cultivation techniques for double-petal pomegranates.

1. Introduction

Phytohormones are pivotal for the development of pistils, stamens, petals, and sepals [1,2,3,4], and alterations in their levels may trigger male sterility [5] or petaloidy [6]. Synthetic plant growth regulators such as naphthaleneacetic acid (NAA) effectively modulate pistil/stamen development, flowering time, and floral yield. Studies have demonstrated that NAA treatment suppressed the expression of the auxin efflux carrier gene, leading to decreased auxin efflux from buds, which hindered flower bud sprouting [7]. Furthermore, aberrant auxin accumulation induces tapetum hyperplasia and asynchronous meiosis [3]. Notably, elevated auxin concentrations stimulate ethylene biosynthesis and organ-specific alterations in ethylene metabolism or signaling pathways, leading to abnormal stamen development [5]. These findings reveal that phytohormones coordinately govern floral organogenesis.
Ornamental pomegranate (Punica granatum), which belongs to the genus Punica within the family Lythraceae, generally includes single- and double-petal flowers. Double-petal pomegranates are particularly favored for landscaping applications because of their full and showy blossoms. Studies have demonstrated that two efficient synthesized plant growth regulators, namely, ethephon (C2H6CIO3P) and paclobutrazol (C15H20ClN3O), enhance fertile flower proportions in pomegranates [8,9] while NAA prevents blossom drop; however, plant growth regulator-mediated petaloidy in ornamental pomegranates has not been reported to date. Therefore, the purpose of this article is to screen out the treatments of plant growth regulators that promote double petals and identify corresponding genes under these treatments.
Recent multiomics studies have revealed that petaloidy in diverse plant species correlates with hormone metabolism-related genes. Transformation from stamens to petals in lotus involves 11 hormone-associated genes and 22 transcription factors [10]. Candidate genes that regulate petaloidy in crabapples include an auxin-responsive gene and a floral development gene [11]. Petaloidy in clematis involves floral development genes, hormone-related genes, and cell wall remodeling genes [6]. Our prior integrated genomics, transcriptomics, and proteomics analyses of ornamental pomegranates pinpointed the following eight petaloidy-associated candidate genes linked to auxin, jasmonate, abscisic acid, and ethylene pathways, which involved hormone biosynthesis, transport, and signaling: flavin-containing monooxygenase (YUC), IAA-amino acid hydrolase 1 (ILR1), indole-3-acetic acid-amido synthetase (GH3.17), auxin transporter 2 (LAX2), auxin response factor (ARF), auxin-induced in root cultures protein 12 (AIR12), jasmonic acid-amido synthetase 1 (JAR1), and abscisic acid (ABA) stress ripening-induced protein (ASR) [12,13]. Critically, these regulator-responsive genes govern late-stage floral organogenesis when modulated by exogenous plant growth regulators [14,15,16]. For example, Stintzi proposed that male-sterile mutants are caused by impaired jasmonic acid (JA) biosynthesis, which reduces endogenous JA levels [17]. Downregulation of JAR1 was also shown to reduce sensitivity to methyl jasmonate (MeJA) in JAR1 homozygous mutants, indicating that JAR1 is a key factor in the response to exogenous MeJA induction [18]. Therefore, the expression response patterns of the above 10 hormone-related genes induced by plant growth regulators must be further investigated.
Based on the above studies, this article hypothesized that plant growth regulators might affect the petaloidy of pomegranate through expression changes in the related genes. Therefore, this study investigated changes in the quantity of petalized stamens and petals of ornamental pomegranate under induction by different concentrations of NAA, MeJA, ABA, and ETH, with the aim of identifying hormone treatments that enhance petaloidy. We further examined changes in the expression of YUC, ILR1, GH3.17, LAX2, ARF, AIR12, JAR1, and ASR under these treatments and determined their regulatory role in phenotypic traits to screen for key genes that promote petaloidy. This study explored the relationships between cultivation techniques and petaloidy-related phenotypes and genes, thereby providing a theoretical foundation for commercial ornamental pomegranate production.

2. Materials and Methods

2.1. Experimental Site and Plant Materials

The experiment was conducted at the Nanjing Forestry University Nursery (32°04′38″ N, 118°49′05″ E). Nanjing has an annual average temperature of 14.4 °C, altitude of 20–30 masl, annual precipitation of 1267.1 mm, and annual sunshine duration of 1955.5 h. The test material was 18-year-old ornamental pomegranate varieties ‘Nldbh’ and ‘Nlcbh’, which were planted at 2 × 4 m spacing. The soil was sandy loam soil, and it received standard maintenance. According to our previous research [13], the shape of stamens and petals in the flowers grown on the single-petal variety ‘Nldbh’ without a petalized stamen was normal. In these single-petaled flowers, the number of petalized stamens was zero, and the number of petals was six. However, the stamens in the flowers grown on the double-petaled variety ‘Nlcbh’ were abnormally developed, with some petalized stamens changing into petals. These double-petaled flowers had approximately 180 petalized stamens was approximately 180 and 73 petals (Figure 1). The comparison between the stamens of the single-petal flowers and stamens of the double-petal flowers, including petalized stamens, and between the petals of the single-petal flowers and petals of the double-petal flowers, including transitional petals, showed the key dynamic stage of the transformation from the stamens to petaloid stamens and from the transitional petals to normal petals.

2.2. Plant Growth Regulator Treatment Methods

The experiment on single- and double-petaled varieties included two factors (type of plant growth regulator) and three levels (concentrations of plant growth regulator) (Table 1). The control (CK) was sprayed with water. A randomized complete block experimental design was adopted, with a single plant as one block, and each plant was labeled with one lateral branch in four directions: east, south, west, and north. Single-branch treatments were performed, ensuring the relative distance between each treated branch to minimize mutual influence. Twenty-six treatments were conducted, with 10 flower buds per variety per treatment, and three biological replicates were performed. Since petaloidy occurs during late floral development (blooming stage), the treatments were applied at the spring bud stage (10 March to 10 April) in 2022. The NAA (S18037, BR, 98%), MeJA (S30685, BR, 95%), ABA (S25242, 98%), and ETH (S18030, AR, 85%) used in the experiment were produced by Shanghai Yuanye Bio-Technology Co., Ltd., Shanghai, China. The balance used a 1‰ scale and was produced by Hangzhou Huier Instrument Equipment Co., Ltd., Hangzhou, China.

2.3. Phenotypic Indicator Statistics

At the full bloom stage, the number of petalized stamens (NOPSs) and number of petals (NOPs) were counted for both varieties. NOPS refers to the number of petal-shaped stamens in various forms, all of which had slender filaments and incomplete petals. NOP refers to the number of petals with a normal shape. If the slender filaments were lost, then the transitional shaped petalized stamens were considered petals (Figure 1).

2.4. qRT-PCR Analysis

According to the phenotype results of plant growth regulator treatment, the expression levels of eight petaloidy-related genes were detected in different tissues (Table 2). In the NAA treatments (10, 50, and 100 mg/L) and control (CK), floral tissues were collected from stamens of single-petal flowers (StSi) and double-petal flowers (StDo) and petals of single-petal flowers (PeSi) and double-petal flowers (PeDo). In the MeJA treatments (50, 100, and 150 mg/L), floral tissues were collected from the StDo and PeDo. Subsequently, a qRT-PCR analysis was performed to identify flavin-containing monooxygenase (YUC), IAA-amino acid hydrolase (ILR1), indole-3-acetic acid-amido synthetase (GH3.17), auxin transporter (LAX2), auxin response factor (ARF), auxin-induced in root cultures protein (AIR12), jasmonic acid-amido synthetase (JAR1), and ABA stress ripening-induced protein (ASR) in all the collected tissues.
Total RNA from plant tissues was extracted using the RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit (DP441) from Tian Gen (Tiangen Biochemical Technology Co., Ltd., Beijing, China). Using the extracted total RNA as a template, cDNA was obtained by reverse transcription. The qRT-PCR reverse transcription reagent was the HiScript II QRT Super Mix (+gDNA Wiper; Vazyme, Nanjing, China; # R223-01). Designed qRT-PCR primers (Table 3) were used to perform the PCR with the fluorescent reagent AceQ qRT-PCR SYBR Green Master Mix (Vazyme; # Q111-02/AA). Since the actin gene is stably expressed in different tissues of different plants under a wide range of environmental conditions, PgActin was used as the housekeeping gene in this study. qRT-PCR was performed by real-time PCR System TL988-IV of Xi’an Tianlong Science and Technology Co., Ltd., Xi’an, China. The reaction conditions for the amplification were as follows: 95 °C for 5 min; 40 cycles of 95 °C for 10 s and 58 °C for 30 s; 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s; and 40 °C for 5 min. The reaction volume consisted of 5 μL of AceQ qPCR SYBR Green Master Mix (Vazyme # Q111-02/AA, Tiangen Biochemical Technology Co., Ltd., Beijing, China), 0.2 μL of primer 1, 0.2 μL of primer 2, 1 μL of 10× diluted cDNA, and 4.6 μL of distilled water. Data were analyzed using three replicates, and the relative expression was calculated using the 2−ΔΔDDCT method.

2.5. Data Processing

Data were analyzed using Excel 2010 for basic statistics. Normality test, analysis of variance (ANOVA), multiple comparisons, and regression analysis were performed in SPSS (version 24.0). The regression analysis treated phenotypic indices as independent variables and gene expression levels as dependent variables. The statistical significance was set at p < 0.05, and F values greater than 1 were considered indicative of a meaningful contribution to variation.

3. Results

3.1. Effect of Growth Regulator Treatment on Petaloidy Phenotype

As shown in Table 4, 10 mg/L NAA significantly increased NOPS (3.10) and NOP (6.21) in single flowers and NOPS (238.47) and NOP (106.23) in double flowers of ornamental pomegranate (p < 0.01), indicating that the NAA treatment promoted petaloidy in both flower types (Figure 2). Application of 100 mg/L MeJA significantly enhanced NOPS (254.93) and NOP (148.00) in double flowers (p < 0.01), demonstrating that MeJA promotes petaloidy in double-petal flowers. In contrast, neither ABA nor ETH at any concentration significantly increased NOPS or NOP in either single- or double-petal flowers.

3.2. Effects of NAA on Hormone-Related Genes Involved in Petaloidy

Analysis of variance indicated that the NAA treatment significantly or highly significantly affected the expression of YUC, ILR1, GH3.17, LAX2, ARF, AIR12, JAR1, and ASR in different tissues (p < 0.05 or p < 0.01). Multiple comparisons revealed that 10 mg/L NAA significantly upregulated ILR1, LAX2, ARF, AIR12, and JAR1 in StSi (p < 0.05), whereas 50 and 100 mg/L NAA highly significantly upregulated ASR in StSi (p < 0.01) (Figure 3). The expression levels of ILR1, LAX2, ARF, AIR12, and JAR1 were strongly positively correlated (r = 0.799–0.949; p < 0.01) with NOPS in single-petal flowers (Table 5), indicating that the number of petalized stamens in single-petal flowers increased as ILR1, LAX2, ARF, AIR12, and JAR1 were upregulated.
Multiple comparisons revealed that the NAA treatments at various concentrations significantly or highly significantly upregulated the expression of ILR1, LAX2, ARF, AIR12, and JAR1 in StDo (p < 0.05, p < 0.01) (Figure 3). Regression analysis demonstrated strong positive correlations (r = 0.705–0.908; p < 0.05 or p < 0.01) between the expression levels of these genes and NOPS in double-petal flowers (Table 5), indicating that the number of petalized stamens in double-petal flowers increased as ILR1, LAX2, ARF, AIR12, and JAR1 were upregulated.
Multiple comparisons revealed that various concentrations of the NAA treatment highly significantly upregulated the expression of ILR1, LAX2, ARF, AIR12, and JAR1 in PeDo (Figure 3). Regression analysis demonstrated strong positive correlations (r = 0.705–0.908; p < 0.01 or p < 0.05) between the expression levels of these genes and NOP in double-petal flowers (Table 5), indicating that the number of petals in double-petal flowers increased as ILR1, LAX2, ARF, AIR12, and JAR1 were upregulated.
Multiple comparisons revealed that the 10 mg/L NAA treatment highly significantly upregulated the expression of ILR1, LAX2, ARF, and JAR1 in PeSi, whereas the 50 mg/L and 100 mg/L NAA treatments highly significantly upregulated ASR in PeSi (p < 0.01) (Figure 3). Regression analysis demonstrated no significant correlations between the expression levels of YUC, ILR1, GH3.17, LAX2, ARF, AIR12, JAR1, or ASR and NOP in single-petal flowers (Table 5), indicating that the number of petals in single-petal flowers did not change linearly with the expression of the upregulation of all these eight genes.
Collectively, compared to the CK treatment, 10 mg/L NAA significantly or highly significantly upregulated ILR1, LAX2, ARF, and JAR1 in StSi, StDo, PeDo, and PeSi. Their expression showed strong positive correlations with NOPS in both single- and double-petal flowers and NOP in double-petal flowers (p < 0.05 or p < 0.01), but no significant correlation with NOP in single-petal flowers. Notably, under the 10 mg/L NAA treatment, the expression levels of these genes in StDo and PeDo were at least 4-fold higher than those in the CK, indicating greater responsiveness to NAA regulation in StDo and PeDo.

3.3. Effects of MeJA on Hormone-Related Genes Involved in Petaloidy

ANOVA indicated that the MeJA treatment significantly or highly significantly affected the expression of YUC, ILR1, GH3.17, LAX2, ARF, AIR12, and JAR1 in both StDo and PeDo (p < 0.05 or p < 0.01) and highly significantly affected the expression of ASR in StDo (p < 0.01), but did not significantly affect ASR in PeDo. Multiple comparisons revealed that all the MeJA concentrations significantly upregulated ILR1, LAX2, ARF, AIR12, and JAR1 in StDo (p < 0.05 or p < 0.01), with 100 mg/L and 150 mg/L MeJA highly significantly upregulating GH3.17 (p < 0.01) and ASR (p < 0.01) in StDo (Figure 4). Regression analysis demonstrated strong positive correlations (r = 0.613–0.873; p < 0.01 or p < 0.05) between the expression levels of ILR1, GH3.17, LAX2, ARF, and JAR1 and NOPS in double-petal flowers (Table 6), indicating that the number of petalized stamens in double-petal flowers increased as ILR1, GH3.17, LAX2, ARF, and JAR1 were upregulated.
Multiple comparisons showed that all MeJA concentrations highly significantly upregulated the expression of ILR1, LAX2, ARF, and JAR1 in PeDo, whereas the 100 mg/L MeJA treatment specifically highly significantly upregulated GH3.17 (Figure 4). Regression analysis revealed strong positive correlations (r = 0.633–0.873; p < 0.01 or p < 0.05) between the expression levels of ILR1, GH3.17, LAX2, ARF, and JAR1 and NOP in double-petal flowers (Table 6), indicating that the number of petals in double-petal flowers increased as ILR1, GH3.17, LAX2, ARF, and JAR1 were upregulated.
Collectively, compared to the CK treatment, 100 mg/L MeJA significantly or highly significantly upregulated ILR1, GH3.17, LAX2, ARF, and JAR1 in both StDo and PeDo, with their expression levels showing strong positive correlations with NOPS and NOP in double-petal flowers (p < 0.05 or p < 0.01).

4. Discussion

4.1. Plant Growth Regulator-Induced Petaloidy in Ornamental Pomegranate

The formation of double petals of pomegranate is a dynamic process in which the stamens are continuously petalized during their opening period, which produces various transitional petals that gradually transform into normal petals (Figure 1). The origin of increased petals caused by stamen petaloidy occurs in various ornamental plants, such as Prunus persica [19], Lagerstroemia speciosa [20], and Paeonia suffruticosa [21]. Research has shown that petal formation is related to the abnormal development of the anther wall and the morphological structure of the petals [22]. Moreover, various hormones also affect petal development. A study found that after spraying exogenous jasmonic acid on the inflorescences of a Chinese cabbage (Brassica campestris ssp. pekinensis) petal degeneration mutant, the petals returned to normal [23]. Therefore, this study investigated the phenotypic changes and related gene expression changes in pomegranate under a plant growth regulator treatment to provide a theoretical basis for horticultural production and identify the molecular mechanisms underlying floral development and breeding.
Auxin demonstrates significant activity in reproductive development across various plants, particularly in anthers and filaments [2,3]. Our prior combined transcriptome and proteome analysis of ornamental pomegranate revealed higher expression of the auxin-promoting genes YUC, ILR1, LAX2, and ARF in StDo, PeDo, and PeSi than in StSi, but the opposite pattern for the auxin-suppressing gene GH3.17 [13]. Studies on Asiatic hybrid lilies (Lilium spp.) have also reported higher expression of all IAAs in petalized stamens and tepals than in the stamens [24], which is consistent with our findings. To explore the role of auxin in floral organ development in ornamental pomegranates, the buds were treated with the auxin analog NAA. The results demonstrated that 10 mg/L NAA significantly increased NOPS and NOP in both single- and double-petal flowers, indicating the induction of petaloidy. This revealed that 10 mg/L NAA is an effective cultivation approach for enhancing petal number in ornamental pomegranate. Genetic and physiological studies have demonstrated that auxin flux influences the number and patterning of floral organs. Precise auxin concentration gradients are established through polar transport and local biosynthesis, thereby inducing the initiation and growth of floral organ primordia. Research has indicated that petal initiation depends on the transcription factor PETAL LOSS (PTL), which regulates auxin availability to form auxin maxima in the perianth [25]. Treatment with the polar transport inhibitor NPA significantly alters the number of floral organs [26]. Additionally, high auxin concentrations promote ethylene synthesis and modify ethylene metabolism and signaling pathways, ultimately affecting stamen development [5]. Notably, our ETH treatments did not induce stamen petalody, suggesting that ethylene may require synergistic interactions with other hormones to drive variations in petal doubling in ornamental pomegranate. These findings suggest that exogenous auxin-like hormones affect the morphological development of flower organs by altering the distribution and concentration of endogenous auxin.
JA is a crucial phytohormone that regulates plant morphogenesis, particularly in pollen and anther wall development [1]. Although Stintzi attributed male sterility in Arabidopsis mutants to impaired JA biosynthesis and reduced endogenous JA levels [17], studies on sesame (Sesamum indicum) and other plants have reported higher JA content in sterile flowers than in fertile flowers [26]. Endogenous JA is recognized by COI1, which recruits JAZ proteins for degradation, thereby activating the transcription of MYBs, and mutations in these genes cause stamen developmental defects [27]. Notably, Wang observed higher expression of most JA signaling genes in petalized stamens and tepals than in normal stamens, which is consistent with the expression pattern of JAR1 reported in our study [13]. To investigate the effects of exogenous JA on petaloidy in ornamental pomegranates, flower buds were treated with MeJA. The results revealed that 100 mg/L exogenous MeJA significantly increased NOPS and NOP in double-petal flowers, indicating the induction of petaloidy in the double-petal variety of ornamental pomegranate. Notably, previous studies have indicated that JA signaling forms synergistic or antagonistic relationships with other hormones through interactions between its core protein components and other signaling pathways. For instance, JA biosynthesis is regulated by auxin-responsive factors such as ARF6 and ARF8, thereby enabling the coordinated control of stamen development by JA and auxin [27,28]. In this study, both NAA and MeJA induced petaloidy in ornamental pomegranates; therefore, whether they act synergistically warrants further investigation. This suggests that exogenous MeJA can cause defects in stamen development by altering the content of endogenous jasmonic acid in various tissues or changing other hormone pathways, such as the auxin pathway.

4.2. Response Patterns of Hormone-Related Genes in Petaloidy of Ornamental Pomegranate Under NAA Induction

This study revealed that treatment with 10 mg/L NAA significantly or highly significantly upregulated ILR1, LAX2, ARF, and JAR1 in StSi, StDo, PeDo, and PeSi compared to the CK, with substantially greater upregulation in StDo and PeDo than in StSi and PeSi. This suggests that these genes crucially promote stamen petaloidy and petal transition structure growth in ornamental pomegranates treated with 10 mg/L NAA. Regression analysis demonstrated strong positive correlations between their expression levels and three morphological indices: NOPS in single- and double-petal flowers and NOP in double-petal flowers. Therefore, these genes represent key regulatory genes for petaloidy variation under NAA treatment (Figure 5).
Auxin metabolism and transport genes regulate local auxin concentration gradients, with mutations often causing severe floral defects such as increased or reduced organ numbers [29]. In plants, auxin primarily exists in conjugated forms that can be hydrolyzed into active auxin by indole-3-acetic acid-amido hydrolase (ILR). Studies have demonstrated that Arabidopsis roots cultured with IAA contain approximately 10-fold higher levels of IAA-Trp conjugates than IAA-free controls, indicating that conjugate homeostasis critically regulates auxin metabolism [30]. The auxin influx carrier LAX primarily facilitates auxin uptake into cells. Studies have reported that CcLAX3 promoter activity in transiently expressed tobacco is strongly induced by IBA and NaCl [31], indicating LAX3 involvement in the IBA response. Additionally, auxin transporter genes regulate the content of free auxin and the expression of auxin-responsive genes (ARFs and AUX/IAA), and the floral organ identity gene RhAG (class C) in rose buds, thereby controlling the homeotic transformation between stamens and petals [32]. However, the interaction between auxin transporters and AG, along with their mechanistic role in petaloidy formation, remains unclear. The ‘Boundary Shift Model’ in the ABCDE floral development model postulates that petaloidy arises from outward expansion of gene expression domains, including mutations, deletions, or constrictions in C-class genes such as AG [33,34,35]. Previous studies have demonstrated that AG C-terminal deletions in Prunus serrulata var. lannesiana, ectopic AG expression in roses, and aberrant AG expression in Ranunculus japonicus induce petaloidy [32,33,34,35,36,37]. These collective findings establish the critical role of AG in stamen–petal development; thus, further investigation into how auxin regulates AG expression at floral organ boundaries is warranted. In addition to synthesis and transport, auxin signaling is crucial for floral organ development. Auxin response factors (ARFs) regulate stamen development, pollen maturation, and dehiscence [16,38,39]. The Arabidopsis ettin (arf3) mutation increases petal number while reducing stamen number and disrupting pistil patterning [40], whereas Arabidopsis ARF17 knockout mutants exhibit complete male sterility [14]. Under exogenous auxin induction, Lilium brownii maintains low ARF19 expression, which induces embryogenic cell formation by regulating WOX genes [41]. JA-amido synthetase (JAR1) catalyzes the conjugation of auxin or jasmonate with amino acids to form conjugated hormones. For example, the expression of HbJAR1 shows significant upregulation 6 h post-IAA treatment [42], which is consistent with our expression trends. However, not all JAR1 homologs exhibited upregulated expression under auxin treatment [15], suggesting that specific JAR1 isoforms may participate in auxin induction pathways. These results demonstrate that ILR, LAX, ARF, and JAR1 respond to exogenous hormones by participating in the metabolism and transport of auxin, thereby regulating floral development and petaloidy.

4.3. Response Patterns of Hormone-Related Genes in Petaloidy of Ornamental Pomegranate Under MeJA Induction

This study found that 100 mg/L exogenous MeJA treatment significantly or highly significantly upregulated ILR1, GH3.17, LAX2, ARF, and JAR1 in StDo and PeDo compared to CK, indicating that these genes promote petaloidy in ornamental pomegranate. Regression analysis revealed strong positive correlations between their expression levels and both NOPS and NOP in double-petal flowers, identifying them as key regulatory genes for MeJA-induced phenotypic variation in petaloidy (Figure 5).
As a crucial endogenous phytohormone, JA does not act in isolation but collaborates with other hormones within intricate signaling networks [43]. For example, auxin conjugates participate in JA-induced processes in Arabidopsis under exogenous jasmonate treatment [30]. ILR1 catalyzes the release of free auxin, whereas GH3 and JAR1 conjugate auxin or jasmonate with amino acids to form conjugated hormones. Conjugated auxin loses biological activity, whereas conjugated jasmonate can activate the JA signaling pathway [44]. Studies have demonstrated that the downregulation of JAR1 results in reduced sensitivity to MeJA in JAR1 homozygous mutants, thereby establishing JAR1 as an essential mediator of exogenous MeJA-induced signaling pathways [18]. GH3, as one of the three primary auxin-responsive gene families, contains the conserved auxin response element ‘TGTCTC’ in its promoter region. Zhang Chao [45] discovered that the deletion of StGH3.1 and StGH3.5 reduces plant responsiveness to exogenous JA during development, indicating that these genes serve as critical mediators in JA-induced signaling pathways. ARFs are transcription factors that recognize and bind auxin response elements to regulate the expression of auxin-responsive genes. Studies have shown that AtARF2 and AtARF19 serve as key sites for integrating auxin and ethylene signaling, whereas AtARF6 and AtARF8 control JAZ/TIFY10A expression during JA induction, demonstrating the regulatory role of ARFs under JA induction [16]. Additionally, the expression of PgARF6a and PgARF6 was positively correlated with the JA concentration under an IBA treatment [46], confirming that ARFs are both auxin-induced and participate in JA-mediated regulation. Auxin transport occurs via passive diffusion and polar transport, with the latter being regulated by influx carriers (AUX1/LAX) and efflux carriers (PIN). Influx carriers deliver auxin into cells, whereas efflux carriers pump it out. Critically, studies have revealed that low concentrations of exogenous JA inhibit endocytosis of the auxin transporter PIN2, whereas high concentrations of exogenous JA reduce PIN2 accumulation on the plasma membrane. This demonstrates the regulatory role of JA in development mediated by auxin gradients [47]. Studies have also reported the significant upregulation of four auxin influx carrier genes in rice (Oryza sativa) roots under JA treatment [48], which is consistent with the upregulation of LAX2 observed in our study following MeJA induction. Additionally, studies have demonstrated that under high concentrations of exogenous MeJA, floral organ identity genes, including class A (BnAP1 and BnAP2), class B (BnAP3 and BnPI3), and class C (BnAG1), induce various floral abnormalities in Brassica napus, such as irregular petals, sepals, and stamens [49]. However, the interplay between JA-metabolic genes and floral homeotic genes remains unclear and requires further investigation. Consequently, under the induction of Meja, ILR1, GH3, LAX, ARF, and JAR1 participate in the metabolism, transport, and response of auxin or jasmonic acid, indicating the association between the auxin and jasmonic acid pathways. This is consistent with the results of phenotype studies showing that both auxin and jasmonic acid can promote double petalization.
Despite these important findings, this study presented certain limitations that should be noted. For example, (i) the induction experiments were only conducted using four individual plant growth regulators and thus failed to investigate combinations of multiple types of plant growth regulators, and (ii) the molecular analysis was based solely on transcription and did not perform protein validation. In future studies, combined induction experiments, such as NAA + MeJA or NAA + ETH, should be prioritized to evaluate the interactions among different hormone pathways, and key genes should be experimentally validated using gene editing technology such as CRISPR. Such studies could aid in deciphering the specific mechanism of petaloidy affected by different hormone pathways.

5. Conclusions

The present study revealed that NAA at 10 mg/L and MeJA at 100 mg/L increased NOPS and NOP levels in ornamental pomegranates, whereas neither ABA nor ETH induced petaloidy. NAA induced upregulation of ILR1, LAX2, ARF, and JAR1 in StSi, StDo, PeDo, and PeSi, with their expression levels demonstrating strong positive correlations with NOPS in both single- and double-petal flowers and with NOP in double-petal flowers. In addition, the MeJA treatment upregulated ILR1, GH3.17, LAX2, ARF, and JAR1 specifically in StDo and PeDo, with their expression levels exhibiting strong positive correlations with NOPS and NOP in double-petal flowers. Collectively, ILR1, GH3.17, LAX2, ARF, and JAR1 were identified as the key regulatory genes governing NAA/MeJA-mediated petaloidy. The effective treatments of plant growth regulators and petaloidy-related key genes screened in this study not only provide valuable tools for horticultural production and the efficient development of new cultivars in pomegranate but also aid in the establishment of molecular mechanisms of floral development in other ornamental species. Future studies should focus on combined induction experiments, such as NAA + MeJA or NAA + ETH, and CRISPR-based editing of petaloidy–related genes.

Author Contributions

Conceptualization, Y.H., Z.Y. and Z.Z.; methodology, Y.H.; software, H.Y., F.L., L.M. and W.D.; validation, F.L.; formal analysis, Y.H.; investigation, Y.H.; resources, Z.Y.; data curation, Y.H.; writing—original draft preparation, Y.H.; writing—review and editing, Y.H., L.M., F.L., H.Y. and W.D.; visualization, Y.H., L.M., F.L. and H.Y.; supervision, Z.Y. and Z.Z.; project administration, Z.Y. and Z.Z.; funding acquisition, Z.Y. and Z.Z. All the authors have read and agreed to the published version of the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the General Program of Natural Science Research for Higher Education Institutions in Jiangsu Province (21KJB220008) and the 2024 Approved Social Science Planning Research Projects in Shandong Province (24CLYJ28).

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors are grateful to the anonymous reviewers for their valuable time and their insightful comments, which greatly improved the quality of the manuscript. The authors also sincerely thank the funding agencies for their invaluable financial support.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
NAANaphthaleneacetic acid
MeJAMethyl jasmonate
ABAAbscisic acid
ETHEthephon
NOPSsNumber of petalized stamens
NOPsNumber of petals
PeSiPetals of the single-petal flowers
PeDoPetals of the double-petal flowers, including the transitional petals
StSiStamens of the single-petal flowers
StDoStamens of the double-petal flowers, including the petalized stamens
YUCFlavin-containing monooxygenase
ILR1IAA-amino acid hydrolase 1
GH3.17Indole-3-acetic acid-amido synthetase
LAX2Auxin transporter 2
ARFAuxin response factor
AIR12Auxin-induced in root cultures protein 12
JAR1Jasmonic acid-amido synthetase 1
ASRABA stress ripening-induced protein
ANOVAAnalysis of variance
PTLPETAL LOSS
PINEfflux carrier

References

  1. Xiao, Y.G.; Chen, Y.; Charnikhova, T.; Mulder, P.P.; Heijmans, J.; Hoogenboom, A.; Agalou, A.; Michel, C.; Morel, J.-B.; Dreni, L.; et al. OsJAR1 is required for JA–regulated floret opening and anther dehiscence in rice. Plant Mol. Biol. 2014, 86, 19–33. [Google Scholar] [CrossRef]
  2. Aloni, R.; Aloni, E.; Langhans, M.; Cornelia, I.U. Role of auxin in regulating Arabidopsis flower development. Planta 2006, 223, 315–328. [Google Scholar] [CrossRef]
  3. Cecchetti, V.; Brunetti, P.; Napoli, N.; Fattorini, L.; Altamura, M.M.; Costantino, P.; Cardarelli, M. ABCB1 and ABCB19 auxin transporters have synergistic effects on early and late Arabidopsis anther development. J. Integr. Plant Biol. 2015, 57, 1089–1098. [Google Scholar] [CrossRef] [PubMed]
  4. Chen, Y.; Jin, M.; Wu, C.Y.; Bao, J.P. Effects of plant growth regulators on the endogenous hormone content of calyx development in ‘Korla’ fragrant pear. Hortscience 2022, 57, 497–503. [Google Scholar] [CrossRef]
  5. Pan, J.; Wang, G.; Wen, H.F.; Du, H.; Lian, H.L.; He, H.L.; Pan, J.S.; Cai, R. Differential gene expression caused by the F and M loci provides insight into ethylene–mediated female flower differentiation in cucumber. Front. Plant Sci. 2018, 9, 1091. [Google Scholar] [CrossRef] [PubMed]
  6. Xiong, Y.Y. Study on the Double Petal Formation Mechanism of Grandiflora Clematis. Master’s Thesis, Southwest Forestry University, Kunming, China, 4 June 2019. [Google Scholar]
  7. Wei, J.; Yang, Q.S.; Ni, J.B.; Gao, Y.H.; Tang, Y.X.; Bai, S.L.; Teng, Y.W. Early defoliation induces auxin redistribution, promoting paradormancy release in pear buds. Plant Physiol. 2022, 190, 2739–2756. [Google Scholar] [CrossRef]
  8. Chen, L.N.; Zhang, J.; Li, H.X.; Niu, J.; Xue, H.; Liu, B.B.; Wang, Q.; Luo, X.; Zhang, F.H.; Zhao, D.G.; et al. Transcriptomic analysis reveals candidate genes for female sterility in pomegranate flowers. Front. Plant Sci. 2017, 8, 1430. [Google Scholar] [CrossRef]
  9. Xia, S.S.; Niu, J.; Chen, L.N.; Cao, S.Y. Effect of different reagents on the proportion of fertile flower and fruit yield and quality in pomegranate. J. Northwest For. Univ. 2017, 32, 111–116. [Google Scholar]
  10. Lin, Z.; Damaris, R.N.; Shi, T.; Li, J.; Yang, P. Transcriptomic analysis identifies the key genes involved in stamen petaloid in lotus (Nelumbo nucifera). BMC Genom. 2018, 19, 554. [Google Scholar] [CrossRef]
  11. Hera, G. Morphology of Single-Petaled/Double-Petaled Flower Traits in ‘Malus’ Through Anatomical and Transcriptome Analyses. Ph.D. Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 31 May 2013. [Google Scholar]
  12. Huo, Y.; Yang, H.; Ding, W.J.; Yuan, Z.H.; Zhu, Z.L. Exploring the relationship between genomic variation and phenotype in ornamental pomegranate. Horticulturae 2023, 9, 361. [Google Scholar] [CrossRef]
  13. Huo, Y.; Yang, H.; Ding, W.J.; Huang, T.; Yuan, Z.H.; Zhu, Z.L. Combined transcriptome and proteome analysis provides insights into petaloidy in ornamental pomegranate. Plants 2023, 12, 2402. [Google Scholar] [CrossRef]
  14. Yang, J.; Tian, L.; Sun, M.X.; Huang, X.Y.; Zhu, J.; Guan, Y.F.; Jia, Q.S.; Yang, Z.N. AUXIN RESPONSE FACTOR17 is essential for pollen wall pattern formation in Arabidopsis. Plant Physiol. 2013, 162, 720–731. [Google Scholar] [CrossRef]
  15. Hagen, G.; Guilfoyle, T. Auxin–responsive gene expression: Genes, promoters and regulatory factors. Plant Mol. Biol. 2002, 49, 373–385. [Google Scholar] [CrossRef]
  16. Schruff, M.C.; Spielman, M.; Tiwari, S.; Adams, S.; Fenby, N.; Scott, R.J. The AUXIN RESPONSE FACTOR 2 gene of Arabidopsis links auxin signalling, cell division, and the size of seeds and other organs. Development 2006, 133, 251–261. [Google Scholar] [CrossRef]
  17. Stintzi, A.; Browse, J. The Arabidopsis male–sterile mutant, opr3, lacks the 12–oxophytodienoic acid reductase required for jasmonate synthesis. Proc Natl. Acad. Sci USA 2000, 97, 10625–10630. [Google Scholar] [CrossRef]
  18. Xiang, Q.J.; Yang, H.Y.; Wu, J.; Peng, Z.; Shen, F.; Zhou, L.Y.; Wang, Y.Y. Identification and MeJA sensitivity analysis of Arabidopsis mutant jar1. J. Southwest For. Univ. 2018, 38, 69–73. [Google Scholar]
  19. Cirilli, M.; Rossini, L.; Chiozzotto, R.; Baccichet, I.; Florio, F.E.; Mazzaglia, A.; Turco, S.; Bassi, D.; Gattolin, S. Less is more: Natural variation disrupting a miR172 gene at the di locus underlies the recessive double-flower trait in peach (P. persica L. Batsch). BMC Plant Biol. 2022, 22, 318. [Google Scholar] [CrossRef] [PubMed]
  20. Hu, L.; Zheng, T.; Cai, M.; Pan, H.; Wang, J.; Zhang, Q. Transcriptome analysis during floral organ development provides insights into stamen petaloidy in Lagerstroemia speciosa. Plant Physiol. Biochem. 2019, 142, 510–518. [Google Scholar] [CrossRef] [PubMed]
  21. Li, W.; Huang, X.C.; Wang, Y.L.; Zhang, R.J.; Shi, D.Y.; Li, T.F.; Zhou, G.C.; Xue, J.Y. Plastid phylogenomics of Paeonia and the evolution of ten flower types in tree peony. Genes 2022, 13, 2229. [Google Scholar] [CrossRef]
  22. Lou, P.; Kang, J.G.; Zhang, G.Y.; Bonnema, G.; Fang, Z.Y.; Wang, X.W. Transcript profiling of a dominant male sterile mutant (Ms-cd1) in cabbage during flower bud development. Plant Sci. 2007, 172, 111–119. [Google Scholar] [CrossRef]
  23. Peng, S.; Huang, S.; Liu, Z.; Feng, H. Mutation of ACX1, a jasmonic acid biosynthetic enzyme, leads to petal degeneration in chinese cabbage (Brassica campestris ssp. pekinensis). Int. J. Mol. Sci. 2019, 20, 2310. [Google Scholar] [CrossRef]
  24. Wang, W.B.; He, X.F.; Li, X.Y.; Wang, W.H. Transcriptome profiling during double–flower development provides insight into stamen petaloid in cultivated Lilium. Ornam. Plant Res. 2022, 2, 10. [Google Scholar] [CrossRef]
  25. Lampugnani, E.R.; Kilinc, A.; Smyth, D.R. Auxin controls petal initiation in Arabidopsis. Development 2013, 140, 185–194. [Google Scholar] [CrossRef] [PubMed]
  26. Liu, H.Y.; Wu, K.; Yang, M.M.; Zhou, X.A.; Zhao, Y.Z. Variation of soluble sugar, starch and plant hormones contents in sesame dominat genic male sterile line during bud development. Chin. J. Oil Crop Sci. 2014, 36, 175–180. [Google Scholar]
  27. Song, S.S.; Qi, T.C.; Huang, H.; Xie, D.X. Regulation of stamen development by coordinated actions of jasmonate, auxin, and gibberellin in Arabidopsis. Mol. Plant 2013, 6, 1065–1073. [Google Scholar] [CrossRef]
  28. Jiang, Y.J.; Liang, G.; Yang, S.Z.; Yu, D.Q. Arabidopsis WRKY57 functions as a node of convergence for jasmonic acid–and auxinmediated signaling in jasmonic acid–induced leaf senescence. Plant Cell 2014, 26, 230–245. [Google Scholar] [CrossRef]
  29. Cheng, Y.; Zhao, Y. A role for auxin in flower development. J. Integr. Plant Biol. 2007, 49, 99–104. [Google Scholar] [CrossRef]
  30. Staswick, P.E. The tryptophan conjugates of jasmonic and indole–3–acetic acids are endogenous auxin inhibitors. Plant Physiol. 2009, 150, 1310–1321. [Google Scholar] [CrossRef]
  31. Yang, Y.; Wang, J.Y.; Xu, Y.; Abbas, F.; Xu, D.B.; Tao, S.C.; Xie, X.T.; Song, F.; Huang, Q.Y.; Sharma, A.; et al. Genome-wide identification and expression analysis of AUX/LAX family genes in Chinese hickory (Carya cathayensis Sarg.) under various abiotic stresses and grafting. Front Plant Sci. 2023, 13, 1060965. [Google Scholar] [CrossRef]
  32. Chen, J.W.; Li, Y.; Li, Y.H.; Li, Y.Q.; Wang, Y.; Jiang, C.Y.; Choisy, P.; Xu, T.; Cai, Y.M.; Pei, D.; et al. Auxin response factor 18–histone deacetylase 6 module regulates floral organ identity in rose (Rosa hybrida). Plant Physiol. 2021, 186, 1074–1087. [Google Scholar] [CrossRef]
  33. Yanofsk, M.F. Floral meristems to floral organs: Gens controlling early events in Arabidopsis flower development. Annu. Rev. Plant Physiol. 1995, 46, 167–188. [Google Scholar] [CrossRef]
  34. Davies, B.; Motte, P.; Keck, E.; Saedler, H.; Sommer, H.; Schwarz-Sommer, Z. Plena and Farinelli: Redundancy and regulatory interactions between two Antirrhinum MADS–box factors controlling flower development. EMBO J. 1999, 18, 4023–4034. [Google Scholar] [CrossRef]
  35. Nakamura, T.; Fukuda, T.; Nakana, M.; Hasebe, M.; Kameya, T.; Kanno, A. The modified ABC model explains the development of the petaloid perianth of Agapanthus praecox ssp. Orientalis (Agapanthaceae) flower. Plant Mol. Biol. 2005, 58, 435–445. [Google Scholar] [CrossRef] [PubMed]
  36. Dubois, A.; Raymond, O.; Maene, M.; Baudino, S.; Langlde, B.N.; Boltz, V.; Vergne, P.; Bendahmane, M. Tinkering with the C–function: A molecular frame for the selection of double flowers in cultivated roses. PLoS ONE 2010, 5, e9288. [Google Scholar] [CrossRef] [PubMed]
  37. Liu, Z.X.; Zhang, D.D.; Liu, D.; Li, F.L.; Lu, H. Exon skipping of AGAMOUS homolog PrseAG in developing double flowers of Prunus lannesiana (Rosaceae). Plant Cell Rep. 2013, 32, 227–237. [Google Scholar] [CrossRef] [PubMed]
  38. Ellis, C.M.; Nagpal, P.; Young, J.C.; Hagen, G.; Guifoyle, J.T.; Reed, W.J. AUXIN RESPONSE FACTOR1 and AUXIN RESPONSE FACTOR2 regulate senescence and floral organ abscission in Arabidopsis thaliana. Development 2005, 132, 4563–4574. [Google Scholar] [CrossRef]
  39. Pekker, I.; Alvarez, J.P.; Eshed, Y. Auxin response factors mediate Arabidopsis organ asymmetry via modulation of KANADI activity. Plant Cell 2005, 17, 2899–2910. [Google Scholar] [CrossRef]
  40. Sessions, A.; Nemhauser, J.L.; McColl, A.; Roe, J.L.; Feldmann, K.A.; Zambryski, P.C. ETTIN patterns the Arabidopsis floral meristerm and reproductive organs. Development 1997, 134, 4481–4491. [Google Scholar] [CrossRef]
  41. Yang, Y. Molecular Mechanism of ARF19-WOX9/13 Mediated Exogenous Auxin Inducing the Embryogenic Cell Formation in Lilium. Ph.D. Thesis, Shenyang Agricultural University, Shenyang, China, 1 June 2022. [Google Scholar]
  42. Li, X.N.; Xiao, H.Z.; Wan, S.L.; Zhang, D.; Zhang, Y. Gene cloning and expression analysis of auxin responsive HbJAR1 in rubber tree. Chin. J. Trop. Crops 2017, 38, 1478–1484. [Google Scholar]
  43. Wang, J.; Song, L.; Gong, X.; Xu, J.F.; Li, M.H. Functions of jasmonic acid in plant regulation and response to abiotic stress. Int. J. Mol. Sci. 2020, 21, 1446. [Google Scholar] [CrossRef]
  44. Sheard, L.B.; Tan, X.; Mao, H.; Withers, J.; Ben-Nissan, G.; Hinds, T.R.; Kobayashi, Y.; Hsu, F.F.; Sharon, M.; Browse, J.; et al. Jasmonate perception by inositol–phosphate–potentiated COI1–JAZ co–receptor. Nature 2010, 468, 400–405. [Google Scholar] [CrossRef]
  45. Zhang, C. Identification of jasmonic acid regulatory gene GH3 family and analysis of disease resistance and wounding in potato. Ph.D. Thesis, Northwest Agriculture & Forestry University, Xianyang, China, 1 April 2021. [Google Scholar]
  46. Zhao, Y.J.; Wang, Y.Y.; Zhao, X.Q.; Yan, M.; Ren, Y.; Yuan, Z.H. ARF6s identification and function analysis provide insights into flower development of Punica granatum L. Front. Plant Sci. 2022, 13, 833747. [Google Scholar]
  47. Sun, J.Q.; Chen, Q.; Qi, L.L.; Jiang, H.L.; Li, S.U.; Xu, Y.X.; Liu, F.; Zhou, W.K.; Pan, J.W.; Li, X.G.; et al. Jasmonate modulates endocytosis and plasma membrane accumulation of the Arabidopsis PIN2 protein. New Phytol. 2011, 191, 360–375. [Google Scholar] [CrossRef]
  48. Li, J.T.; Ren, M.D.; Chai, M.M.; Zhang, H.X.; Wang, Z.Y.; Gu, C.F.; Tian, Q.; Peng, C.Y.; Li, Y.X.; Fan, H.Y. Research of jasmonic acid modulated auxin biosynthesis and transport in rice root. J. Xinyang Norm. Univ. 2021, 34, 448–451. [Google Scholar]
  49. Pak, H.; Guo, Y.; Chen, M.X.; Chen, K.M.; Li, Y.L.; Hua, S.J.; Shamsi, I.; Meng, H.B.; Shi, C.G.; Jiang, L.X. The effect of exogenous methyl jasmonate on the flowering time, floral organ morphology, and transcript levels of a group of genes implicated in the development of oilseed rape flowers (Brassica napus L.). Planta 2009, 231, 79–91. [Google Scholar] [CrossRef]
Figure 1. Morphological characteristics and indices of ornamental pomegranate flowers: (a) morphology of a single-petal flower; (b) morphology of single petals; (c) stamen morphology of single-petal flower; (d) morphology of a double-petal flower; (e) petal morphology of double-petal flower, including normal petal and transitional petal; (f) stamen morphology of double-petal flower, including petaloid stamens; (g) petal number of single and double-petal flowers; (h) petaloid stamen number of single and double-petal flowers. Lowercase letters represent the difference is significant (p < 0.05), uppercase letters represent the difference is highly significant (p < 0.01).
Figure 1. Morphological characteristics and indices of ornamental pomegranate flowers: (a) morphology of a single-petal flower; (b) morphology of single petals; (c) stamen morphology of single-petal flower; (d) morphology of a double-petal flower; (e) petal morphology of double-petal flower, including normal petal and transitional petal; (f) stamen morphology of double-petal flower, including petaloid stamens; (g) petal number of single and double-petal flowers; (h) petaloid stamen number of single and double-petal flowers. Lowercase letters represent the difference is significant (p < 0.05), uppercase letters represent the difference is highly significant (p < 0.01).
Horticulturae 11 01059 g001
Figure 2. Single-petal flower of pomegranate with petaloid stamens under the NAA treatment: (a) A single-petal flower with petalized stamens. (b) Petalized stamens and normal stamens in the single-petal flower. (c) A normal stamen. (d) A petalized stamen.
Figure 2. Single-petal flower of pomegranate with petaloid stamens under the NAA treatment: (a) A single-petal flower with petalized stamens. (b) Petalized stamens and normal stamens in the single-petal flower. (c) A normal stamen. (d) A petalized stamen.
Horticulturae 11 01059 g002
Figure 3. Effects of NAA treatment on the expression of hormone-related genes involved in petaloidy. 0 means water control, 10 means 10 mg/L NAA, 50 means 50 mg/L NAA, and 100 means 100 mg/L NAA. StSi means stamens of single-petal flowers, including normal stamens and petalized stamens. StDo means stamens of double-petal flowers, including normal stamens and petalized stamens. PeDo means petals of double-petal flowers, including normal petals and transitional petals. PeSi means petals of single-petal flowers, only including normal petals (Figure 1). YUC: flavin-containing monooxygenase gene; ILR1: IAA-amino acid hydrolase gene; GH3.17: indole-3-acetic acid-amido synthetase gene; LAX2: auxin transporter gene; ARF: auxin response factor gene; AIR12: auxin-induced in root cultures protein gene; JAR1: jasmonic acid-amido synthetase gene; ASR: ABA stress ripening-induced protein gene. Lowercase letters represent the difference is significant (p < 0.05), uppercase letters represent the difference is highly significant (p < 0.01).
Figure 3. Effects of NAA treatment on the expression of hormone-related genes involved in petaloidy. 0 means water control, 10 means 10 mg/L NAA, 50 means 50 mg/L NAA, and 100 means 100 mg/L NAA. StSi means stamens of single-petal flowers, including normal stamens and petalized stamens. StDo means stamens of double-petal flowers, including normal stamens and petalized stamens. PeDo means petals of double-petal flowers, including normal petals and transitional petals. PeSi means petals of single-petal flowers, only including normal petals (Figure 1). YUC: flavin-containing monooxygenase gene; ILR1: IAA-amino acid hydrolase gene; GH3.17: indole-3-acetic acid-amido synthetase gene; LAX2: auxin transporter gene; ARF: auxin response factor gene; AIR12: auxin-induced in root cultures protein gene; JAR1: jasmonic acid-amido synthetase gene; ASR: ABA stress ripening-induced protein gene. Lowercase letters represent the difference is significant (p < 0.05), uppercase letters represent the difference is highly significant (p < 0.01).
Horticulturae 11 01059 g003
Figure 4. Effects of MeJA treatment on the expression of hormone-related genes involved in petaloidy. 0 means water control, 50 means 10 mg/L MeJA, 100 means 100 mg/L MeJA, and 150 means 100 mg/L MeJA. StDo means stamens of double-petal flowers, including normal stamens and petalized stamens. PeDo means petals of double-petal flowers, including normal petals and transitional petals. YUC: flavin-containing monooxygenase gene; ILR1: IAA-amino acid hydrolase gene; GH3.17: indole-3-acetic acid-amido synthetase gene; LAX2: auxin transporter gene; ARF: auxin response factor gene; AIR12: auxin-induced in root cultures protein gene; JAR1: jasmonic acid-amido synthetase gene; ASR: ABA stress ripening-induced protein gene. Lowercase letters represent the difference is significant (p < 0.05), uppercase letters represent the difference is highly significant (p < 0.01).
Figure 4. Effects of MeJA treatment on the expression of hormone-related genes involved in petaloidy. 0 means water control, 50 means 10 mg/L MeJA, 100 means 100 mg/L MeJA, and 150 means 100 mg/L MeJA. StDo means stamens of double-petal flowers, including normal stamens and petalized stamens. PeDo means petals of double-petal flowers, including normal petals and transitional petals. YUC: flavin-containing monooxygenase gene; ILR1: IAA-amino acid hydrolase gene; GH3.17: indole-3-acetic acid-amido synthetase gene; LAX2: auxin transporter gene; ARF: auxin response factor gene; AIR12: auxin-induced in root cultures protein gene; JAR1: jasmonic acid-amido synthetase gene; ASR: ABA stress ripening-induced protein gene. Lowercase letters represent the difference is significant (p < 0.05), uppercase letters represent the difference is highly significant (p < 0.01).
Horticulturae 11 01059 g004
Figure 5. Morphological indices and key genes involved in petaloidy of ornamental pomegranate induced by different treatments of plant growth regulators. The red circle represents efficient treatment for petaloidy, and the green circle represents invalid treatment. The red upward-pointing arrow represents increased morphological indices. The purple dotted box represents auxin pathway genes, and the blue dotted box represents jasmonic acid pathway genes. Yellow font represents shared genes both under 10 mg/L NAA and 100 mg/L MeJA.
Figure 5. Morphological indices and key genes involved in petaloidy of ornamental pomegranate induced by different treatments of plant growth regulators. The red circle represents efficient treatment for petaloidy, and the green circle represents invalid treatment. The red upward-pointing arrow represents increased morphological indices. The purple dotted box represents auxin pathway genes, and the blue dotted box represents jasmonic acid pathway genes. Yellow font represents shared genes both under 10 mg/L NAA and 100 mg/L MeJA.
Horticulturae 11 01059 g005
Table 1. Treatment of different plant growth regulators on single- and double-petal varieties.
Table 1. Treatment of different plant growth regulators on single- and double-petal varieties.
Pomegranate VarietyPlant Growth RegulatorConcentration (mg/L)
Single-petal variety ‘Nldbh’NAA10
Single-petal variety ‘Nldbh’NAA50
Single-petal variety ‘Nldbh’NAA100
Single-petal variety ‘Nldbh’MeJA50
Single-petal variety ‘Nldbh’MeJA100
Single-petal variety ‘Nldbh’MeJA150
Single-petal variety ‘Nldbh’ABA50
Single-petal variety ‘Nldbh’ABA100
Single-petal variety ‘Nldbh’ABA150
Single-petal variety ‘Nldbh’ETH10
Single-petal variety ‘Nldbh’ETH50
Single-petal variety ‘Nldbh’ETH100
Single-petal variety ‘Nldbh’CK
Double-petal variety ‘Nlcbh’NAA10
Double-petal variety ‘Nlcbh’NAA50
Double-petal variety ‘Nlcbh’NAA100
Double-petal variety ‘Nlcbh’MeJA50
Double-petal variety ‘Nlcbh’MeJA100
Double-petal variety ‘Nlcbh’MeJA150
Double-petal variety ‘Nlcbh’ABA50
Double-petal variety ‘Nlcbh’ABA100
Double-petal variety ‘Nlcbh’ABA150
Double-petal variety ‘Nlcbh’ETH10
Double-petal variety ‘Nlcbh’ETH50
Double-petal variety ‘Nlcbh’ETH100
Double-petal variety ‘Nlcbh’CK
Note: NAA, naphthaleneacetic acid; MeJA, methyl jasmonate; ABA, abscisic acid; ETH, ethephon.
Table 2. Tissues for qRT-PCR collected from different plant growth regulator treatments.
Table 2. Tissues for qRT-PCR collected from different plant growth regulator treatments.
Treatment of Plant Growth RegulatorTissue
StSiStDoPeDoPeSi
NAA 10 mg/L
NAA 50 mg/L
NAA 100 mg/L
CK
MeJA 50 mg/L
MeJA 100 mg/L
MeJA 150 mg/L
NAA 10 mg/L
NAA 50 mg/L
NAA 100 mg/L
CK
Note: StSi means stamens of single-petal flowers, including normal stamens and petalized stamens. StDo means stamens of double-petal flowers, including normal stamens and petalized stamens. PeDo means petals of double-petal flowers, including normal petals and transitional petals. PeSi means petals of single-petal flowers, only including normal petals (Figure 1). NAA, naphthaleneacetic acid; MeJA, methyl jasmonate.
Table 3. Primer sequences of qRT-PCR.
Table 3. Primer sequences of qRT-PCR.
Gene NameUpstream Primer (5′–3′)Downstream Primer (5′–3′)
PgActinAGTCCTCTTCCAGCCATCTCCACTGAGCACAATGTTTCCA
YUCCTACCCGACCTACCCGACCAAGCGTTGAACCGAGGCTGGATGTC
LAX2CCTGCTGGCTACTCTGTATGTGTTCGCGTTGGCGTGGTTGAGGAG
JAR1GACCGAAGTGAAGGTTGGAGAAGAGCGGCGTGGAGTTGTGGAAGC
ILR1CTGGCGTTGTCGGTTACATCGGATGCTCCCATTCCACTCTCTCCTC
GH3.17CTGGCGGACTAATGGCAAGGCTCTCATCAGGGCTCGTGACCAC
ASRACACCACCACCTCTTCCACCACAGCCGACAGCCATCACCTCAG
ARFGAAACATGATGCCGATGCTTTGGGCAAGGCTTTGAGGAGTTCAGGGTAG
AIR12AACTGCTCCGACCTCCCGAAGCAGCGGTGAAGGCAATGGAGAG
Note: YUC: flavin-containing monooxygenase gene; ILR1: IAA-amino acid hydrolase gene; GH3.17: indole-3-acetic acid-amido synthetase gene; LAX2: auxin transporter gene; ARF: auxin response factor gene; AIR12: auxin-induced in root cultures protein gene; JAR1: jasmonic acid-amido synthetase gene; ASR: ABA stress ripening-induced protein gene. PgActin is used as the housekeeping gene.
Table 4. Effects of different growth regulators on NOPS and NOP of different flower types.
Table 4. Effects of different growth regulators on NOPS and NOP of different flower types.
TreatmentFlower TypeNumber of Petalized Stamens (NOPSs) per FlowerNumber of Petals (NOPs) per Flower
10 mg/L NAASingle-petal flower3.10 ± 0.16 Aa6.21 ± 0.07 Aa
50 mg/L NAASingle-petal flower 1.87 ± 0.21 Bb6.17 ± 0.05 ABab
100 mg/L NAASingle-petal flower0.13 ± 0.05 Cc6.17 ± 0.05 ABab
50 mg/L MeJASingle-petal flower0.00 ± 0.00 Cc6.10 ± 0.08 Abab
100 mg/L MeJASingle-petal flower0.00 ± 0.00 Cc6.00 ± 0.05 Bb
150 mg/L MeJASingle-petal flower 0.00 ± 0.00 Cc6.13 ± 0.05 Abab
50 mg/L ABASingle-petal flower 0.00 ± 0.00 Cc6.03 ± 0.05 Bb
100 mg/L ABASingle-petal flower0.00 ± 0.00 Cc6.03 ± 0.05 Bb
150 mg/L ABASingle-petal flower 0.00 ± 0.00 Cc6.00 ± 0.00 Bb
10 mg/L ETHSingle-petal flower0.00 ± 0.00 Cc6.07 ± 0.09 ABb
50 mg/L ETHSingle-petal flower0.00 ± 0.00 Cc6.03 ± 0.05 Bb
100 mg/L ETHSingle-petal flower0.00 ± 0.00 Cc6.07 ± 0.05 ABb
CKSingle-petal flower 0.00 ± 0.00 Cc6.03 ± 0.05 Bb
10 mg/L NAADouble-petal flower238.47 ± 9.08 ABa106.23 ± 4.32 Bb
50 mg/L NAADouble-petal flower205.20 ± 9.40 BCb99.97 ± 6.46 BCbc
100 mg/L NAADouble-petal flower174.00 ± 5.08 BCc72.133 ± 13.96 BCc
50 mg/L MeJADouble-petal flower 207.70 ± 17.68 Bb89.50 ± 9.70 BCbc
100 mg/L MeJADouble-petal flower254.93 ± 9.51 ABa148.00 ± 23.79 Aa
150 mg/L MeJADouble-petal flower208.00 ± 11.13 Bb132.97 ± 12.22 ABa
50 mg/L ABADouble-petal flower154.60 ± 25.77 Cc72.57 ± 19.26 BCc
100 mg/L ABADouble-petal flower 169.60 ± 20.56 BCc89.23 ± 12.55 BCbc
150 mg/L ABADouble-petal flower174.67 ± 13.65 BCc66.47 ± 7.92 Cc
10 mg/L ETHDouble-petal flower175.57 ± 14.26 BCc69.03 ± 14.18 Cc
50 mg/L ETHDouble-petal flower167.07 ± 17.64 Cc77.10 ± 7.29 BCc
100 mg/L ETHDouble-petal flower 238.47 ± 9.08 ABa106.23 ± 4.32 Bb
CKDouble-petal flower175.37 ± 3.18 BCc71.133 ± 12.75 BCc
Note: NAA, naphthaleneacetic acid; MeJA, methyl jasmonate; ABA, abscisic acid; ETH, ethephon. Single-petal flowers are grown on the single-petal variety ‘Nldbh’, and double-petal flowers are grown on the double-petal variety ‘Nlcbh’. Different lowercase letters in the same column represent significant differences (p < 0.05), and different uppercase letters in the same column indicate that the difference is highly significant (p < 0.01).
Table 5. Regression analysis of morphological index and expression level of hormone-related genes in different tissues under 10 mg/L NAA treatment.
Table 5. Regression analysis of morphological index and expression level of hormone-related genes in different tissues under 10 mg/L NAA treatment.
TreatmentIndexTissueGene NameRegression EquationSamplesPCCF ValueSig.
NAA 10 mg/LNOPSStSiYUCy = 0.003x + 0.01912 0.279 0.843 0.380
ILR1y = 0.022x + 0.04712 0.949 90.3460.000
GH3.17y = 0.006x + 0.03612 0.397 1.8670.202
LAX2y = 0.053x + 0.16112 0.888 37.4570.000
ARFy = 0.011x + 0.05112 0.799 17.6010.002
AIR12y = 0.039x + 0.12512 0.822 20.7570.001
JAR1y = 0.048x + 0.02612 0.831 22.3970.001
ASRy = −4.409x + 45.40012 0.548 4.295 0.065
NAA 10 mg/LNOPSStDoYUCy = 0.000x − 0.00812 0.325 1.181 0.303
ILR1y = 0.003x − 0.44412 0.90143.2120.000
GH3.17y = 0.000x − 0.00712 0.354 1.430 0.259
LAX2y = 0.008x − 1.04112 0.87833.5730.000
ARFy = 0.003x − 0.44812 0.908 47.229 0.000
AIR12y = 0.002x − 0.14112 0.705 9.860 0.011
JAR1y = 0.005x − 0.64812 0.770 14.610 0.003
ASRy = −0.133x + 62.25712 0.510 3.514 0.090
NAA 10 mg/LNOPPeDoYUCy = 0.000x + 0.02512 0.139 0.197 0.667
ILR1y = 0.003x − 0.10912 0.78315.8470.003
GH3.17y = 0.000x + 0.03912 0.180 1.334 0.576
LAX2y = 0.042x − 0.91712 0.6567.5720.020
ARFy = 0.006x − 0.22412 0.668 8.041 0.018
AIR12y = 0.002x − 0.00812 0.681 8.655 0.015
JAR1y = 0.005x − 0.12312 0.643 7.050 0.024
ASRy = −0.033x + 12.36012 0.375 1.638 0.230
NAA 10 mg/LNOPPeSiYUCy = −0.086x + 0.57212 0.310 1.060 0.327
ILR1y = 0.146x − 0.82512 0.417 2.107 0.177
GH3.17y = −0.060x + 0.42912 0.253 0.686 0.427
LAX2y = 1.048x − 5.97912 0.504 3.410 0.095
ARFy = 0.604x − 3.14212 0.559 4.535 0.059
AIR12y = 0.069x − 0.34512 0.224 0.530 0.483
JAR1y = 0.177x − 1.02312 0.509 3.500 0.091
ASRy = 2.114x + 4.43812 0.071 0.050 0.827
Note: NAA: naphthaleneacetic acid. NOPS means the number of petalized stamen, and NOP means the number of petal. StSi means stamens of single-petal flowers, including normal stamens and petalized stamens. StDo means stamens of double-petal flowers, including normal stamens and petalized stamens. PeDo means petals of double-petal flowers, including normal petals and transitional petals. PeSi means petals of single-petal flowers, only including normal petals (Figure 1). YUC: flavin-containing monooxygenase gene; ILR1: IAA-amino acid hydrolase gene; GH3.17: indole-3-acetic acid-amido synthetase gene; LAX2: auxin transporter gene; ARF: auxin response factor gene; AIR12: auxin-induced in root cultures protein gene; JAR1: jasmonic acid-amido synthetase gene; ASR: ABA stress ripening-induced protein gene.
Table 6. Regression analysis of morphological index and expression level of hormone-related genes in StDo and PeDo under 100 mg/L MeJA treatment.
Table 6. Regression analysis of morphological index and expression level of hormone-related genes in StDo and PeDo under 100 mg/L MeJA treatment.
TreatmentIndexTissueGene NameRegression EquationSamplesPCCF ValueSig.
MeJA 100 mg/LNOPSStDoYUCy = 0.000x + 0.064120.4913.170.105
ILR1y = 0.002x − 0.20212 0.726 11.120 0.008
GH3.17y = 0.0.001x − 0.06312 0.613 6.011 0.034
LAX2y = 0.007x − 0.97112 0.873 31.982 0.000
ARFy = 0.002x − 0.27412 0.824 21.093 0.001
AIR12y = 0.001x + 0.02212 0.386 1.748 0.216
JAR1y = 0.003x − 0.43812 0.884 35.839 0.000
ASRy = 0.118x + 10.25812 0.456 2.626 0.136
MeJA 100 mg/LNOPPeDoYUCy = 0.000x + 0.07112 0.449 2.520 0.144
ILR1y = 0.002x − 0.07712 0.820 20.477 0.001
GH3.17y = 0.001x + 0.01312 0.633 6.687 0.027
LAX2y = 0.023x − 0.29012 0.873 31.954 0.000
ARFy = 0.003x + 0.00412 0.718 10.619 0.009
AIR12y = 0.001x + 0.06112 0.541 4.147 0.069
JAR1y = 0.002x − 0.03312 0.766 14.179 0.004
ASRy = −0.206x + 61.61512 0.570 4.812 0.053
Note: MeJA: methyl jasmonate. NOPS means the number of petalized stamen and NOP means the number of petal. StDo means stamens of double-petal flowers, including normal stamens and petalized stamens. PeDo means petals of double-petal flowers, including normal petals and transitional petals (Figure 1). YUC: flavin-containing monooxygenase gene; ILR1: IAA-amino acid hydrolase gene; GH3.17: indole-3-acetic acid-amido synthetase gene; LAX2: auxin transporter gene; ARF: auxin response factor gene; AIR12: auxin-induced in root cultures protein gene; JAR1: jasmonic acid-amido synthetase gene; ASR: ABA stress ripening-induced protein gene.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Huo, Y.; Lu, F.; Mu, L.; Yang, H.; Ding, W.; Yuan, Z.; Zhu, Z. Plant Growth Regulators Promote Petaloidy and Modulate Related Gene Expression in Ornamental Pomegranate. Horticulturae 2025, 11, 1059. https://doi.org/10.3390/horticulturae11091059

AMA Style

Huo Y, Lu F, Mu L, Yang H, Ding W, Yuan Z, Zhu Z. Plant Growth Regulators Promote Petaloidy and Modulate Related Gene Expression in Ornamental Pomegranate. Horticulturae. 2025; 11(9):1059. https://doi.org/10.3390/horticulturae11091059

Chicago/Turabian Style

Huo, Yan, Fei Lu, Lili Mu, Han Yang, Wenjie Ding, Zhaohe Yuan, and Zunling Zhu. 2025. "Plant Growth Regulators Promote Petaloidy and Modulate Related Gene Expression in Ornamental Pomegranate" Horticulturae 11, no. 9: 1059. https://doi.org/10.3390/horticulturae11091059

APA Style

Huo, Y., Lu, F., Mu, L., Yang, H., Ding, W., Yuan, Z., & Zhu, Z. (2025). Plant Growth Regulators Promote Petaloidy and Modulate Related Gene Expression in Ornamental Pomegranate. Horticulturae, 11(9), 1059. https://doi.org/10.3390/horticulturae11091059

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop