Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification and Characterization of CIPK Family Members in Jasmine
2.2. Phylogenetic Analysis and Chromosomal Mapping of JsCIPKs
2.3. Analysis of Conserved Motifs and Domains of the Jasmine CIPK Family
2.4. Analysis of CIPK Gene Distribution and Collinearity in Jasmine
2.5. Prediction of Cis-Elements in the Jasmine CIPK Gene
2.6. Analysis of the Expression Patterns of CIPK Genes in Jasmine
2.7. Expression Analysis of JsCIPK Genes Under Salt Stress
2.8. Statistical Analyses
3. Results
3.1. Identification of Members of the Jasmine CIPK Family
3.2. Phylogenetic Analysis of the CIPK Gene Family in Jasmine
3.3. Gene Structure and Conserved Motifs of JsCIPKs
3.4. Collinearity Analysis of Jasmine CIPK Gene Family
3.5. Analysis of Cis-Elements of CIPK Gene Family Members in Jasmine
3.6. Expression Analysis of JsCIPK Genes
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Xiong, L.Z.; Yang, Y.N. Disease resistance and abiotic stress tolerance in rice are inversely modulated by an abscisic acid-inducible mitogen-activated protein kinase. Plant Cell 2003, 15, 745–759. [Google Scholar] [CrossRef]
- Su, W.H.; Ren, Y.J.; Wang, D.J.; Huang, L.; Fu, X.Q.; Ling, H.; Su, Y.C.; Huang, N.; Tang, H.C.; Xu, L.P.; et al. New insights into the evolution and functional divergence of the CIPK gene family in Saccharum. BMC Genom. 2020, 21, 868. [Google Scholar] [CrossRef] [PubMed]
- Niu, L.L.; Dong, B.Y.; Song, Z.H.; Meng, D.; Fu, Y.J. Genome-wide identification and characterization of CIPK family and analysis responses to various stresses in apple (Malus domestica). Int. J. Mol. Sci. 2018, 19, 2131. [Google Scholar] [CrossRef]
- Sanders, D.; Pelloux, J.; Brownlee, C.; Harper, J.F. Calcium at the crossroads of signaling. Plant Cell 2002, 14 (Suppl. 1), S401–S417. [Google Scholar] [CrossRef]
- Yu, Y.H.; Xia, X.L.; Yin, W.L.; Zhang, H.C. Comparative genomic analysis of CIPK gene family in Arabidopsis and Populus. Plant Growth Regul. 2007, 52, 101–110. [Google Scholar] [CrossRef]
- Chen, X.; Gu, Z.; Xin, D.; Hao, L.; Liu, C.; Huang, J.; Ma, B.; Zhang, H. Identification and characterization of putative CIPK genes in maize. J. Genet. Genom. 2011, 38, 77–87. [Google Scholar] [CrossRef]
- Luan, S.; Lan, W.Z.; Lee, S.C. Potassium nutrition, sodium toxicity, and calcium signaling: Connections through the CBL-CIPK network. Curr. Opin. Plant Biol. 2009, 12, 339–346. [Google Scholar] [CrossRef] [PubMed]
- Dong, Q.; Wallrad, L.; Almutairi, B.O.; Kudla, J. Ca2+ signaling in plant responses to abiotic stresses. J. Integr. Plant Biol. 2022, 64, 287–300. [Google Scholar] [CrossRef]
- Albrecht, V.; Weinl, S.; Blazevic, D.; D’Angelo, C.; Batistic, O.; Kolukisaoglu, U.; Bock, R.; Schulz, B.; Harter, K.; Kudla, J. The calcium sensor CBL1 integrates plant responses to abiotic stresses. Plant J. 2003, 36, 457–470. [Google Scholar] [CrossRef]
- Hu, W.; Xia, Z.Q.; Yan, Y.; Ding, Z.H.; Tie, W.W.; Wang, L.Z.; Zou, M.L.; Wei, Y.X.; Lu, C.; Hou, X.W.; et al. Genome-wide gene phylogeny of CIPK family in cassava and expression analysis of partial drought-induced genes. Front. Plant Sci. 2015, 6, 914. [Google Scholar] [CrossRef]
- Albrecht, V.; Ritz, O.; Linder, S.; Harter, K.; Kudla, J. The NAF domain defines a novel protein-protein interaction module conserved in Ca2+-regulated kinases. EMBO J. 2001, 20, 1051–1063. [Google Scholar] [CrossRef]
- Kolukisaoglu, U.; Weinl, S.; Blazevic, D.; Batistic, O.; Kudla, J. Calcium sensors and their interacting protein kinases: Genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiol. 2004, 134, 43–58. [Google Scholar] [CrossRef]
- Xiang, Y.; Huang, Y.; Xiong, L. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiol. 2007, 144, 1416–1428. [Google Scholar] [CrossRef] [PubMed]
- Xi, Y.; Liu, J.; Dong, C.; Cheng, Z.M. The CBL and CIPK Gene Family in Grapevine (Vitis vinifera): Genome-wide analysis and expression profiles in response to various abiotic stresses. Front. Plant Sci. 2017, 8, 978. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Gai, W.X.; Qiao, Y.M.; Ali, M.; Wei, A.M.; Luo, D.X.; Li, Q.H.; Gong, Z.H. Identification of CBL and CIPK gene families and functional characterization of CaCIPK1 under Phytophthora capsici in pepper (Capsicum annuum L.). BMC Genom. 2019, 20, 775. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.F.; Liu, W.Z.; Li, H.W.; Wang, L.Y.; Deng, M.; Liang, W.W.; Deyholos, M.K.; Jiang, Y.Q. Identification and characterization of CBL and CIPK gene families in canola (Brassica napus L.). BMC Plant Biol. 2014, 14, 8. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhou, X.N.; Liu, S.Y.; Yu, A.Z.; Yang, C.M.; Chen, X.L.; Liu, J.Y.; Wang, A.X. Identification and functional analysis of tomato CIPK gene family. Int. J. Mol. Sci. 2019, 21, 110. [Google Scholar] [CrossRef]
- Li, J.; Jiang, M.M.; Ren, L.; Liu, Y.; Chen, H.Y. Identification and characterization of CBL and CIPK gene families in eggplant (Solanum melongena L.). Mol. Genet. Genom. 2016, 291, 1769–1781. [Google Scholar] [CrossRef] [PubMed]
- Hu, D.G.; Ma, Q.J.; Sun, C.H.; Sun, M.H.; You, C.X.; Hao, Y.J. Overexpression of MdSOS2L1, a CIPK protein kinase, increases the antioxidant metabolites to enhance salt tolerance in apple and tomato. Physiol. Plant. 2016, 156, 201–214. [Google Scholar] [CrossRef]
- Tang, R.J.; Liu, H.; Bao, Y.; Lv, Q.D.; Yang, L.; Zhang, H.X. The woody plant poplar has a functionally conserved salt overly sensitive pathway in response to salinity stress. Plant Mol. Biol. 2010, 74, 367–380. [Google Scholar] [CrossRef]
- Deng, X.M.; Zhou, S.Y.; Hu, W.; Feng, J.L.; Zhang, F.; Chen, L.H.; Huang, C.; Luo, Q.C.; He, Y.Z.; Yang, G.X.; et al. Ectopic expression of wheat TaCIPK14, encoding a calcineurin B-like protein-interacting protein kinase, confers salinity and cold tolerance in tobacco. Physiol. Plant. 2013, 149, 367–377. [Google Scholar] [CrossRef]
- Tang, W.; Thompson, W.A. Role of the Arabidopsis calcineurin B-like protein-interacting protein kinase CIPK21 in plant cold stress tolerance. Plant Biotechnol. Rep. 2020, 14, 275–291. [Google Scholar] [CrossRef]
- Yan, S.H.; Ji, J.; Wang, G. Effects of salt stress on plants and the mechanism of salt tolerance. World Sci.-Technol. Rearch Dev. 2006, 28, 70–76. [Google Scholar]
- Papastylianou, P.; Bakogianni, N.N.; Travlos, I. Sensitivity of seed germination to salt stress in black cumin (Nigella sativa L.). Not. Bot. Horti Agrobot. Cluj-Napoca 2018, 46, 202–205. [Google Scholar] [CrossRef]
- Tang, Y.J.; Gao, F.L.; Yang, Z.; Wu, Z.J.; Yang, L. Complete genome analysis of jasmine virus T from Jasminum sambac in China. Arch. Virol. 2016, 161, 2033–2036. [Google Scholar] [CrossRef]
- Mistry, J.; Finn, R.D.; Eddy, S.R.; Bateman, A.; Punta, M. Challenges in homology search: HMMER3 and convergent evolution of coiled-coil regions. Nucleic Acids Res. 2013, 41, e121. [Google Scholar] [CrossRef]
- Tusnády, G.E.; Kalmár, L.; Hegyi, H.; Tompa, P.; Simon, I. TOPDOM: Database of domains and motifs with conservative location in transmembrane proteins. Bioinformatics 2008, 24, 1469–1470. [Google Scholar] [CrossRef]
- Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 8, 1194–1202. [Google Scholar] [CrossRef]
- Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server. In The Proteomics Protocols Handbook; Humana Press: Totowa, NJ, USA, 2005; Volume 52, pp. 571–607. [Google Scholar]
- Yu, C.S.; Chen, Y.C.; Lu, C.H.; Hwang, J.K. Prediction of protein subcellular localization. Proteins 2006, 64, 643–651. [Google Scholar] [CrossRef]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef]
- Bailey, T.L.; Nadya, W.; Chris, M.; Li, W.W. MeMe: Discovering and analyzing DNA and protein sequence motifs. Nucleic Acids Res. 2006, 34, W369–W373. [Google Scholar] [CrossRef] [PubMed]
- Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
- Shen, F. Jasminum-Sambac-Genome. Available online: https://github.com/maypoleflyn/Jasminum-sambac-genome (accessed on 20 November 2022).
- Voorrips, R. MapChart: Software for the graphical presentation of linkage maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef]
- Wang, Y.P.; Tang, H.B.; Debarry, J.D.; Tan, X.; Li, J.P.; Wang, X.Y.; Lee, T.H.; Jin, H.Z.; Marler, B.; Guo, H.; et al. Mcscanx: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
- Wang, S.; Li, Q. Genome-Wide Identification of the Salvia miltiorrhiza SmCIPK gene family and revealing the salt resistance characteristic of SmCIPK13. Int. J. Mol. Sci. 2022, 23, 6861. [Google Scholar] [CrossRef]
- Meng, D.; Dong, B.Y.; Niu, L.L.; Song, Z.H.; Wang, L.T.; Amin, R.; Cao, H.Y.; Li, H.H.; Yang, Q.; Fu, Y.J. The pigeon pea CcCIPK14-CcCBL1 pair positively modulates drought tolerance by enhancing flavonoid biosynthesis. Plant J. 2021, 106, 1278–1297. [Google Scholar] [CrossRef]
- Kudla, J.; Batistic, O.; Hashimoto, K. Calcium signals: The lead currency of plant information processing. Plant Cell 2010, 22, 541–563. [Google Scholar] [CrossRef]
- Kim, K.N.; Cheong, Y.H.; Gupta, R.; Luan, S. Interaction specificity of Arabidopsis calcineurin B-like calcium sensors and their target kinases. Plant Physiol. 2000, 124, 1844–1853. [Google Scholar] [CrossRef]
- Kanwar, P.; Sanyal, S.K.; Tokas, I.; Yadav, A.K.; Pandey, A.; Kapoor, S.; Pandey, G.K. Comprehensive structural, interaction and expression analysis of CBL and CIPK complement during abiotic stresses and development in rice. Cell Calcium 2014, 56, 81–95. [Google Scholar] [CrossRef]
- Yin, X.; Wang, Q.L.; Chen, Q.; Xiang, N.; Yang, Y.Q.; Yang, Y.P. Genome-wide identification and functional analysis of the calcineurin B-like protein and calcineurin B-like protein-interacting protein Kinase gene families in Turnip (Brassica rapa var. rapa). Front. Plant Sci. 2017, 8, 1191. [Google Scholar] [CrossRef] [PubMed]
- Tai, F.J.; Yuan, Z.H.; Li, S.P.; Wang, Q.; Liu, F.Y.; Wang, W. ZmCIPK8, a CBL-interacting protein kinase, regulates maize response to drought stress. Plant Cell Tissue Organ Cult. 2015, 124, 459–469. [Google Scholar] [CrossRef]
- Gong, J.Y.; Shi, T.L.; Li, Y.K.; Wang, H.C.; Li, F. Genome-wide identification and characterization of calcium metabolism related gene families in Arabidopsis thaliana and their regulation by Bacillus amyloliquefaciens under high calcium stress. Front. Plant Sci. 2021, 12, 707496. [Google Scholar] [CrossRef] [PubMed]
- Bai, X.; Ji, J.; Wang, W.; Gu, C.; Yu, Q.; Jiang, J.; Yang, C.; Liu, G. Characterization of CBL-Interacting Protein Kinases’ Gene Family and Expression Pattern Reveal Their Important Roles in Response to Salt Stress in Poplar. Forests 2022, 13, 1353. [Google Scholar] [CrossRef]
- Wu, G.Q.; Xie, L.L.; Wang, J.L.; Wang, B.C.; Li, Z.Q. Genome-wide identification of CIPK genes in sugar beet (Beta vulgaris) and their expression under NaCl stress. J. Plant Growth Regul. 2022, 42, 260–274. [Google Scholar] [CrossRef]
- Ohta, M.; Guo, Y.; Halfter, U.; Zhu, J.K. A novel domain in the protein kinase SOS2 mediates interaction with the protein phosphatase 2C AB12. Proc. Natl. Acad. Sci. USA 2003, 100, 11771–11776. [Google Scholar] [CrossRef]







| Sequences (5′–3′) | ||
|---|---|---|
| Primers | Forward | Reverse |
| JsCIPK1 | GGCCTCAACCTTGCTTCTCT | GTGACCCTTGCGTCCAATCT |
| JsCIPK2 | AGGTTTTGGCTCGAAAGGGT | TCCGGTGTGAACCATCTTGG |
| JsCIPK6 | AGGCATGACGGAGCAAATCA | TCGACCCCTAGCGATTTTGG |
| JsCIPK7 | GCACCGGAGGTATTAAGCCA | TACGCAGCAATGACACGGAA |
| JsCIPK8 | GGGAGGCTTTTAGGGAAGGG | AACCAATCGCATGACGGAGA |
| JsCIPK12 | ACGGCGCAAAAGTTGACATC | GTATCCGGGTTCGGGTCAAG |
| JsCIPK13 | TCCAATCCATTTGGTGGCGA | GCACATCTTTCGGCATTCCC |
| JsCIPK14 | TTGGCTATGATGGGGCAACC | GCTGAACGAAAGCCAAGGTG |
| JsACTIN2 | TCTCTATGGTAACATTGTCCTG | ATCCAGACACTGTACTTCCTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, S.; Huang, X.; Yin, L.; Li, J.; Xu, J.; Wu, R. Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress. Horticulturae 2025, 11, 40. https://doi.org/10.3390/horticulturae11010040
Zhang S, Huang X, Yin L, Li J, Xu J, Wu R. Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress. Horticulturae. 2025; 11(1):40. https://doi.org/10.3390/horticulturae11010040
Chicago/Turabian StyleZhang, Shuang, Xin Huang, Lili Yin, Jiawei Li, Jiacan Xu, and Ruigang Wu. 2025. "Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress" Horticulturae 11, no. 1: 40. https://doi.org/10.3390/horticulturae11010040
APA StyleZhang, S., Huang, X., Yin, L., Li, J., Xu, J., & Wu, R. (2025). Genome-Wide Identification of the CIPK Gene Family in Jasmine and Expression Analysis Under Salt Stress. Horticulturae, 11(1), 40. https://doi.org/10.3390/horticulturae11010040
