Next Article in Journal
Predicting Sweet Pepper Yield Based on Fruit Counts at Multiple Ripeness Stages Monitored by an AI-Based System Mounted on a Pipe-Rail Trolley
Next Article in Special Issue
The Comprehensive Root Metabolite–Rhizomicrobiota Response Patterns of Rhododendron delavayi (R. delavayi) to Waterlogging Stress and Post–Waterlogging Recovery
Previous Article in Journal
The Influence of Storage Conditions and Fruit Quality Parameters on the Minimization of Surface Pitting in Sweet Cherries
Previous Article in Special Issue
Terpene Synthase (TPS) Family Member Identification and Expression Pattern Analysis in Flowers of Dendrobium chrysotoxum
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 11
Issue 7
10.3390/horticulturae11070717
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Pollen-Specific Promoter Analysis of the DIR Gene Family in Rosa chinensis

by
Qijing Dong
,
Qian Yang
,
Zitong Wang
,
Yuan Zhao
,
Sixu Guo
,
Yifang Peng
,
Qi Li
and
Yu Han
*
National Engineering Research Center for Floriculture, State Key Laboratory of Efficient Production of Forest Resources, Beijing Key Laboratory of Ornamental Plants Germplasm Innovation & Molecular Breeding, Beijing Laboratory of Urban and Rural Ecological Environment, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants, Ministry of Education, School of Landscape Architecture, Beijing Forestry University, Beijing 100083, China
*
Author to whom correspondence should be addressed.
Horticulturae 2025, 11(7), 717; https://doi.org/10.3390/horticulturae11070717
Submission received: 18 May 2025 / Revised: 16 June 2025 / Accepted: 17 June 2025 / Published: 20 June 2025
(This article belongs to the Special Issue Physiological and Molecular Biology of Ornamental Plants—2nd Edition)
Browse Figures
Versions Notes

Abstract

Dirigent proteins (DIRs) are pivotal regulators of lignin/lignan biosynthesis and play multifaceted roles in plant development and stress adaptation. Despite their functional significance, DIR genes remain unexplored in Rosa chinensis, a globally important woody ornamental species. This study identified 33 RcDIRs through whole-genome analysis, including their chromosomal distribution, phylogenetic relationships, collinearity, protein and gene structure, conserved motifs, and cis-acting element distribution, and classified them into three phylogenetically independent subgroups (DIR-a, DIR-b/d, and DIR-e). Notably, the DIR-e subgroup includes an exclusive tandem cluster comprising RcDIR7-RcDIR12, representing the largest lineage-specific RcDIR expansion in R. chinensis. Structural characterization revealed that most RcDIRs exhibit a conserved single-exon architecture. Promoter cis-element analysis uncovered abundant stress-/hormone-responsive elements and three pollen-specific motifs (AAATGA, POLLEN1LELAT52, GTGANTG10), with RcDIR12 from the DIR-e cluster showing high pollen-specific regulatory potential. Experimental validation included cloning the RcDIR12 promoter from R. chinensis ‘Old Blush’, constructing proRcDIR12::GUS vectors, and conducting histochemical GUS assays with pollen viability/DAPI staining in transgenic Arabidopsis. Histochemical assays demonstrated GUS activity localization in mature trinucleate pollen grains, marking the first experimental evidence of pollen-specific DIRs in rose. Our findings not only elucidate the DIR family’s genomic organization and evolutionary innovations in R. chinensis but also establish proRcDIR12 as a molecular tool for manipulating pollen development in plants.

1. Introduction

Rosa chinensis, a perennial woody plant of the genus Rosa, family Rosaceae, is known for its unique ornamental characteristics and significant economic value [1]. The modern R. chinensis is an interspecific hybrid developed in recent years, combining rich ornamental traits and agronomic significance, and is widely cultivated as an ornamental plant worldwide [2]. In plant sexual reproduction, normal pollen development is critical for achieving successful pollination and fruit set [3], while pollen viability and maturity directly determine the success rate of R. chinensis hybrid breeding. Studies demonstrate that pollen viability is a key factor influencing crossbreeding efficiency and fruiting rates in R. chinensis, with hybridization success rates significantly improving as pollen viability increases [4,5]. Although the importance of pollen in R. chinensis crossbreeding is widely acknowledged, research on pollen-specific promoters in this species remains scarce. Transcriptional regulation, a major mechanism of gene expression control, is coordinated by cis-acting elements (e.g., core promoters and enhancers) and trans-acting factors (e.g., transcription factors and co-regulators) [6]. In plants, pollen-specific promoters are essential for studying pollen development. For example, in Triticum aestivum, the pollen-specific promoter of Pollen-Specific Gene 076 (PSG076) was isolated and shown to drive GUS expression exclusively in late bicellular pollen to mature pollen stages and pollen tubes in transgenic tobacco, with no activity detected in other tissues [7]. In Oryza sativa, two late-stage pollen-specific promoters, pollen late-stage promoter 1 (PLP1) and pollen late-stage promoter 2 (PLP2), identified via a stable transformation system, activated GUS expression solely during late pollen development. Their activity and specificity were governed by specific promoter sequences and enhancer motifs such as ‘AGAAA’ and ‘CAAT’ [8].
Lignans are primarily found in conifers, while lignin is widely distributed in vascular plants. Dirigent proteins (DIRs) play a key role in the biosynthesis of lignin and lignans in plant cell walls, although their specific functions vary among different plants. DIRs were first identified in Forsythia intermedia, where they stereoselectively direct the coupling of two pinoresinol radical intermediates to form (+) or (−) pinoresinol, a key precursor for lignan biosynthesis [9,10]. To date, DIRs have been studied in various plants. For instance, in Zea mays, ZmDIR11 is upregulated under drought stress, and its silencing or mutation significantly reduces drought tolerance in maize, indicating its positive regulatory role in the drought stress response [11]. In Vitis vinifera, VvDIR4 enhances resistance to anthracnose in both Arabidopsis and grape by activating the SA/JA signaling pathway and promoting pathogen-induced lignin biosynthesis [12]. In Setaria italica, 38 SiDIR genes have been identified, with high expression in root tissues and responses to salt, heavy metals, and osmotic stress, suggesting their involvement in stress resistance and root development [13]. A total of 420 DIR genes have been identified in different rice species (cultivated and wild), with a significant expansion of members in cultivated rice. Their expression is responsive to various biotic and abiotic stresses and is enriched in roots, implying their potential role in environmental adaptation [14].
Studies have shown that dirigent proteins play an irreplaceable role in plant growth and development, cell structure maintenance, stress resistance enhancement, and secondary metabolism, especially in the lignin biosynthetic pathway [15]. Pollen walls are mainly composed of spore proteins and lignin; lignin may enhance the structural stability of pollen walls through interactions with spore proteins [16,17]. Although the functions of dirigent proteins have been explored in many studies, research on their promoters is still relatively scarce. In particular, the functions of DIRs in rose pollen development have not yet been revealed. In rose, pollen-specific promoters enable the precise genetic manipulation of male fertility traits without disrupting floral morphology—an essential feature for maintaining ornamental value. Furthermore, these promoters facilitate the study of the lineage-specific pollen development mechanisms underlying recurrent sterility in rose breeding populations. Screening for RcDIRs that are specifically expressed in pollen may provide important clues for uncovering their potential functions. This study aims to identify DIR genes in the rose genome and analyze their phylogeny, gene structure, and cis-acting elements, with the goal of thoroughly elucidating the rose DIR gene family and focusing on predicting the pollen-specific elements of RcDIR promoters. Based on this, a key RcDIR, named RcDIR12, was successfully predicted. Using the ancient rose cultivar ‘Old Blush’ as the material, the promoter sequence of RcDIR12 was cloned, and a pBI121-proRcDIR12::GUS expression vector was constructed. Through the genetic transformation of Arabidopsis thaliana, transgenic lines were obtained, and the specific expression sites of proRcDIR12 were explored. The above studies provide important reference information for further revealing the function of the RcDIR12 gene in rose pollen development and the application of the proRcDIR12 promoter.

2. Materials and Methods

2.1. Materials and Reagents

R. chinensis ‘Old Blush’ was grown in a greenhouse at Beijing Forestry University (Beijing, China, E 116°20′, N 40°0′) under the conditions of 25 °C day/18 °C dark, 12 h light/12 h dark, and 8000 lx light intensity. Wild-type A. thaliana (Columbia-0 ecotype) was grown in a growth chamber at 22 ± 2 °C with a photoperiod of 16 h light/8 h dark.

2.2. Identification and Chromosomal Localization of DIR Genes in R. chinensis

Twenty-five A. thaliana DIR sequences were downloaded from The Arabidopsis Information Resource (TAIR) website (http://www.arabidopsis.org/, accessed on 19 December 2024). Protein files of R. chinensis were obtained from the R. chinensis genome browser (https://lipm-browsers.toulouse.inra.fr/pub/RchiOBHm-V2/, accessed on 4 December 2024). The conserved domain of the DIR family protein (PF03018) was retrieved from the Pfam database (http://pfam-legacy.xfam.org/, accessed on 4 December 2024), and Hidden Markov Model (HMM) analysis and Protein Basic Local Alignment Search Tool (BLASTP) screening were performed. Specifically, HMMER search was conducted with an E-value threshold of 1 × 10−5 and a similarity threshold of >50%, while BLASTP was performed with an E-value threshold of 1 × 10−5 and an identity threshold of 50%. Initially, 34 RcDIRs were identified. Combining domain analysis and manual verification to remove proteins with incomplete domains, a total of 33 RcDIR gene family members were ultimately identified. The physicochemical properties of RcDIRs, including their number of amino acids, molecular weight, theoretical isoelectric point, instability index, hydropathy index, and aliphatic index, were calculated using the ExPASy tool (https://web.expasy.org/protparam/, accessed on 30 December 2024). Additionally, the subcellular localization of RcDIRs was predicted using the WoLF PSORT website (https://wolfpsort.hgc.jp/, accessed on 30 December 2024), and the chromosomal locations of RcDIRs were analyzed and visualized using TBtools-II (v2.210) software [18,19,20].

2.3. Phylogenetic Tree Construction and Collinearity Analysis of RcDIRs

The multiple sequence alignment of RcDIR and AtDIR sequences was performed using MEGA software (v11.0.13) [21]. Based on the alignment results, a phylogenetic tree of the DIR gene family was constructed using the Maximum Likelihood (ML) method, with parameters set to perform 1000 bootstrap replicates to assess the reliability of the tree topology. Subsequently, the phylogenetic tree was refined and annotated using iTOL (v7) (https://itol.embl.de/, accessed on 11 February 2025) [22]. The collinearity regions between the A. thaliana and R. chinensis genomes were analyzed and visualized using TBtools-II (v2.210) software.

2.4. Analysis of Gene Structure, Conserved Domains, Protein Structure, and Promoter Cis-Acting Elements of RcDIRs

The sequences of RcDIRs were aligned using the Jalview tool (v2.11.4.0) with the Muscle method [23]. Conserved motifs were analyzed using the MEME online tool (https://meme-suite.org/, accessed on 20 February 2025), with the number of motifs set to 10 and other parameters kept at the default values [24]. The gene structure features of RcDIR genes, including exon and intron distribution, were analyzed using the GSDS platform (v2.0) (http://gsds.cbi.pku.edu.cn/, accessed on 26 December 2024) [25]. The conserved motifs and gene structures of RcDIRs were visualized using TBtools-II (v2.210) software. We input the complete amino acid sequence of each target RcDIR. We use the default prediction mode of AlphaFold3 (https://alphafoldserver.com/, accessed on 24 March 2025) [26], which integrates sequence information and multiple sequence alignment (MSA) data. The accuracy of the structure is assessed using the pLDDT (predicted Local Distance Difference Test) and pTM (predicted Template Modeling score) provided by AlphaFold3, specifically determined as follows: very high (plDDT > 90), confident (90 > plDDT > 70), low (70 > pLDDT > 50), and very low (pLDDT < 50). A pTM score greater than 0.7 indicates higher confidence. After prediction, the structures were optimized and visualized using PyMOL (v2.6.0) software to clearly illustrate the overall structural features and important functional regions of the proteins [27]. To comprehensively analyze the promoter sequences of the RcDIR gene family, two different lengths of promoter regions were extracted from the genomic sequences. First, the nucleotide sequences 2000 bp upstream of each gene were extracted as promoter regions for the analysis of cis-acting regulatory elements. These promoter sequences were analyzed for the types, quantities, and functions of cis-acting elements using the PlantCARE website (https://bioinformatics.psb.ugent.be/webtools/plantcare/html, accessed on 19 February 2025) [28], and the results were graphically presented using R (v4.2.1).
To further investigate the regulatory elements associated with pollen-specific expression, promoter sequences 1200 bp upstream of the transcription start site were extracted from the genomic sequences of RcDIR gene family members. Based on the genomic annotation information, the orientation (sense or antisense strand) of each promoter sequence was determined. Subsequently, pollen-specific regulatory elements such as AGAAA and GTGA were specifically identified within these promoter sequences. The number of pollen-specific elements and their distribution on the sense and antisense strands were counted for each promoter sequence, and the results were compiled into a table.

2.5. Promoter Cloning and Expression Vector Construction

Genomic DNA was extracted from young leaves of R. chinensis ‘Old Blush’ using a plant DNA extraction kit (D6943-01, Omega Bio-Tek, Norcross, GA, USA). Based on the sequence information of the RcDIR12 gene (RchiOBHmChr2g0159671) provided by the R. chinensis genome database (https://lipm-browsers.toulouse.inra.fr/pub/RchiOBHm-V2/, accessed on 25 February 2025), primers for promoter cloning were designed (proRcDIR12-U: TGATTACGCCAAGCTTCTGACATATTAGCATTTGCTG; proRcDIR12-L: GACCACCCGGGGATCCCCAATTCAAAACAACATTGTA) to amplify the proRcDIR12 sequence. The specific promoter sequence was detailed in Table S1. The PCR system was performed according to the instructions of TOYOBO KOD-Plus (KOD-401, TOYOBO, Osaka, Japan). The PCR program was as follows: 94 °C for 5 min, 94 °C for 30 s, 56 °C for 30 s, and 72 °C for 1 min 30 s, for 32 cycles, and there was a 72 °C extension for 2 min. The PCR product was detected by 1% agarose gel electrophoresis, and the target band was recovered and purified using an Agarose Gel DNA Recovery Kit (DP209-02, Tiangen, Beijing, China) according to the instructions. The recovered product was ligated with pEASY®-Blunt (CB101-01, TransGen, Beijing, China), transformed into Trans1-T1 competent cells (CD501-02, TransGen, Beijing, China), and identified by PCR. The positive recombinant plasmid was sequenced by SinoGenoMax Company Limited (Beijing, China) and named pEASY-proRcDIR12. Hind III (R0104, NEB, lpswich, MA, USA) and BamH I (R0136, NEB, MA, USA) restriction enzymes were used to digest the recombinant plasmid pEASY-proRcDIR12 and the target vector pBI121 (stored in our laboratory). The digestion products were recovered and purified using the Agarose Gel DNA Recovery Kit (DP209-02, Tiangen, Beijing, China). The promoter fragment was ligated with the target vector using T4 DNA ligase (EL0011, Thermo Scientific™, Waltham, MA, USA) according to the instructions. The ligation product was transformed into Trans1-T1 E. coli competent cells, and positive clones were sequenced to obtain the recombinant expression vector pBI121-proRcDIR12::GUS.

2.6. Agrobacterium-Mediated Stable Genetic Transformation in A. thaliana

The recombinant vector pBI121-proRcDIR12::GUS was introduced into Agrobacterium tumefaciens AGL0 competent cells (AC1060, Weidibio, Shanghai, China). Positive colonies were identified by colony PCR, and selected colonies were cultured to an optical density at 600 nm (OD600) of 0.6 to 0.8. The recombinant Agrobacterium suspension was used to infect wild-type A. thaliana (Columbia, Col) using the floral dip method [29]. Seeds from the T0 generation were sown on MS medium containing kanamycin (Kan, 50 mg·L−1). After germination for 1 week, seedlings were transplanted to soil and grown for 4 weeks. Leaves were collected and genomic DNA was extracted using the Omega Tissue DNA Kit (D3396-02, Omega Bio-Tek, GA, USA). RT-PCR was performed to detect the presence of the transgene using the following primers: U: ATTTCACCCTTCAGATGG, and L: GTGTAGTTTGGGCTGGTT. The PCR system was conducted according to the instructions of TB Green® Premix Ex Taq™ II (RR420Q, Takara, Tokyo, Japan). The PCR program was 94 °C for 5 min, 94 °C for 30 s, 51 °C for 30 s, and 72 °C for 1 min, for 28 cycles, and 72 °C for 2 min. Seeds from positive plants were harvested and propagated to the T3 generation. Promoter GUS staining analysis was performed on T3 generation seedlings.

2.7. GUS Staining of the Transgenic A. thaliana

The experimental materials included 45-day-old wild-type A. thaliana and transgenic A. thaliana expressing the pBI121-proRcDIR12::GUS construct at 15, 25, and 45 days old. The GUS staining solution was prepared according to the instructions provided with the GUS staining kit (G3060, Solarbio, Beijing, China). The plant materials to be tested were immersed in the GUS staining solution and incubated at 37 °C in the dark for 24 h. Subsequently, the samples were decolorized with a gradient ethanol solution for 48 h, and the expression of GUS in the plants was observed and recorded.

2.8. Pollen Viability Staining (I-KI Method)

Anthers from stage 13 flowers of wild-type and transgenic A. thaliana were placed on a slide, and one drop of ddH2O was added [30]. The anthers were gently crushed with forceps to release pollen. One to two drops of I-KI staining solution (SL72602, Coolaber, Beijing, China) were added to completely submerge the pollen in the staining solution, as described in the product manual. The staining of pollen was observed under a Leica MZ10 F stereomicroscope (Leica Microsystems GmbH, Wetzlar, Germany). Pollen grains that appeared blue or black indicated strong viability; pollen grains that appeared brownish-yellow indicated some viability; and pollen grains that were colorless indicated no viability or sterility.

2.9. DAPI Staining

This section was conducted according to reference [31]. The DAPI working solution was prepared by mixing the stock solution (D9542, Sigma-Aldrich, Saint Louis, MO, USA) with buffer solution at a ratio of 1:1000 to 1:10,000. The DAPI working solution was placed on a slide, and flowers at stage 13 from both wild-type and transgenic A. thaliana were directly and evenly dipped into the staining solution. After the pollen grains fell into the staining solution, a cover slip was placed on top, and the slide was kept in the dark for 2 min. The development of pollen nuclei was observed using a Leica 2245 inverted fluorescence microscope (CKX941, Leica Microsystems GmbH, Wetzlar, Germany). DAPI staining allowed for a clear observation of the two sperm nuclei and one vegetative nucleus in normally mature pollen grains, thereby determining the developmental stage of the pollen nuclei.

3. Results

3.1. Identification and Physicochemical Property Analysis of the RcDIR Gene Family

A total of 33 RcDIR genes were identified in this study and were named RcDIR1 to RcDIR33 based on their chromosomal locations (Table 1). The length of amino acids in RcDIRs varied significantly, ranging from 167 to 413 with an average length of 203.55. The relative molecular weight (expressed in kD) of RcDIRs ranged from 18.67 to 42.57, with an average of 22.10 kD. Isoelectric point (pI) analysis showed that the pI values of RcDIRs ranged from 4.37 to 9.79, with an average of 7.66. Among them, 18 were basic proteins (pI > 7), and 15 were acidic proteins (pI < 7). The instability index (Instability Index Analysis, IIA) of RcDIRs ranged from 18.78 to 48.94, with an average value of 32.77. Only 4 RcDIRs (RcDIR1, RcDIR12, RcDIR17, and RcDIR21) were predicted to be unstable proteins, while the remaining 29 were stable proteins. The grand average of the hydropathicity (GRAVY) values of 25 RcDIRs were all greater than zero, indicating hydrophobic properties. Subcellular localization prediction results showed that more than 50% of RcDIRs were likely to be localized in the chloroplasts (Table 1). CDS sequences of the 33 RcDIRs identified in this study were presented in Table S1.

3.2. Chromosomal Distribution and Gene Cluster Formation of RcDIRs

Chromosomal localization analysis revealed that the 33 RcDIR genes are distributed across seven chromosomes of R. chinensis (Figure 1). The highest number of RcDIRs, a total of eight, are found on chromosome 2. Chromosomes 1, 3, and 5 each harbor four RcDIRs, while chromosome 4 contains two RcDIRs. Additionally, 29 of the RcDIRs (87.9% of the total) are organized into gene clusters on the chromosomes. Chromosome 1 carries two gene clusters, and chromosome 6 contains the largest tandem repeat cluster, which comprises six members (RcDIR7–RcDIR12). Chromosome 4 includes only one gene cluster, whereas chromosomes 2, 3, 5, and 7 each possess gene clusters with three to five members.

3.3. Phylogenetic Clustering, Structural Prediction, and Collinearity Analysis of the RcDIR Family

A phylogenetic tree was constructed using DIRs from both A. thaliana and R. chinensis. The analysis revealed that the 33 RcDIRs and 25 AtDIRs were clustered into three distinct subgroups: DIR-a, DIR-b/d, and DIR-e (Figure 2A). Different subgroups of dirigent proteins are known to have unique biological functions. Studies have shown that the DIR-a subgroup, which includes FiDIR1 from F. intermedia [9] and AtDIR5/AtDIR6 from A. thaliana [32], plays a key role in lignan biosynthesis through the stereoselective 8-8′ coupling of coniferyl alcohol. The DIR-b/d subgroup is involved in the enantioselective bimolecular coupling of coniferyl alcohol radicals and enantioselective oxidative coupling of sesquiterpene phenols such as (+)- or (−)-gossypol [33,34].
The DIR-a subgroup comprises seven R. chinensis members and five A. thaliana members, with some RcDIRs forming conserved clusters with the key lignin biosynthesis genes AtDIR5 and AtDIR6 from A. thaliana. The DIR-b/d subgroup is the largest, containing 15 RcDIRs and 14 AtDIRs, accounting for 50.0% of all members. The DIR-e subgroup includes 11 RcDIRs and six AtDIRs, with a significantly higher proportion of R. chinensis genes compared to A. thaliana. Subgroups DIR-c, DIR-f, and DIR-g were not detected in this study, with DIR-c being a subgroup specific to monocots [35].
It is worth noting that the DIR-e family is divided into two groups, one of which is RcDIR7-RcDIR12, and these genes are also located in the same gene cluster according to the chromosomal localization results. Figure 2B shows the secondary structure elements of the RcDIR7-12 proteins and their spatial distribution. Each protein is composed of a single polypeptide chain, with a highly conserved core folding pattern. All proteins exhibit a mixed secondary structure composed of α-helices (red), β-sheets (green), and random coils. The DIR domain (gold) is located in the N-terminal to the central region, forming a continuous gold block.
The collinearity analysis results indicate (Figure 2C) that there are 8 collinear pairs between the 33 DIRs of R. chinensis and the 25 DIRs of A. thaliana. Among them, RcDIR13 is collinear with AtDIR14, RcDIR17 with AtDIR12, RcDIR20 with AtDIR2, RcDIR24 with AtDIR19, and RcDIR13 with AtDIR8. Notably, RcDIR29 from R. chinensis shows collinearity with three different genes in A. thaliana (AtDIR4, AtDIR15, and AtDIR24).

3.4. Conservation of Domains and Gene Structure Analysis of RcDIRs

As shown in Figure 3A, the motif analysis of the RcDIR gene family reveals that members generally contain four to six motifs, whose distribution patterns are closely related to the phylogenetic grouping. Based on the topology of the phylogenetic tree, grouping is performed through the first major bifurcation, dividing the RcDIRs into four main groups, within which genes exhibit similar motif patterns. For instance, in the first group, all members except RcDIR19 contain motifs 1 through 5. Motifs 1, 2, and 3 are found in all four main groups, indicating that these motifs are widely distributed and highly conserved in RcDIR sequences. Multiple sequence alignments further reveal the conservation patterns of these motifs: motifs 1, 2, and 3 are universally present in all members (Figure 3B). However, certain motifs such as motif 8 and motif 9 are only found in specific groups, that is, the DIR-b/d subgroup; motif 7 is only present in the DIR-a subgroup; and motifs 6 and 10 are specifically found in the DIR-e subgroup. Additionally, apart from a few exceptions like RcDIR19 and RcDIR20, which contain two exons and one intron, the other RcDIRs only include one exon and lack introns, exhibiting a typical DIR gene structure (Figure 3A) [36].

3.5. Classification and Distribution of Cis-Acting Elements in the Promoters of RcDIRs

In this study, a total of 57 functional elements were identified and categorized into four major functional modules: light response (28 types), abiotic stress response (13 types), biotic stress response (9 types), and plant growth and development regulation (7 types) (Figure 4). The heatmap analysis results (left side of Figure 4) show that within the light response module, core regulatory elements such as G-Box, Box4, and I-box are widely distributed among RcDIR family members. Abiotic stress response elements mainly include Abscisic Acid Response Elements (ABREs), Antioxidant Response Elements (AREs), and MYB Transcription Factor Binding Sites (MBS I). In contrast, the distribution of elements in the biotic stress response and plant growth and development modules is relatively sparse, with no significant clustering observed. The element count statistics (right side of Figure 4) further confirm this distribution pattern, with the highest proportion of light response elements found in genes such as RcDIR21, RcDIR13, and RcDIR2, followed by abiotic stress, and the lowest proportion in biotic stress and growth and development.

3.6. Identification of Three Pollen-Specific Elements in the Promoters of the DIR Gene Family in R. chinensis

A systematic analysis was conducted to explore the distribution characteristics and potential functional associations of pollen-specific cis-acting elements in the promoter regions of RcDIR gene family members. Pollen-specificity was defined by the exclusive ability of these elements to drive expression in pollen tissues with undetectable activity in all non-pollen tissues. The results revealed the presence of three pollen-specific cis-acting elements in the promoter regions of the RcDIR gene family: AAATGA, POLLEN1LELAT52, and GTGANTG10 [37,38,39] (Table S2). The distribution of these three elements among the promoter regions of RcDIR gene family members showed significant variation. Taking the promoter of RcDIR12 as an example, it was identified to contain one AAATGA element, six POLLEN1LELAT52 elements, and nine GTGANTG10 elements. All RcDIR gene family members contained the POLLEN1LELAT52 element, and all but RcDIR13 and RcDIR14 contained the GTGANTG10 element. However, only a few members contained the AAATGA element, and they generally included only one of either AAATGA or TCATTT. Notably, the promoter of RcDIR24 contained the highest number of AAATGA elements, totaling seven; it also contained the highest number of GTGANTG10 elements, with sixteen. RcDIR6 and RcDIR17 had the highest number of POLLEN1LELAT52 elements, with 13 each. These differences suggest that the composition of pollen-specific cis-acting elements in the promoter regions of different members may be closely related to their roles in pollen development and function.

3.7. Specific Expression of proRcDIR12::GUS in Pollen of Transgenic A. thaliana

A recombinant expression vector, pBI121-proRcDIR12::GUS, was constructed (Figures S1 and S2). A. thaliana was infected using the floral dip method, and T3 transgenic plants were identified as positive by PCR (Figure S3). GUS histochemical staining results showed that, compared to wild-type A. thaliana, 45-day-old transgenic plants only stained at the flower bud site (Figure 5A,B), and only 25-day-old transgenic flower buds displayed a blue color (Figure 5C,D); other parts did not stain.
Microscopic analysis was carried out to localize the specific staining sites within the flower buds. Further refined GUS staining experiments on flowers from wild-type and proRcDIR12::GUS transgenic A. thaliana revealed that the proRcDIR12 promoter drove GUS expression in the anthers of 45-day-old transgenic plants (Figure 6A,B). Specifically, immature anthers in the bud did not turn blue (Figure 6C), anthers in semi-open flowers showed a slight blue color (Figure 6D), anthers in fully open flowers turned dark blue, and scattered pollen also appeared blue (Figure 6E). Additionally, when the siliques began to develop, the tips of the young siliques of proRcDIR12::GUS transgenic plants, which are the location of the original stigma, also turned blue due to pollen adhesion (Figure 6F,G).

3.8. Specific Expression of proRcDIR12::GUS in Mature Trinucleate Pollen

To investigate the expression of proRcDIR12::GUS in pollen, pollen viability staining and DAPI staining were performed on pollen at different developmental stages of transgenic A. thaliana. The results showed that most pollen grains of the transgenic A. thaliana were viable (Figure 7A–C), and pollen at the mononuclear, binuclear, and trinucleate stages could be distinguished (Figure 7D–F). GUS staining revealed no expression in mononuclear- and binuclear-stage pollen (Figure 7G,H), while blue coloration was observed in mature trinucleate pollen (Figure 7I), indicating that the GUS gene is specifically expressed in trinucleate pollen. In summary, proRcDIR12 can drive the specific expression of GUS in mature trinucleate pollen.

4. Discussion

The rose serves as the type plant for the Rosaceae family and holds significant importance for studying post-pollination floral performance and breeding [40]. During rose breeding, pollen viability, germination rate, and pollen tube growth are critical traits [41], with post-pollination pollen viability directly determining hybridization success rates [42]. Notably, pollen morphological characteristics not only influence the dispersal and fertilization efficiency of plants such as Bougainvillea but also provide key evidence for taxonomic research [43]. In A. thaliana, normal pollen morphological development, efficient germination capacity, and rapid directed pollen tube growth are considered key factors influencing double fertilization success [44,45,46].
DIRs are widely present in various plants, including ferns, gymnosperms, and angiosperms [47]. These proteins play multifaceted roles in plant growth and development, disease resistance, and stress tolerance. By regulating the synthesis of lignin and lignans, they enhance the structural stability of plant cell walls, thereby improving plant tolerance to biotic and abiotic stresses. For instance, overexpression of the GhDIR1 gene in G. hirsutum not only promotes the biosynthesis of lignans but also enhances resistance to Verticillium dahliae, thereby preventing the spread of the pathogen [48]. In A. thaliana, the loss of function of AtDIR10/ESB1 results in the impaired formation of the Casparian strip in the roots and the abnormal deposition of lignin and suberin [49]. The diversity and importance of these functions make DIRs significant targets in research on plant stress tolerance and growth and development. However, their specific functional networks in roses still need to be further analyzed.
This study comprehensively presents information on the amino acid length, molecular weight, isoelectric point, instability index, and hydrophobicity of the 33 RcDIRs. More than 50% of RcDIRs are predicted to be localized in the chloroplasts, suggesting that these genes may play important roles in photosynthesis or chloroplast-related metabolic processes. There is extensive collinearity between the DIR gene families of R. chinensis and A. thaliana, with highly conserved chromosomal positions and arrangement orders for some genes, reflecting the core functional constraints of these genes in plant development or environmental adaptation. The cis-acting element results indicate that each RcDIR gene contains at least three types of functional elements, with the highest frequency of light response and abiotic stress response elements. The frequency of biotic stress elements is relatively lower. Three genes (RcDIR15, RcDIR24, RcDIR31) lack elements related to growth and development. Notably, RcDIR30 contains the highest number of cis-acting elements, which may indicate its significant role in regulating various biological processes in plants.
The formation of gene clusters is usually associated with tandem duplication events, which are considered an important driving force for the expansion of gene families [50,51]. Studies have shown that tandemly duplicated gene clusters tend to form chromatin topological associating domains, which may facilitate the occurrence of tandem duplication events by promoting local chromatin interactions [52]. In the RcDIR gene family, the close arrangement patterns of different gene clusters suggest the key role of tandem duplication events in family expansion. Similar phenomena have been reported in the DIR gene families of Nicotiana tabacum and Solanum lycopersicum [53,54], and this mechanism may be a conserved evolutionary strategy for the functional divergence and enhanced environmental adaptability of plant DIR genes. The DIR-e subgroup has evolved stably across different species [55], and this subgroup includes ESB1, which plays a role in the construction of the Casparian strip by participating in lignin deposition, although its specific biochemical function has not been fully elucidated [49]. This study found that the DIR-e subgroup in R. chinensis contains an independent branch composed of RcDIR7-RcDIR12, and this branch is the largest tandem gene cluster in R. chinensis, possibly indicating that this branch has undergone a unique evolutionary process in R. chinensis, thereby acquiring species-specific functions. This unique evolution may enable it to play a key role in the specific physiological processes of R. chinensis, but its specific mechanism in pollen development still needs to be verified by experiments.
Hybrid breeding is the main breeding method for roses, and pollen sterility directly affects breeding efficiency and limits the cultivation of new hybrid rose varieties. Ensuring the maturity and fertility of pollen is one of the foundations for carrying out hybrid breeding work in roses, and research on the mechanism of pollen maturity in roses lays a theoretical foundation for this work. The development of anthers and pollen plays an important role in the biological processes of plant pollination and fruiting. Some genes that affect the formation of anthers and pollen are not only expressed in the anthers but also in other parts of the plant, such as the promoter of G. hirsutum casein kinase I (GhCKI), which is expressed in mature anthers but also in petals and sepals [56]. Some genes that show anther-specific expression, such as the auxin response factor 17 (ARF17), are expressed in the inner wall of the anther but not in the pollen, and the A. thaliana arf17 mutant exhibits defects in the lignification of the inner wall of the anther, leading to anther dehiscence defects [57]. Researchers have also found some genes, such as the G. hirsutum GhWRKY22 transcription factor, which are expressed in both mature and young pollen, but the expression is weaker in young pollen and stronger in mature pollen [58]. This study analyzed the promoter regions of RcDIRs and found that they contain multiple pollen-specific expression elements, including AAATGA, POLLEN1LELAT52, and GTGANTG10. Focusing on RcDIR12, a member of the tandem gene cluster RcDIR7-RcDIR12, this study found that proRcDIR12 is specifically expressed in mature trinucleate pollen and not expressed in other locations, suggesting that RcDIR12 may play an important role in the maturation process of plant pollen, providing a new perspective for the study of the mechanism of pollen maturity in roses. This study primarily focused on ‘Old Blush’ as the research subject. The conservation of proRcDIR12 activity across different rose varieties remains to be further validated. Additionally, although the proRcDIR12 sequence contains stress response elements, suggesting its potential involvement in stress response regulation, the systematic detection of RcDIR12 expression characteristics and promoter activity under various stress conditions has not yet been conducted. Further research is needed to explore its functional conservation across different varieties and stress conditions.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae11070717/s1, Figure S1: Agarose gel electrophoresis results of the constructed recombinant expression vector pBI121-proRcDIR12::GUS. Figure S2: Schematic representation of the recombinant expression vector pBI121-proRcDIR12::GUS. Figure S3: PCR identification of the proRcDIR12 promoter in transgenic Arabidopsis thaliana. Table S1. CDS sequences of the 33 RcDIRs and the RcDIR12 promoter sequence. Table S2: Pollen promoter elements of RcDIR gene family members.

Author Contributions

Conceptualization, Q.D. and Q.Y.; methodology, Z.W.; software, Y.Z.; validation, S.G., Y.P. and Q.L.; formal analysis, Y.H.; investigation, Q.D.; resources, Q.Y.; data curation, Q.D.; writing—original draft preparation, Q.D.; writing—review and editing, Q.L. and Y.H.; visualization, Y.Z.; supervision, Y.H.; project administration, Y.H.; funding acquisition, Y.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32471938, 31800594), China; the National Key Research and Development Project of China (2023YFD1200105), China; and the Beijing Natural Science Foundation (6174045), China.

Data Availability Statement

Data are contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Hibrand, S.L.; Ruttink, T.; Hamama, L.; Kirov, I.; Lakhwani, D.; Zhou, N.N.; Bourke, P.M.; Daccord, N.; Leus, L.; Schulz, D.; et al. A high-quality genome sequence of Rosa chinensis to elucidate ornamental traits. Nat. Plants 2018, 4, 473–484. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, Z.; Yang, T.; Liu, Y.; Wu, S.;  Sun, H.; Wu, J.; Li, Y.; Zheng, Y.; Ren, H.; Yang, Y.; et al. Haplotype-resolved genome assembly and resequencing provide insights into the origin and breeding of modern rose. Nat. Plants 2024, 10, 1659–1671. [Google Scholar] [CrossRef] [PubMed]
  3. Wei, S.; Ma, L. Comprehensive insight into tapetum-mediated pollen development in Arabidopsis thaliana. Cells 2023, 12, 247. [Google Scholar] [CrossRef]
  4. Kilic, T. Identifying successful combinations by fertility index in old garden roses and hybrid tea roses crosses. PeerJ 2023, 11, e15526. [Google Scholar] [CrossRef]
  5. NaRa, J.; Ki Young, P. Rose pollen management methods to improve productivity. Agronomy 2022, 12, 1285. [Google Scholar] [CrossRef]
  6. Haberle, V.; Stark, A. Eukaryotic core promoters and the functional basis of transcription initiation. Nat. Rev. Mol. Cell Biol. 2018, 19, 621–637. [Google Scholar] [CrossRef]
  7. Chen, L.; Miao, Y.; Wang, C.; Su, P.; Li, T.; Wang, R.; Hao, X.; Yang, G.; He, G.; Gao, C. Characterization of a novel pollen-specific promoter from wheat (Triticum aestivum L.). Plant Mol. Biol. Rep. 2012, 30, 1426–1432. [Google Scholar] [CrossRef]
  8. Yan, S.; Wang, Z.; Liu, Y.; Li, W.; Wu, F.; Lin, X.; Meng, Z. Functional architecture of two exclusively late stage pollen-specific promoters in rice (Oryza sativa L.). Plant Mol. Biol. 2015, 88, 415–428. [Google Scholar] [CrossRef]
  9. Davin, L.B.; Wang, H.B.; Crowell, A.L.; Bedgar, D.L.; Martin, D.M.; Sarkanen, S.; Lewis, N.G. Stereoselective bimolecular phenoxy radical coupling by an auxiliary (dirigent) protein without an active center. Science 1997, 275, 362–366. [Google Scholar] [CrossRef]
  10. Halls, S.C.; Lewis, N.G. Secondary and quaternary structures of the (+)-pinoresinol-forming dirigent protein. Biochemistry 2002, 41, 9455–9461. [Google Scholar] [CrossRef]
  11. Zhao, Z.; Guan, Y.; Qin, T.; Zheng, H.; Wang, H.; Xu, W.; Gu, W.; Yu, D.; Wei, J.; Hu, Y. A dirigent gene, ZmDIR11, positively regulates drought tolerance in maize. Agronomy 2025, 15, 604. [Google Scholar] [CrossRef]
  12. Zhang, Q.; Luo, N.; Dai, X.; Lin, J.; Ahmad, B.; Chen, Q.; Lei, Y.; Wen, Z. Ectopic and transient expression of VvDIR4 gene in Arabidopsis and grapes enhances resistance to anthracnose via affecting hormone signaling pathways and lignin production. BMC Genom. 2024, 25, 895. [Google Scholar] [CrossRef] [PubMed]
  13. Gong, L.; Li, B.; Zhu, T.; Xue, B. Genome-wide identification and expression profiling analysis of DIR gene family in Setaria italica. Front. Plant Sci. 2023, 14, 1243806. [Google Scholar] [CrossRef] [PubMed]
  14. Duan, W.; Xue, B.; He, Y.; Liao, S.; Li, X.; Li, X.; Liang, Y. Genome-wide identification and expression pattern analysis of dirigent members in the genus Oryza. Int. J. Mol. Sci. 2023, 24, 7189. [Google Scholar] [CrossRef]
  15. Panigua, C.; Bilkova, A.; Jackson, P.; Dabravolski, S.; Riber, W.; Didi, V.; Houser, J.; Gigli-Bisceglia, N.; Wimmerova, M.; Budínská, E.; et al. Dirigent proteins in plants: Modulating cell wall metabolism during abiotic and biotic stress exposure. J. Exp. Bot. 2017, 68, 3287–3301. [Google Scholar] [CrossRef]
  16. Yang, W.; Duan, H.; Yu, K.; Hou, S.; Kang, Y.; Wang, X.; Hao, J.; Liu, L.; Zhang, Y.; Luo, L.; et al. Integrative dissection of lignin composition in Tartary buckwheat seed hulls for enhanced dehulling efficiency. Adv. Sci. 2024, 11, e2400916. [Google Scholar] [CrossRef]
  17. Yuan, G.; Zou, T.; He, Z.; Xiao, Q.; Li, G.; Liu, S.; Xiong, P.; Chen, H.; Peng, K.; Zhang, X.; et al. SWOLLEN TAPETUM AND STERILITY 1 is required for tapetum degeneration and pollen wall formation in rice. Plant Physiol. 2022, 190, 352–370. [Google Scholar] [CrossRef]
  18. Khan, A.; Li, R.; Sun, J.; Ma, F.; Zhang, H.; Jin, J.; Ali, M.; Haq, S.; Wang, J.; Gong, Z.; et al. Genome-wide analysis of dirigent gene family in pepper (Capsicum annuum L.) and characterization of CaDIR7 in biotic and abiotic stresses. Sci. Rep. 2018, 8, 5500. [Google Scholar] [CrossRef]
  19. Horton, P.; Park, K.J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef]
  20. Chen, C.; Wu, Y.; Li, J.; Wang, X.; Zeng, Z.; Xu, J.; Liu, Y.; Feng, J.; Chen, H.; He, Y.; et al. TBtools-II: A “one for all, all for one” bioinformatics platform for biological big-data mining. Mol. Plant 2023, 16, 1733–1742. [Google Scholar] [CrossRef]
  21. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  22. Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v6: Recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res. 2024, 52, W78–W82. [Google Scholar] [CrossRef] [PubMed]
  23. Waterhouse, A.M.; Procter, J.B.; Martin, D.M.A.; Clamp, M.; Barton, G.J. Jalview Version 2—A multiple sequence alignment editor and analysis workbench. Bioinformatics 2009, 25, 1189–1191. [Google Scholar] [CrossRef]
  24. Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, W202–W208. [Google Scholar] [CrossRef]
  25. Hu, B.; Jin, J.; Guo, A.; Zhang, H.; Luo, J.; Gao, G. GSDS 2.0: An upgraded gene feature visualization server. Bioinformatics 2015, 31, 1296–1297. [Google Scholar] [CrossRef]
  26. Abramson, J.; Adler, J.; Dunger, J.; Evans, R.; Green, T.; Pritzel, A.; Ronneberger, O.; Willmore, L.; Ballard, A.J.; Bambrick, J.; et al. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 2024, 630, 493–500. [Google Scholar] [CrossRef]
  27. DeLano, W.L. Pymol: An open-source molecular graphics tool. CCP4 Newsl. Protein Crystallogr. 2002, 40, 82–92. [Google Scholar]
  28. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; de Peer, Y.V.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  29. Clough, S.J.; Bent, A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998, 16, 735–743. [Google Scholar] [CrossRef]
  30. Alvarez-Buylla, E.R.; Benítez, M.; Corvera-Poiré, A.; Chaos Cador, Á.; de Foltel, S.; Gamboa de Buen, A.; Garay-Arroyo, A.; García-Ponce, B.; Jaimes-Miranda, F.; Pérez-Ruiz, R.V.; et al. Flower development. Arab. Book 2010, 8, e127. [Google Scholar] [CrossRef]
  31. Ross, K.J.; Fransz, P.; Jones, G.H. A light microscopic atlas of meiosis in Arabidopsis thaliana. Chromosome Res. 1996, 4, 507–516. [Google Scholar] [CrossRef] [PubMed]
  32. Kim, K.-W.; Moinuddin, S.G.A.; Atwell, K.M.; Costa, M.A.; Davin, L.B.; Lewis, N.G. Opposite stereoselectivities of dirigent proteins in Arabidopsis and Schizandra species. J. Biol. Chem. 2012, 287, 33957–33972. [Google Scholar] [CrossRef] [PubMed]
  33. Effenberger, I.; Zhang, B.; Li, L.; Wang, Q.; Liu, Y.; Klaiber, I.; Pfannstiel, J.; Wang, Q.; Schaller, A. Dirigent proteins from cotton (Gossypium sp.) for the atropselective synthesis of gossypol. Angew. Chem. Int. Ed. 2015, 54, 14660–14663. [Google Scholar] [CrossRef] [PubMed]
  34. Lin, J.; Fang, X.; Li, J.; Chen, Z.; Wu, W.; Guo, X.; Liu, N.; Huang, J.; Chen, F.; Wang, L.; et al. Dirigent gene editing of gossypol enantiomers for toxicity-depleted cotton seeds. Nat. Plants 2023, 9, 605–615. [Google Scholar] [CrossRef]
  35. Corbin, C.; Drouet, S.; Markulin, L.; Auguin, D.; Lainé, É.; Davin, L.B.; Cort, J.R.; Lewis, N.G.; Hano, C. A genome-wide analysis of the flax (Linum usitatissimum L.) dirigent protein family: From gene identification and evolution to differential regulation. Plant Mol. Biol. 2018, 97, 73–101. [Google Scholar] [CrossRef]
  36. Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.-H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
  37. Weterings, K.; Schrauwen, J.; Wullems, G.; Twell, D. Functional dissection of the promoter of the pollen-specific gene NTP303 reveals a novel pollen-specific, and conserved cis-regulatory element. Plant J. 1995, 8, 55–63. [Google Scholar] [CrossRef]
  38. Manimaran, P.; Reddy, M.R.; Rao, T.B.; Mangrauthia, S.K.; Sundararam, R.M.; Balachandran, S.M. Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica. Plant Reprod. 2015, 28, 133–142. [Google Scholar] [CrossRef]
  39. Twell, D.; Yamaguchi, J.; Wing, R.A.; Ushiba, J.; McCormick, S. Promoter analysis of genes that are coordinately expressed during pollen development reveals pollen-specific enhancer sequences and shared regulatory elements. Genes Dev. 1991, 5, 496–507. [Google Scholar] [CrossRef]
  40. Caser, M.; Dente, F.; Ghione, G.; Mansuino, A.; Giovannini, A.; Scariot, V. Shortening of selection time of Rosa hybrida by in vitro culture of isolated embryos and immature seeds. Propag. Ornam. Plants. 2014, 14, 139–144. [Google Scholar]
  41. Nadeem, M.; Akond, M.; Riaz, A.; Qasim, M.; Younis, A.; Farooq, A. Pollen morphology and viability relates to seed production in hybrid roses. Plant Breed. Seed Sci. 2014, 68, 25–38. [Google Scholar] [CrossRef]
  42. Macovei, A.; Caser, M.; Donà, M.; Valassi, A.; Giovannini, A.; Carbonera, D.; Scariot, V.; Balestrazzi, A. Prolonged cold storage affects pollen viability and germination along with hydrogen peroxide and nitric oxide content in Rosa hybrida. Not. Bot. Hort. Agrobot. Cluj-Na 2016, 44, 6–10. [Google Scholar] [CrossRef]
  43. Tripathi, S.; Singh, S.; Roy, K.R. Pollen morphology of Bougainvillea (Nyctaginaceae): A popular ornamental plant of tropical and sub-tropical gardens of the world. Rev. Palaeobot. Palynol. 2017, 239, 31–46. [Google Scholar] [CrossRef]
  44. Honys, D.; Twell, D. Comparative analysis of the Arabidopsis pollen transcriptome. Plant Physiol. 2003, 132, 640–652. [Google Scholar] [CrossRef]
  45. Gibalová, A.; Reňák, D.; Matczuk, K.; Dupláková, N.; Cháb, D.; Twell, D.; Honys, D. AtbZIP34 is required for Arabidopsis pollen wall patterning and the control of several metabolic pathways in developing pollen. Plant Mol. Biol. 2009, 70, 581–601. [Google Scholar] [CrossRef]
  46. Vogler, F.; Schmalzl, C.; Englhart, M.; Bircheneder, M.; Sprunck, S. Brassinosteroids promote Arabidopsis pollen germination and growth. Plant Reprod. 2014, 27, 153–167. [Google Scholar] [CrossRef]
  47. Laurence, B.; Davin, M.; Jourden, A.; Patten, A. Dissection of lignin macromolecular configuration and assembly: Comparison to related biochemical processes in allyl/propenyl phenol and lignan biosynthesis. Nat. Prod. Rep. 2008, 25, 1015–1090. [Google Scholar]
  48. Shi, H.; Liu, Z.; Zhu, L.; Zhang, C.; Chen, Y.; Zhou, Y.; Li, F.; Li, X. Overexpression of cotton (Gossypium hirsutum) dirigent 1 gene enhances lignification that blocks the spread of Verticillium dahliae. Acta Biochim. Biophys. Sin. 2012, 44, 555–564. [Google Scholar] [CrossRef]
  49. Hosmani, P.S.; Kamiya, T.; Danku, J.; Salt, D.E. Dirigent domain-containing protein is part of the machinery required for formation of the lignin-based Casparian strip in the root. Proc. Natl. Acad. Sci. USA 2013, 110, 14498–14503. [Google Scholar] [CrossRef]
  50. Jiang, M.; Chu, Z. Comparative analysis of plant MKK gene family reveals novel expansion mechanism of the members and sheds new light on functional conservation. BMC Genom. 2018, 19, 407. [Google Scholar] [CrossRef]
  51. Qu, J.; Liu, L.; Guo, Z.; Li, X.; Pan, F.; Sun, D.; Yin, L. The ubiquitous position effect, synergistic effect of recent generated tandem duplicated genes in grapevine, and their co-response and overactivity to biotic stress. Fruit Res. 2023, 3, 16. [Google Scholar] [CrossRef]
  52. Ma, N.; Li, X.; Ci, D.; Zeng, H.; Zhang, C.; Xie, X.; Zhong, C.; Deng, X.W.; Li, D.; He, H. Chromatin topological domains associate with the rapid formation of tandem duplicates in plants. Nat. Commun. 2019, 10, 484. [Google Scholar] [CrossRef] [PubMed]
  53. Li, T.; Luo, W.; Du, C.; Lin, X.; Lin, G.; Chen, R.; He, H.; Wang, R.; Lu, L.; Xie, X. Functional and evolutionary comparative analysis of the DIR gene family in Nicotiana tabacum L. and Solanum tuberosum L. BMC Genom. 2024, 25, 671. [Google Scholar]
  54. Saddique, M.A.B.; Guan, G.; Hu, B.; Khan, M.; Amjad, M.D.; Abbas, S.; Hussain, Z.; Maqsood, M.F.K.; Luo, X.; Ren, M. Genome-wide computational analysis of the dirigent gene family in Solanum lycopersicum. Proteome Sci. 2024, 22, 10. [Google Scholar] [CrossRef]
  55. Liu, Z.; Wang, X.; Sun, Z.; Zhang, Y.; Meng, C.; Chen, B.; Wang, G.; Ke, H.; Wu, J.; Yan, Y.; et al. Evolution, expression and functional analysis of cultivated allotetraploid cotton DIR genes. BMC Plant Biol. 2021, 21, 89. [Google Scholar] [CrossRef]
  56. Li, Y.; Li, Y.; Su, Q.; Wu, Y.; Zhang, R.; Li, Y.; Ma, Y.; Ma, H.; Guo, X.; Zhu, L.; et al. High temperature induces male sterility via MYB66-MYB4-Casein kinase I signaling in cotton. Plant Physiol. 2022, 189, 2091–2109. [Google Scholar] [CrossRef]
  57. Xu, X.; Wang, B.; Feng, Y.; Xue, J.; Qian, X.; Liu, S.; Zhou, J.; Yu, Y.; Yang, N.; Xu, P.; et al. AUXIN RESPONSE FACTOR17 directly regulates MYB108 for anther dehiscence. Plant Physiol. 2019, 181, 645–655. [Google Scholar] [CrossRef]
  58. Wang, Y.; Li, Y.; He, S.; Gao, Y.; Wang, N.; Lu, R.; Li, X. A cotton (Gossypium hirsutum) WRKY transcription factor (GhWRKY22) participates in regulating anther/pollen development. Plant Physiol. Biochem. 2019, 141, 231–239. [Google Scholar] [CrossRef]
Horticulturae 11 00717 g001
Figure 1. Chromosomal localization map shows the positions of RcDIRs. The labeled genes are arranged from top to bottom on the R. chinensis chromosomes, with chromosome numbers indicated at the top of each chromosome. The colors in the figure represent gene density, with lighter colors indicating low gene density and darker colors indicating high gene density.
Figure 1. Chromosomal localization map shows the positions of RcDIRs. The labeled genes are arranged from top to bottom on the R. chinensis chromosomes, with chromosome numbers indicated at the top of each chromosome. The colors in the figure represent gene density, with lighter colors indicating low gene density and darker colors indicating high gene density.
Horticulturae 11 00717 g001
Horticulturae 11 00717 g002
Figure 2. Phylogenetic evolution, protein structure, and collinearity analysis of the DIR family genes in R. chinensis. (A) Phylogenetic tree of the DIR family genes from R. chinensis and A. thaliana. Subgroups DIR-a, DIR-b/d, and DIR-e are indicated with green, orange-red, and yellow backgrounds, respectively. Specific colors are used to distinguish between different species: AtDIRs are marked with blue pentagons, and RcDIRs are marked with red circles. (B) Three-dimensional structural models of the RcDIR family members and their DIR domains. Red represents α-helices, green represents β-sheets, and gold represents the DIR domain. (C) Collinearity analysis of DIR genes between R. chinensis and A. thaliana. The gray lines in the background represent collinear pairs in the genomes of R. chinensis and A. thaliana; red lines represent collinear DIR gene pairs. “Chr1-7” denotes chromosome numbers.
Figure 2. Phylogenetic evolution, protein structure, and collinearity analysis of the DIR family genes in R. chinensis. (A) Phylogenetic tree of the DIR family genes from R. chinensis and A. thaliana. Subgroups DIR-a, DIR-b/d, and DIR-e are indicated with green, orange-red, and yellow backgrounds, respectively. Specific colors are used to distinguish between different species: AtDIRs are marked with blue pentagons, and RcDIRs are marked with red circles. (B) Three-dimensional structural models of the RcDIR family members and their DIR domains. Red represents α-helices, green represents β-sheets, and gold represents the DIR domain. (C) Collinearity analysis of DIR genes between R. chinensis and A. thaliana. The gray lines in the background represent collinear pairs in the genomes of R. chinensis and A. thaliana; red lines represent collinear DIR gene pairs. “Chr1-7” denotes chromosome numbers.
Horticulturae 11 00717 g002
Horticulturae 11 00717 g003
Figure 3. Structural characterization analysis of the RcDIR gene family in R. chinensis. (A) Phylogenetic tree, conserved motifs, and exon–intron structure of RcDIRs. Each motif (motif 1 to motif 10) is represented by a distinct color. A scale bar is shown at the bottom of the figure, and gene names are labeled on the left side, arranged according to their subgroup affiliations. Yellow bars represent exons, lines represent introns, and blue bars represent non-coding regions. (B) Amino acid sequence alignment and conservation analysis of DIR family members in R. chinensis. Each row in the figure represents the amino acid sequence of a family member, with sequence names listed on the left. Letters in different colors indicate amino acids of different properties: red for hydrophobic amino acids, blue for hydrophilic amino acids, green for acidic amino acids, and yellow for basic amino acids. Multiple conserved motifs (motif 1 to motif 10) are highlighted with colored boxes, which are highly conserved among different family members.
Figure 3. Structural characterization analysis of the RcDIR gene family in R. chinensis. (A) Phylogenetic tree, conserved motifs, and exon–intron structure of RcDIRs. Each motif (motif 1 to motif 10) is represented by a distinct color. A scale bar is shown at the bottom of the figure, and gene names are labeled on the left side, arranged according to their subgroup affiliations. Yellow bars represent exons, lines represent introns, and blue bars represent non-coding regions. (B) Amino acid sequence alignment and conservation analysis of DIR family members in R. chinensis. Each row in the figure represents the amino acid sequence of a family member, with sequence names listed on the left. Letters in different colors indicate amino acids of different properties: red for hydrophobic amino acids, blue for hydrophilic amino acids, green for acidic amino acids, and yellow for basic amino acids. Multiple conserved motifs (motif 1 to motif 10) are highlighted with colored boxes, which are highly conserved among different family members.
Horticulturae 11 00717 g003
Horticulturae 11 00717 g004
Figure 4. Analysis of cis-acting elements in the promoter regions of RcDIR gene family members. The table on the left side lists the presence of specific cis-acting elements in the promoter regions of each gene family member, with the shade of color indicating the frequency of occurrence of each element. The types of elements include abiotic stress (red), biotic stress (green), light responsiveness (cyan), and plant growth and development elements (purple).
Figure 4. Analysis of cis-acting elements in the promoter regions of RcDIR gene family members. The table on the left side lists the presence of specific cis-acting elements in the promoter regions of each gene family member, with the shade of color indicating the frequency of occurrence of each element. The types of elements include abiotic stress (red), biotic stress (green), light responsiveness (cyan), and plant growth and development elements (purple).
Horticulturae 11 00717 g004
Horticulturae 11 00717 g005
Figure 5. Tow-type Arabidopsis GUS staining (Bar = 1 cm). (A) Wild-type plants; (B) 45-day-old proRcDIR12::GUS transgenic Arabidopsis; (C) 25-day-old proRcDIR12::GUS transgenic Arabidopsis; (D) 15-day-old proRcDIR12::GUS transgenic Arabidopsis. Arrows in panels (B,C) indicate blue-stained floral buds.
Figure 5. Tow-type Arabidopsis GUS staining (Bar = 1 cm). (A) Wild-type plants; (B) 45-day-old proRcDIR12::GUS transgenic Arabidopsis; (C) 25-day-old proRcDIR12::GUS transgenic Arabidopsis; (D) 15-day-old proRcDIR12::GUS transgenic Arabidopsis. Arrows in panels (B,C) indicate blue-stained floral buds.
Horticulturae 11 00717 g005
Horticulturae 11 00717 g006
Figure 6. GUS staining of wild-type and proRcDIR12::GUS transgenic Arabidopsis (Bar = 1 cm). (A) GUS staining of wild-type Arabidopsis inflorescences; (B) proRcDIR12::GUS transgenic Arabidopsis inflorescence GUS staining; (C) proRcDIR12::GUS staining of transgenic Arabidopsis bracts; (D) proRcDIR12::GUS staining of transgenic Arabidopsis primary-flowering flowers; (E) proRcDIR12::GUS transgenic Arabidopsis anther GUS staining; (F) proRcDIR12::GUS staining for the initiation of GUS transgenic Arabidopsis horn fruit development; (G) proRcDIR12::GUS staining with GUS staining of young Arabidopsis horn fruit with stigma pollen.
Figure 6. GUS staining of wild-type and proRcDIR12::GUS transgenic Arabidopsis (Bar = 1 cm). (A) GUS staining of wild-type Arabidopsis inflorescences; (B) proRcDIR12::GUS transgenic Arabidopsis inflorescence GUS staining; (C) proRcDIR12::GUS staining of transgenic Arabidopsis bracts; (D) proRcDIR12::GUS staining of transgenic Arabidopsis primary-flowering flowers; (E) proRcDIR12::GUS transgenic Arabidopsis anther GUS staining; (F) proRcDIR12::GUS staining for the initiation of GUS transgenic Arabidopsis horn fruit development; (G) proRcDIR12::GUS staining with GUS staining of young Arabidopsis horn fruit with stigma pollen.
Horticulturae 11 00717 g006
Horticulturae 11 00717 g007
Figure 7. ProRcDIR12::GUS transgenic Arabidopsis pollen staining at three periods. (A–C) Pollen viability staining at three nuclear stages of proRcDIR12::GUS transgenic Arabidopsis. (A) Primary nuclear pollen; (B) dinuclear pollen; (C) trinuclear pollen. (D–F) DAPI staining of pollen at three nuclear stages of proRcDIR12::GUS transgenic Arabidopsis. (D) Primary nuclear pollen; (E) dinuclear pollen; (F) trinuclear pollen. (G–I) GUS staining of pollen at three nuclear stages of proRcDIR12::GUS transgenic Arabidopsis. (G) Primary nuclear pollen, (H) dinuclear pollen, (I) trinuclear pollen. Arrows in panels (A–C,G–I) indicate pollen grains.
Figure 7. ProRcDIR12::GUS transgenic Arabidopsis pollen staining at three periods. (A–C) Pollen viability staining at three nuclear stages of proRcDIR12::GUS transgenic Arabidopsis. (A) Primary nuclear pollen; (B) dinuclear pollen; (C) trinuclear pollen. (D–F) DAPI staining of pollen at three nuclear stages of proRcDIR12::GUS transgenic Arabidopsis. (D) Primary nuclear pollen; (E) dinuclear pollen; (F) trinuclear pollen. (G–I) GUS staining of pollen at three nuclear stages of proRcDIR12::GUS transgenic Arabidopsis. (G) Primary nuclear pollen, (H) dinuclear pollen, (I) trinuclear pollen. Arrows in panels (A–C,G–I) indicate pollen grains.
Horticulturae 11 00717 g007
Table 1. Identification and physicochemical properties of the 33 RcDIRs in R. chinensis.
Table 1. Identification and physicochemical properties of the 33 RcDIRs in R. chinensis.
Gene NameGene IDNumber of Amino AcidMolecular Weight (kDa)Theoretical pIInstabilityAliphatic IndexGrand Average of HydropathicitySubcellular Localization
RcDIR1RchiOBHmChr1g031965118420.198.7642.0183.260.127extracellular
RcDIR2RchiOBHmChr1g031966118720.765.9234.5688.070.159extracellular
RcDIR3RchiOBHmChr1g036539141342.574.3739.7187.36−0.012vacuole
RcDIR4RchiOBHmChr1g036540129330.835.0532.0882.870.024chloroplast
RcDIR5RchiOBHmChr2g009736118920.379.5220.9294.920.072chloroplast
RcDIR6RchiOBHmChr2g012529130932.045.0827.5782.69−0.058chloroplast
RcDIR7RchiOBHmChr2g015883117719.259.3339.4795.310.119chloroplast
RcDIR8RchiOBHmChr2g015884113114.369.5228.7393.740.051chloroplast
RcDIR9RchiOBHmChr2g015886120522.218.8530.2794.630.307chloroplast
RcDIR10RchiOBHmChr2g015889117919.589.1324.7994.690.134chloroplast
RcDIR11RchiOBHmChr2g015891117819.286.1032.4996.970.206extracellular
RcDIR12RchiOBHmChr2g015967118019.549.1237.3085.000.093chloroplast
RcDIR13RchiOBHmChr3g047899119421.019.7525.2597.010.134chloroplast
RcDIR14RchiOBHmChr3g047901117018.459.7948.9476.82−0.106nucleus
RcDIR15RchiOBHmChr3g047903119721.409.5941.7678.680.043cytoplasm
RcDIR16RchiOBHmChr3g048030118420.836.9533.5586.360.024chloroplast
RcDIR17RchiOBHmChr4g039661125025.815.8141.60100.240.274chloroplast
RcDIR18RchiOBHmChr4g039662124925.585.0136.0789.000.117extracellular
RcDIR19RchiOBHmChr5g008064117519.669.3934.1096.34−0.025chloroplast
RcDIR20RchiOBHmChr5g008144119621.707.9636.4693.010.048chloroplast
RcDIR21RchiOBHmChr5g008145119621.726.9740.3592.550.033vacuole
RcDIR22RchiOBHmChr5g008146119421.526.5930.4592.940.059vacuole
RcDIR23RchiOBHmChr6g024455119121.508.9337.3787.70.108extracellular
RcDIR24RchiOBHmChr6g024456118619.805.4321.1086.510.114extracellular
RcDIR25RchiOBHmChr6g024457123325.346.6538.3382.45−0.072chloroplast
RcDIR26RchiOBHmChr6g024458118719.995.5524.1385.610.082chloroplast
RcDIR27RchiOBHmChr6g024459119121.109.4631.6676.60−0.165chloroplast
RcDIR28RchiOBHmChr6g024460119221.299.7829.2581.30−0.140chloroplast
RcDIR29RchiOBHmChr7g019599118420.985.9134.2476.3−0.037extracellular
RcDIR30RchiOBHmChr7g019600118020.226.1732.3483.50.163chloroplast
RcDIR31RchiOBHmChr7g019601118520.648.492289.140.105chloroplast
RcDIR32RchiOBHmChr7g019603119121.269.2118.7881.20.005chloroplast
RcDIR33RchiOBHmChr7g019604116718.678.5633.7281.260.043chloroplast
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Dong, Q.; Yang, Q.; Wang, Z.; Zhao, Y.; Guo, S.; Peng, Y.; Li, Q.; Han, Y. Genome-Wide Identification and Pollen-Specific Promoter Analysis of the DIR Gene Family in Rosa chinensis. Horticulturae 2025, 11, 717. https://doi.org/10.3390/horticulturae11070717

AMA Style

Dong Q, Yang Q, Wang Z, Zhao Y, Guo S, Peng Y, Li Q, Han Y. Genome-Wide Identification and Pollen-Specific Promoter Analysis of the DIR Gene Family in Rosa chinensis. Horticulturae. 2025; 11(7):717. https://doi.org/10.3390/horticulturae11070717

Chicago/Turabian Style

Dong, Qijing, Qian Yang, Zitong Wang, Yuan Zhao, Sixu Guo, Yifang Peng, Qi Li, and Yu Han. 2025. "Genome-Wide Identification and Pollen-Specific Promoter Analysis of the DIR Gene Family in Rosa chinensis" Horticulturae 11, no. 7: 717. https://doi.org/10.3390/horticulturae11070717

APA Style

Dong, Q., Yang, Q., Wang, Z., Zhao, Y., Guo, S., Peng, Y., Li, Q., & Han, Y. (2025). Genome-Wide Identification and Pollen-Specific Promoter Analysis of the DIR Gene Family in Rosa chinensis. Horticulturae, 11(7), 717. https://doi.org/10.3390/horticulturae11070717

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop