Next Article in Journal
Discrimination of Farming Practices Through Olive Leaf Phenolic and Mineral Analysis
Previous Article in Journal
Open-Source High-Throughput Phenotyping for Blueberry Yield and Maturity Prediction Across Environments: Neural Network Model and Labeled Dataset for Breeders
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Cultivar-Dependent Variations in the Microbiome of Grapevine Leaves

by
Raúl Castanera
1,2,*,†,
Víctor M. González-Miguel
1,†,
Glòria Escolà
1,
Marta Olivé
1,
Neus Teixidó
3,
Robert Savé
4,
Josep María Casacuberta
1,5 and
Blanca San Segundo
1,5,*
1
Centre for Research in Agricultural Genomics (CRAG) CSIC-IRTA-UAB-UB, Campus Universitat Autónoma de Barcelona, Bellaterra (Cerdanyola del Valles), 08193 Barcelona, Catalonia, Spain
2
IRTA, Genomics and Biotechnology, Edifici CRAG, Campus UAB, 08193 Bellaterra, Catalonia, Spain
3
IRTA, Postharvest, Edifici Fruitcentre, Parc Agrobiotech Lleida, Parc de Gardeny, 25003 Lleida, Catalonia, Spain
4
IRTA, Fruit Production, Torre Marimon, 08140 Caldes de Montbui, Catalonia, Spain
5
Consejo Superior de Investigaciones Científicas (CSIC), 08193 Barcelona, Catalonia, Spain
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Horticulturae 2024, 10(12), 1333; https://doi.org/10.3390/horticulturae10121333
Submission received: 5 November 2024 / Revised: 10 December 2024 / Accepted: 11 December 2024 / Published: 13 December 2024
(This article belongs to the Section Viticulture)

Abstract

The grapevine (Vitis vinifera) is a major fruit crop of economic importance worldwide. Commercial grapevine cultivars are susceptible to infection by pathogenic microorganisms that cause diseases both in leaves and fruits, and it is known that the leaf microbiome plays an important role in plant health and fitness. In this study, shotgun metagenomic sequencing was used to characterize the microbial communities associated with grapevine leaves in three commercial varieties, Cabernet Sauvignon, Garnacha, and Marselan, grown in the same biogeographical unit. Metagenomic data revealed a differential enrichment of the microbial communities living inside grapevine leaves or on the leaf surface in the three varieties. The most abundant fungal taxa associated with grapevine leaves belong to the phylum Ascomycota, which included relevant pathogenic fungi for grapevines, such as Botrytis cinerea, Sclerotinia sclerotium, and Alternaria alternata, as well as several fungal species potentially pathogenic for grapevines (e.g., members of the Colletotrichum, Aspergillus, and Penicillium genera). Basidiomycota constituted a minor fraction of the fungal microbial communities. Grapevine leaves also harbored a diversity of bacterial taxa. At the phylum level, bacterial communities in all three varieties were primarily composed of Pseudomonadata, Bacillota, Bacteroidota, and a lower proportion of Actinomycetota. Differences in the fungal and bacterial community structures were observed between varieties, although they were more important in fungi. In particular, S. sclerotiorum and B. cinerea were found to preferentially colonize leaves in the Marselan and Garnacha varieties, respectively. These findings further support that the host genotype can shape its own microbiome in grapevines. A better understanding of the leaf microbiome in grapevines will provide the basis for the development of tailored strategies to prevent diseases in vineyards while helping to increase sustainability in grapevine production.

1. Introduction

The grapevine (Vitis vinifera) is cultivated around the world and is a fruit crop with great economic, social, cultural, and ecological impact [1]. In the vineyard, grapevine plants can be colonized by a remarkable diversity of microbes that interact with each other and with the plants [2]. Multiple factors can shape the grapevine microbiome, both internal factors (e.g., host genotype or plant age) and external factors, such as edaphoclimatic condition variables (e.g., drought, humidity, temperature, soil texture, and chemical composition), agronomical practices, and the vineyard location [3,4]. Some microbes associated with grapevines can be pathogenic for the plant, being responsible for diseases that cause substantial economic losses. Furthermore, grapevines can be simultaneously infected by different pathogens and some of them can be in a latent status (e.g., living as endophytes) which, at a specific time under favorable conditions, can become pathogenic. For example, Botrytis cinerea, one of the most important pathogens of this crop, can cause latent infections [5]. The simultaneous presence of multiple microbial species in a particular tissue can make disease diagnosis difficult. Chemical treatments are routinely used to control grapevine diseases in vineyards, with consequent negative impacts on the environment and human health and problems associated with the development of pathogen resistance.
Considering its global economic importance and the impact that grapevine-associated microorganisms can have on the health and yield of grapes, as well as for winemaking industries, the analysis of the microbial assemblage in grapevines has raised great interest. Diverse fungi, oomycetes, bacteria, viruses, or phytoplasmas can be pathogenic for the grapevine plant [6,7,8]. Some of the most important grapevine diseases are caused by fungi, which include B. cinerea, causing the gray mold disease; Erysiphe necator, causing powdery mildew; and Sclerotinia sclerotiorum, causing Sclerotinia shoot rot in grapevines. Esca is a complex disease, involving various taxonomically unrelated fungal pathogens such as Phaeoacremonium aleophilum, Phaeomoniella chlamydospora, and Fomitiporia mediterranea. Another important disease in grapevine plants is downy mildew caused by the oomycete Plasmopara viticola. Bacterial diseases in grapevines include bacterial blight (Xylophilus ampelinus), Pierce’s disease (Xylella fastidiosa), Pseudomonas bunch rot (Pseudomonas syringae pv. syringae), and crown gall (Agrobacterium vitis). Furthermore, sour rot caused by a complex of yeast and bacteria is receiving much attention in regions having hot summer seasons, also associated with global climate change. Different grapevine cultivars differ in their sensitivity to pathogenic microorganisms, which is also dependent on environmental factors [6,9,10]. However, our knowledge on the microbial communities that specifically associate distinct grapevine cultivars is still limited.
Traditionally, research on microorganisms in plant tissues has relied on microbiological approaches for the identification of cultured organisms. Such methods are labor-intensive and may not necessarily result in the identification of specific microbial groups of importance, because microorganisms colonizing a plant tissue might be unable to grow on conventional culture media in the laboratory. The introduction of DNA-based molecular techniques, such as the polymerase chain reaction (PCR) and the identification of molecular markers, improved our ability to characterize microbial communities in plants. Improvements in DNA sequencing opened up the possibility of studying the microbial community structure with a higher resolution by employing metagenomics approaches, which have the power to analyze the genomic material present in a plant tissue without the need to culture microbes in a laboratory. Two main strategies have been developed for the metagenomic analysis of plant microbiomes, namely the metabarcoding of amplified marker DNA sequences (or targeted sequencing) and whole-genome sequencing (or shotgun metagenomics). Targeted sequencing involves PCR amplification of gene-specific DNA segments, typically ribosomal DNAs, to identify specific taxonomic groups present in the sample, which are then profiled using reference databases. The 16S rRNA sequence is considered the most conserved taxonomic marker for bacterial communities, whereas the internal transcribed spacer (ITS) of the nuclear ribosomal DNA is generally used to examine fungal communities [11]. However, amplicon sequencing has several drawbacks. The universal primers might amplify genes from different taxonomic lineages with different efficiency, which is also dependent on the copy number variation in the target sequence across taxa, thus leading to low confidence taxonomic assignments [12]. In contrast to metabarcoding approaches, shotgun metagenomics has the power to explore the total DNA material of plant tissues, also providing data for minority species, and it usually provides better phylogenetic resolution [8,13]. Although shotgun metagenomics enables the accurate assessment of microbial communities in plant tissues, it still depends on reference genomic databases created for the taxonomic classification of microorganisms.
Until recently, studies to characterize the grapevine microbial community were mainly based on the detection of bacterial and/or fungal regions using amplicon sequencing, namely the bacterial small subunit ribosomal RNA gene (16S rRNA) and fungal ITS rRNA regions [6,9,10,11,14,15,16,17]. Although shotgun metagenomic approaches have been widely used to investigate the microbial community in different plant species, few studies have yet applied this approach for an in-depth analysis of the microbiome in grapevine leaves [18].
Shotgun metagenomic sequencing has been used for the microbiome profiling of grape berries from the Corvina variety during withering and grape must from Cabernet Sauvignon [19,20] but up to now, limited information is available on the microbiome of grapevine leaves. As the microbiome in grapevine leaves can affect plant health and grape production, a better understanding of the leaf microbial communities of different grapevine cultivars is of paramount importance. Furthermore, the accurate identification of grapevine-associated microbial communities will allow for the development of sustainable strategies for disease management in vineyards, as well as the exploration of new biocontrol agents and factors influencing the success or failure of biocontrol systems.
In the present investigation, the microbial community associated with leaves of three commercially important grapevine cultivars grown in the Mediterranean region was investigated. They were Cabernet Sauvignon, Garnacha, and Marselan. Cabernet Sauvignon is one of the most widely recognized red wine grape varieties that can be grown in a diverse spectrum of climates. Cabernet Sauvignon originated in France and nowadays is grown in nearly every major wine-producing country. Garnacha is also a widely grown red wine that needs hot and dry conditions such as those found in Spain, where this variety is believed to have originated. Marselan is a newly developed grapevine variety derived from the cross between Cabernet Sauvignon and Garnacha. Shotgun metagenomic sequencing was adopted to obtain the deepest insight into the diversity of the microbial communities living inside grapevine leaves or on the leaf surface of the Cabernet Sauvignon, Garnacha, and Marselan varieties grown in the same vineyard. Also, taking advantage of the increasing number of publicly available reference genomes, a custom database containing known fungal and bacterial genomes has been created for the taxonomic profiling of microbial communities in grapevine leaves. Differences were found in the composition of the microbial communities, both fungal and bacterial communities, in leaves of Cabernet Sauvignon, Garnacha, and Marselan, supporting that the host genotype can shape the leaf microbiome in grapevines.

2. Materials and Methods

2.1. DNA Extraction

Grapevine (V. vinifera) plants were grown in vineyards located at the Institute of Agrifood Research and Technology (IRTA, Barcelona, Spain; GPS coordinates 41°36′48.3438″ N; 2°10′15.2976″ E). Three grapevine varieties were examined, namely Cabernet Sauvignon, Garnacha, and Marselan, which were grown under management practices routinely used in vineyards in this geographical region. Young leaves from 5-year-old grapevine plants distributed across the vineyard were collected early in July 2020. In each case, the third leaf from the apex was harvested (three biological replicates for each variety, each replicate consisting of a pool of at least 6 plants). The global microbial community structure of grapevine leaves, consisting of epiphytic and endophytic fungal and bacterial communities, was examined. Accordingly, leaves were not either washed or surface sterilized prior to DNA extraction. The plant material was pulverized in liquid nitrogen and stored at −80 °C until DNA extraction. For each DNA extraction, 0.1 g was processed.
For the comprehensive evaluation of the vineyard microbiome, the obtention of high-quality DNA samples is a requisite, where high-molecular-weight DNA is desirable. It is also known that extracting DNA from grapevine leaves free of contaminants (e.g., polyphenols, polysaccharides, pigments) is particularly challenging [21]. Different protocols for DNA extraction were assayed based on the use of different detergents for cell lysis (e.g., using ionic detergents or SDS) and/or the use of sorbitol prior to cell lysis [22,23,24]. The DNeasy Plant kit (Qiagen, Dusseldorf, Germany) was also used for DNA extraction from grapevine leaves, according to the manufacturer’s instructions. The quality and concentration of DNA were determined using a Nanodrop 2000 spectrophotometer (Nanodrop technologies, Wilmington, DE, USA) and agarose gel electrophoresis. Among the various methods assayed in this work for DNA extraction, the best results were obtained using the DNAeasy kit (Qiagen, Dusseldorf, Germany). Thus, high-quality DNA was obtained from all three grapevine varieties using the DNAeasy kit (Qiagen, Dusseldorf, Germany), with A260/A280 (DNA/protein) values of 1.9–2.0 and A260/230 (DNA/other impurities) values around 2.0.

2.2. Library Construction and Sequencing

Shotgun sequencing was used to profile the taxonomic composition of microbial communities in grapevine leaves. Library preparation and sequencing was conducted at Novogene (Cambridge, UK). For this, the genomic DNA was randomly fragmented by sonication, then DNA fragments were end-polished, A-tailed, and ligated with the full-length adapters for Illumina sequencing, followed by PCR amplification using P5 and P7 primers (P5, 5′ AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT 3′; P7, 5′ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGATGACTATCTCGTATGCCGTCTTCTGCTTG-3′). The PCR products were purified with an AMPure XP system. The libraries were checked for size distribution by an Agilent 2100 Bioanalyzer (Agilent Technologies, CA, USA) and quantified by real-time PCR. Three independent libraries were prepared from each grapevine variety (Cabernet Sauvignon, Garnacha, Marselan). The obtained libraries were then sequenced using the Illumina platform at Novogene (Cambridge, UK) and 2 × 150 bp paired-end sequencing.

2.3. Development of a Customized Reference Genome Database

A microbial genomics database suitable for shotgun metagenomic studies in Vitis using Kraken2 v2.0.8 [25] was built. For this, every bacterial, archaeal, and viral genome were downloaded from the NCBI RefSeq database (June, 2024) with the status “complete genome” or “chromosome”. This resource was complemented with all fungal genomes available in the same database (June, 2024), irrespective of their completeness level. Finally, the Vitis vinifera genome RefSeq assembly (GCF_030704535.1_ASM3070453v1) was also added to the database to identify reads from the host organism.

2.4. Read Processing and Taxonomic Profiling

A read quality check was performed using fastqc v0.11.5 [26], and adaptor sequences were trimmed with cutadapt v3.1 (https://cutadapt.readthedocs.org/). The taxonomic classification of the reads was performed with Kraken2 and our custom database, and species abundance estimation was further refined using Bracken v2.9 (Bayesian re-estimation of abundance with KrakEN) [27] with parameters -k 31-l 150. Bracken uses the taxonomic assignments made by Kraken to estimate the abundances at a single level (e.g., species).
Krona and Sankey diagrams were used to visualize the microbial composition in each grapevine variety [28]. Krona charts use a series of concentric rings, where each ring corresponds to a specific level in the hierarchy and the segments within each ring are proportionally divided to represent the details at that level. This visual representation of taxonomy allows for an intuitive exploration of the relationships between different taxonomic levels in a particular sample, thus offering insights into the composition and distribution of microbial communities. Sankey diagrams illustrate the distribution and transitions of taxonomic categories across different samples while depicting changes in microbial species and abundances. Krona plots were produced using the plot_krona function from the psadd R package, v0.1.3, and Sankey charts were produced using the Pavian R package, v1.2.1 [29].
LEfSe (linear discriminant analysis effect size) was used to identify the fungal species that were significantly different between grapevine varieties. This analysis allows us to explain differences between samples by coupling standard tests for statistical significance with additional tests encoding biological consistency and effect relevance [30]. LEfSe was performed using the lefser R package, v.1.14.0. Statistical significance was claimed at a p value ˂ 0.05 (Kruskal–Wallis rank sum test), and the threshold for the LEfSe analysis score was set to 2.0.

3. Results

3.1. General Characterization of the Microbial Community in Grapevine Leaves

Shotgun metagenomic sequencing was used to characterize the microbiome associated with leaves of three grapevine varieties and to investigate to what extent the genotype influences the leaf microbiome. To minimize the risk associated with environmental factors affecting the leaf microbiome among varieties, the three grapevine varieties here investigated, Cabernet Sauvignon, Garnacha, and Marselan, were grown in the same vineyard under climatic and meteorological Mediterranean environmental conditions. This study focused on the microbial communities living inside the plant leaves or on the leaf surface and therefore, the leaf material was not washed or surface sterilized before DNA extraction.
The sequencing of metagenomic libraries from grapevine leaves generated 33.3–46.1 million 150 bp paired-end reads per sample (Supplemental Table S1). After quality trimming and adapter removal, a total of 97.9 million 150 bp paired-end reads passed the quality control parameters, with 34.47 million reads (representing 97.76% of the total reads in Cabernet Sauvignon), 31.43 million reads (95.77% of the total reads in Garnacha), and 32.0 million reads (95.81% of the total reads in Marselan) (Supplemental Table S1).
Reads from metagenomic datasets were then used as input for taxonomic classification using Kraken2 (v2.0.8). Publicly available Kraken2 databases are under-represented in fungal species. In order to avoid potential biases, a customized Kraken2 database was built by adding whole-genome sequences available at the NCBI RefSeq database for fungal (598 sequences), bacterial (46,540 sequences), archaeal (616 sequences), and viral genomes (14,971 sequences), as well as V. vinifera (see Section 2.3). By incorporating the V. vinifera genome into our custom database, the reads were classified excluding those corresponding to the host genome (up to 98.1%, 92.4%, and 96.9% of the total reads in Cabernet Sauvignon, Garnacha, and Marselan datasets correspond to V. vinifera). Results from the taxonomic assignment of metagenomics reads from the three grapevine varieties (three samples per variety) are presented in Supplemental Table S2.
Principal coordinate analysis (PCoA) with Bray–Curtis distances was used to have an overview of the similarity/dissimilarity among independent samples from each variety and to infer whether there are differences in the microbial communities between varieties. As shown in Figure 1A, PCoA plots revealed a clustering of microbial communities between samples from each variety, as well as clear separations among the three varieties.
The PCoA showed that the two principal components (PCoA1, 91.2%, and PCO2, 6.8%) accounted for most of the total data variability (Figure 1A). A vast majority of reads were classified as fungi, followed by bacteria, with only a small fraction being assigned to archaea and viruses (Supplemental Figure S1). Leaves of Marselan were more enriched in bacterial taxa than Cabernet Sauvignon or Garnacha leaves. On average, 21.5% of the total reads corresponded to bacteria in Marselan (average of the three samples, each variety), whereas in Cabernet Sauvignon and Garnacha, the proportion of bacterial reads represented 10.2% and 9.4% of the total reads, respectively. Fungal reads represented 89.5%, 90.4%, and 77.4% of the total microbial reads in Cabernet Sauvignon, Garnacha, and Marselan leaves, respectively (Supplemental Figure S1). At the fungal species level, Marselan samples showed slightly higher alpha diversity (Shannon) than Cabernet Sauvignon and Garnacha (3.04, 2.58, and 2.47, respectively, average of three replicates, Kruskal–Wallis p = 0.051). We found no differences in Shannon’s alpha diversity at the species level in bacteria (Marselan = 6.02, Cabernet Sauvignon = 5.97, Garnacha = 5.61, average of three replicates).

3.2. Fungal Communities in Grapevine Leaves

At the class level, the most dominant fungal taxa in grapevine leaves are assigned to the phylum Ascomycota, which included Dothideomycetes (the most abundant taxa in the three grapevine varieties), Sordariomycetes, Eurotiomycetes, and Leotiomycetes (Figure 1B). However, the relative abundance of these fungal taxa varied among varieties. For instance, Dothideomycetes were more abundant in Cabernet Sauvignon, whereas Sordariomycetes were more represented in Garnacha and Marselan than in Cabernet Sauvignon. Eurotiomycetes had a higher abundance in Marselan than in the other two varieties.
Basidiomycete fungi were also identified in grapevine leaves, which included Tremellomycetes and Agaricomycetes (Figure 1B). Compared with Ascomycete fungi, Basiodiomycete fungi were much less represented in grapevine leaves, accounting for only 1–2% of all eukaryotic taxa (Cabernet Sauvignon, 1%; Garnacha and Marselan, 2%) (Supplemental Figures S2–S4). Among them, Tremellomycetes were more abundant in Garnacha than in the other two grapevine varieties. To note, the three biological samples from each variety showed a similar distribution of fungal taxa (Figure 1B). A more detailed description of fungal communities in each grapevine variety is presented below.

3.3. Influence of the Grapevine Cultivar on Leaf Fungal Communities

The abundance of fungal taxa in metagenomic data was examined in more detail at the species level. For this, the taxonomic assignments made by Kraken were refined using Bracken [27]. The complete list of species identified in metagenomic datasets for each grapevine variety is presented in Supplemental Table S3, and a heat map showing fungal species with a relative abundance greater than 0.1% in each variety is shown in Supplemental Figure S5. The outputs from Bracken were used for the visualization of taxonomic distribution by generating Sankey diagrams. Sankey plots showing the most abundant 20 fungal species (representing ~85% of the fungal reads) are depicted in Figure 2. This analysis revealed the dominant presence of species from the Aureobasidium and Alternaria genera in the three cultivars. More specifically, Aureobasidium pullulans followed by A. alternata (class Dothideomycetes) were the most abundant species. Detailed information about the diversity and relative abundances of Ascomycete fungi in the three grapevine leaves (Krona plots) can be found in Supplemental Figure S6.
In addition, Filobasidium floriforme, Penicillium cosmopolitanum, Penicilliopsis zonata, and Colletotrichum fruticola were also found across the three grapevine varieties, with varying relative abundances among them. P. subrubescens was identified among the 20 most abundant fungal species in Marselan but not in Cabernet Sauvignon or Garnacha. Within the genus Aurerobasidium, A. pullulans represented the most abundant fungal species in all three varieties, whereas A. namibiae was present only in Garnacha (Figure 2).
An important number of species in the Alternaria genus were identified within the most abundant fungal species in grapevine leaves, which were more represented in Cabernet Sauvignon than in Garnacha or Marselan (Figure 2; Supplemental Figure S5). Cabernet Sauvignon and Garnacha had the highest Alternaria abundance (52% and 42% of total Ascomycota reads), whereas Marselan had the lowest proportion (24% of Ascomycota) (Supplemental Table S4). Of them, A. alternata, A. postmesia, A. arborecens, and A. burnsii were found to colonize all three varieties. Colletotrichum fructicola, which was also identified in the three varieties, had a higher abundance in Garnacha and Marselan than in Cabernet Sauvignon (Figure 2; Supplemental Figure S5).
In addition to Alternaria and Aureobasidium species, several pathogenic fungi were identified within the 20 most abundant fungal species. For example, Sclerotia sclerotiorum (Ascomycota), the causal agent of the Sclerotinia shoot rot in grapevines, was identified in Marselan but not in Cabernet Sauvignon or Garnacha (Figure 2). To note, B. cinerea, the fungus responsible for gray mold, also ranked among the top 20 fungal species but only in the Garnacha variety (Figure 2). The observation that distinct fungal pathogens are specifically identified in one grapevine variety points to a preferential colonization by these fungi in these particular varieties (e.g., S. sclerotiorum in Marselan and B. cinerea in Garnacha).
It is worth mentioning that our metagenomic analysis identified up to 17 species belonging to the Alternaria genus, of which A. alternata, A. postmessia, A. arborescens, and A. burnsii were the most abundant ones (also identified in the set of the most abundant taxa, Figure 2). The full list of Alternaria species identified in grapevine leaves is presented in Supplemental Table S4. As for Colletotrichum (class Sordiaromycetes), a total of 23 species were identified in grapevine leaves, although C. fruticola and C. acutatum accounted for more than 95% of the Colletotrichum reads. The contribution of Colletotrichum reads to the Ascomycota population varied depending on the variety (more abundant in Garnacha and Marselan, 9% and 8% of Ascomycota, respectively, but only 1% of Ascomycota in Cabernet Sauvignon (Supplemental Table S4)). Furthermore, a total of 54 Aspergillus species (including A. glaucus and A. tubingensis) and 52 Penicillium species (including P. cosmopolitanum and P. subrubescens) were found to be present in leaves of the three grapevine varieties (Supplemental Table S4). Regarding the Botrytis genus (class Leotiomycetes), of the six Botrytis species found in grapevine leaves, B. cinerea was represented the most in the Garnacha variety (Supplemental Table S4). Only one Sclerotinia species (class Leotiomycetes), namely S. sclerotium, was identified in this study, which was more abundant in the leaves of Marselan.
To further investigate differences in the leaf microbiome among grapevine varieties at the species level, linear discriminant analysis effect size (LEfSe) was used. Comparisons between pairs of grapevine varieties are presented in Figure 3. In the Cabernet Sauvignon-Garnacha comparison, C. fructicola, F. floriforme, and B. cinerea were found to be the most enriched in Garnacha (Figure 3A).
When comparing Cabernet Sauvignon and Marselan, C. fructicola and S. sclerotiorum were found to be enriched in Marselan, while 16 out of the 17 Alternaria species identified in our metagenomic datasets were found to be enriched in Cabernet Sauvignon (Figure 3B). These were A. alternata, A. postmessia, A. arborescens, A. burnsii, A. ventricose, A. arbusti, A. incomplexa, A. novae-zelandiae, A. metachromatica, A. triticimaculans, A. viburni, A. conjuncta, A. hordeiaustralica, A. ethzedia, A. infectoria, and A. altra (Figure 3B).
In the Garnacha–Marselan comparison, S. sclerotiorum appeared as enriched in Marselan, whereas members of diverse genera were significantly enriched in Garnacha (e.g., Aureobasidium, Alternaria, Colletotrichum, Filobasidium, and Botrytis cinerea (Figure 3C). In this way, LEfSE analysis showed the species contributing the most to the dissimilarity (effect size) of Marselan leaves (C. fructicula and S. sclerotiorum) as compared with the other two varieties, whereas Alternaria species contributed to fungal community dissimilarity in Cabernet Sauvignon leaves. B. cinerea, the causal agent of gray mold, contributed to differences between Garnacha and the other two grapevine varieties here examined (see Cabernet Sauvignon–Garnacha and Marselan–Garnacha comparisons, Figure 3A,C, respectively). The relative abundances of fungal species that were found to be enriched (or specifically identified) in one or another variety is presented in Figure 4. This analysis illustrated that S. sclerotium and B. cinerea preferentially colonize leaves of Marselan and Garnacha, respectively.
Collectively, the results here presented demonstrate important differences in the fungal microbial communities of the three grapevine varieties examined. Common and specific fungal species were identified in the leaves of these varieties. The observed association between certain fungal species and a given grapevine variety suggest that the grapevine genotype may influence the leaf microbiome.

3.4. Bacterial Communities in Grapevine Leaves

Bacterial communities in grapevine leaves were dominated by members of the phyla Pseudomonadota (comprising Gammaproteobacteria and Alphaproteobacteria and Betaproteobacteria), Bacteroidota, and Bacillota (Figure 5A). As found for the fungal communities, differences among the three varieties were observed at the phylum level (p < 0.05). Actinomycetota were more abundant in Cabernet Sauvignon and Marselan than in Garnacha, whereas Clampylobacterota showed the opposite pattern. At the class level, only Epsilonproteobacteria showed significant differences among the varieties, being more abundant in Garnacha than in Cabernet Sauvignon or Marselan (Figure 5B). Actinomycetes and Betaproteobacteria exhibited the same patterns, although differences were only marginally significant (p = 0.05 in both cases). Krona’s representations of the relative abundances of bacterial taxa in the three grapevine varieties can be found in Supplemental Figures S7–S9.
To further reveal potential variations in the bacterial communities among grapevine varieties, Sankey diagrams were constructed at the species level. This analysis revealed information about the main taxa found in leaves of the three grapevine varieties (Figure 6). Nevertheless, we found no significant differences among the top 20 more abundant genera or species. The genus Frigobacterium sp. was identified among the top bacterial taxa in Garnacha leaves but not in Cabernet Sauvignon or Marselan leaves (Figure 6). On the other hand, Sphingomonas sp. (Alphaproteobacteria) and Ralstonia sp. (Betaproteobacteria) were more represented in leaves of Cabernet Sauvignon and Marselan than in Garnacha leaves (Figure 6).

4. Discussion

This study describes the composition of the leaf microbiome in three grapevine varieties that are widely cultivated in wine-producing regions in Europe, mainly in the Mediterranean region. To minimize the effect of environmental factors (e.g., climatic conditions) and/or the geographical location potentially influencing the microbial population, all three grapevine varieties were cultivated in the same vineyard (in the northeast of Spain). Shotgun metagenomics was used to comprehensively characterize the grapevine leaf microbiome across the three varieties. Even though shotgun metagenomic sequencing allows for the identification of a wider range of species than rRNA amplicon sequencing, so far, few studies have been conducted for the analysis of the grapevine microbiome using this approach. Indeed, most studies in grapevines have been carried out by amplicon sequencing (e.g., 16s and ITS ribosomal RNA sequencing to identify bacteria and fungi, respectively). In those studies, however, a significant percentage of the sequence data remained unassigned, indicating that the genome sequence databases used for taxonomic assignment were far from being complete. As shotgun metagenomics still involves comparisons of metagenomic data to reference genomes, a major consideration in these studies relates to the genome database used to obtain a reliable taxonomical classification of the microbial population in grapevine leaves. Fungal species are under-represented in the currently available public databases, thus critically limiting their detection. This limitation is less important in bacteria, although the databases need to be updated as new genomes become available. To avoid this problem, a custom genome database was built in this work which included all fungal sequences from the RefSeq database as of June 2024, plus all viral, archaeal, and bacterial RefSeq sequences at chromosome or complete levels. Estimates of species abundance were computed by Kraken2/Bracken using the custom database generated in this work. Taken together, the choice of sequencing method (e.g., shotgun metagenomics) and the use of an extended genome database allowed us to obtain a comprehensive catalog of microbes inhabiting grapevine leaves at the species level.
In this work, the microbial communities associated with grapevine leaves, both endophytes and epiphytes, have been characterized. Metagenomic data reveal a differential enrichment of the fungal microbial communities in the three grapevine varieties growing in the same vineyard, including populations of fungal pathogens. Taxa in the phylum Ascomycota were predominant in all three grapevine varieties, but their relative abundances varied among the three varieties here investigated. The predominance of Ascomycetes fungi over basidiomycetes fungi is consistent with results reported in other studies on the microbiome of grapevine tissues [2,6,17,31,32,33,34]. Among Ascomycetes, the most common fungal taxa found in leaves of the three grapevine varieties were A. pullulans and Alternaria spp. Regarding A. pullulans, this is a yeast-like fungus naturally inhabiting the aboveground parts of grapevine tissues, which is also known as black yeast due to its melanin production [6,35,36,37,38]. This fungus is also known for its antagonistic activity against pathogenic fungi, including B. cinerea [39,40]. However, no correlation could be observed between A. pullulans abundance and the presence/absence of B. cinerea in grapevine varieties (e.g., A. pullulans represented 36–43% of fungal species in the grapevine varieties under study in this work, while B. cinerea was found to preferentially colonize Garnacha leaves). The functional relevance of A. pullulans in grapevine leaves, if any, needs to be further investigated.
An interesting finding in this study was that multiple species within the Alternaria genus appear to coexist in grapevine leaves (e.g., up to 17 species), whose distribution varied among grapevine varieties. Alternaria is a common pathogen in vineyards responsible for leaf spot, a disease that causes huge economic losses in grape production. Compared with previous investigations, the results here presented demonstrate a greater diversity of Alternaria species, likely because previous studies used amplicon sequencing of the fungal ITS for metagenome analyses [34]. It is also worth mentioning that species in the genus Alternaria cannot be easily distinguished based only on the ITS region [41].
Our metagenomic analyses also detected C. fructicola in Cabernet Sauvignon, Garnacha, and Marselan. This fungus causes anthracnose, which represents an important disease in most vineyards during rainy and humid weather. Depending on the geographical region, however, different species of Colletotrichum have been associated with anthracnose disease in grapevines. In particular, C. fructicola was previously detected in grapevine leaves and shoots, showing anthracnose in Brazil and China [42,43,44].
Regarding bacterial phyla and in accordance with what has been already described, the leaves of Cabernet Sauvignon, Garnacha, and Marselan showed an abundance of members of the phyla Pseudomonadota, Bacillota, and Bacteroidota [11,15,45]. Differences were also observed between the three cultivars, especially between the Cabernet Sauvignon and Marselan varieties, relative to the Garnacha variety, although only at the phylum and class level. Our results suggest that the landscape of bacterial communities may be more stable than fungal communities in grapevine leaves, although this result might be biased by the lower number of bacterial reads obtained, which may hamper the detection of low-abundance taxa. Among the bacterial taxa identified, several species from the Bacillus genus (phylum Bacillota) were found in the leaves of all three grapevine varieties. Previous studies described that Bacillus species inhabiting grapevine leaves exhibit antagonistic activity against B. cinerea and the oomycete Phytophthora infestans [46], although we did not observe a correlation with the B. cinerea abundance in our samples.
It is generally accepted that the microbial community in a plant species is dependent on the geographical localization and environmental conditions [9,47,48]. Along with this, grapevine-growing regions can be distinguished based on the abundance and/or specific combinations of several key microbial taxa. It has also been proposed that the microbial communities can be influenced by the host genotype [17]. When considering differences observed in the composition of microbial communities between the varieties here examined, one should bear in mind that the three grapevine varieties were grown in the same vineyard. It is then reasonable to assume that differences observed between cultivars can be related more to the plant genotype rather than to different climatic conditions or management practices. For instance, fungal taxa shared among the three grapevine varieties included Aureobasidium, Alternaria, Aspergillus, Penicillium, and Colletotrichum, among others, which might well represent the core fungal microbiome of grapevines in this biogeographical region (northeast region of Spain). Finding fungal and bacterial species that are preferentially associated (or limited) to specific grapevine varieties further supports that the host genotype is an important factor in shaping the leaf microbiome in grapevines.
Our results also suggest that distinct microbial taxa preferentially colonize leaves of one or another grapevine variety. Regarding fungal species, S. sclerotium and B. cinerea were found to be among the most abundant fungal species in Marselan and Garnacha, respectively. S. sclerotium was described for the first time in the microbiome of V. vinifera in the Iberian Peninsula in 2011 [31] and, more recently, as a pathogen in a commercial vineyard at the island of Mallorca (Spain) in 2024 [49]. This fungus causes Sclerotinia shoot rot in grapevines, a disease that is extremely difficult to control due to the long-term persistence of sclerotia in the soil and the production of airborne ascospores [50]. To note, B. cinerea was found to preferentially colonize Garnacha leaves compared with Cabernet Sauvignon and Marselan leaves. In vineyards, B. cinerea (the causal agent of the gray mold disease) is capable of infecting different tissues of the grapevine plant (leaves, berries, inflorescences), as well as dead or decaying tissues, thus causing important losses at the pre- and post-harvest levels and a downgrade in fruit quality. When infecting berries, they can be unsuitable for wine production or, if used, it decreases the quality of the wine obtained. Differential colonization by Botrytis species among the three varieties might well reflect differences in the susceptibility to infection by species in this genus in grapevines. Having said that, it will be of interest to investigate whether there is a genetic component controlling grapevine–B. cinerea interactions that could explain the observed varietal differences in the B. cinerea colonization in grapevine leaves, an aspect that deserves further investigation. Moreover, different levels of susceptibility to B. cinerea are observed in grapevine cultivars under field conditions, even in a given cultivar grown under different environmental conditions [51].
A diverse range of strategies have been developed in many research groups for the prevention and control of grapevine diseases, such as gray mold caused by B. cinerea, aiming to substitute/reduce the use of chemical fungicides in grapes. Some examples are a chitosan-based product commercialized in New Zealand as ARMOUR-Zen® [52], biocontrol agents such as Ulocladium oudemansii, commercialized as BOTRY-Zen [53], or Candida sake CPA-1 [54,55], among others. The intensive use of these chemicals not only has a negative impact on the environment but also might facilitate the development of resistance in fungal strains to chemical fungicides [56]. Additionally, fungicide residues on grapes (and wines) might pose significant risks to human health.
Differences found in the microbial consortia among grapevine varieties might be linked to the history (e.g., breeding and selection processes) and biogeography in the cultivation of grapevines. Of the three grapevine varieties investigated in this work, Garnacha and Cabernet Sauvignon are ancient varieties that currently are cultivated in nearly every major wine-producing region under a diverse spectrum of climates. However, Marselan is a more recently developed variety obtained at the INRA (Institut National de la Recherche Agronomique) by crossbreeding Garnacha and Cabernet Sauvignon. The Marselan variety is grown mainly in France and the northeast of Spain. It is tempting to hypothesize that “old” grapevine varieties might preferentially recruit fungal species that are maintained across generations in a particular environment. The common occurrence of microbial taxa in all three varieties might be indicative that these microorganisms are well adapted to grapevines, which likely also have a wide geographical distribution. On the other hand, microbial species colonizing either “young” varieties (e.g., S. sclerotium in Marselan) or preferentially colonizing a particular variety (e.g., B. cinerea in Garnacha) might represent species that are better adapted for the colonization of specific grapevine genotypes and/or species that are just limited by geographical and environmental factors. The possibility that these species represent early colonizers in a particular genotype, i.e., in the more recently developed variety of Marselan, should not be ruled out.
Finally, clonal selection and vegetative propagation are usual practices in grapevine cultivation, and identical genotypes are usually cultivated in most vineyards these days. A better understanding of microbial signatures associated with grapevine varieties in a particular region in conjunction with the optimal selection of grapevine varieties (e.g., choosing cultivars resilient to establish associations with certain pathogens) will help in developing tailored strategies to improve disease resistance. Due to the economic relevance of grapevines and the lack of effective methods to predict the risk of diseases, high quantities of agrochemicals are routinely applied to vineyards. Furthermore, information on the leaf-associated microbiome in different grapevine varieties will be useful to trace taxa that persist best in each variety over successive cropping while preventing disease outbreaks. Overall, the characterization of microbial communities associated with grapevines opens new windows to prevent losses in vineyards through the development of more sustainable grape production systems.
From a practical point of view, however, further research is clearly needed to determine how the microbiome of grapevine varieties can be influenced by external environmental conditions, including climate and vineyard management practices, in the same geographical region, as well as in other grapevine-growing regions. Also, it will be desirable to perform similar studies on varieties with known resistance to fungal pathogens.

5. Conclusions

Shotgun metagenomics enabled the characterization of the microbiome associated with the leaves of three commercially important grapevine cultivars, Cabernet Sauvignon, Garnacha, and Marselan. A custom database containing microbial genomes was created for the taxonomic profiling of microbial communities in grapevine leaves. This study revealed a high diversity in the fungal and bacterial communities living inside grapevine leaves or on the leaf surface. Differences were observed in the composition of fungal and bacterial communities between grapevine varieties, which included important phytopathogenic fungi. B. cinerea and S. sclerotium were found to be among the most abundant fungal species in Garnacha and Marselan, respectively. Overall, the characterization of the microbial communities in grapevine leaves will open new avenues to designing more effective strategies for disease control in vineyards while minimizing the environmental impact of pesticide usage in grapevine production.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/horticulturae10121333/s1, Table S1. Statistics for data pre-processing. Table S2. Microbial composition of grapevine leaves. Taxonomic profiling of sequencing reads from Cabernet, Garnacha and Marselan leaves. Data from individual samples from each variety is shown. Table S3. Complete list of species identified in metagenomic data from leaves of Cabernet, Garnacha and Marselan, and their relative abundance in each variety. Species included in the customized database were computed by Bracken and used for Krona visualization. Table S4. Relative Abundance of species belonging to the genera Alternaria, Aspergillus, Botrytis, Colletotrichum, Penicillium and Sclerotinia in each grapevine variety. Figure S1. Proportion of reads assigned to Fungi, Bacteria, Archaea, and Viruses in leaves of the grapevine varieties Cabernet Sauvignon (C), Garnacha (G) and Marselan (M). Figure S2. Krona graphs representing the taxonomical diversity observed in leaves of Garnacha at the species level. Figure S3. Krona graphs representing the taxonomical diversity observed in leaves of Marselan at the species level. Figure S4. Krona graphs representing the taxonomical diversity observed in leaves of Cabernet Sauvignon at the species level. Figure S5. Heat map of the most highly represented fungal species in leaves of grapevine varieties. Figure 6. Krona graphs showing the abundance of fungal taxa assigned to the phylum Ascomycota in leaves from Garnacha (A), Cabernet Sauvignon (B) and Marselan (C). Figure S7. Krona graphs showing the abundance of bacterial taxa identified in Cabernet Sauvignon leaves. Figure S8. Krona graphs showing the abundance of bacterial taxa identified in Garnacha leaves. Figure S9. Krona graphs showing the abundance of bacterial taxa identified in Marselan leaves.

Author Contributions

Conceptualization, B.S.S. and J.M.C.; data curation, V.M.G.-M. and R.C.; formal analysis, R.C. and V.M.G.-M.; funding acquisition, B.S.S. and J.M.C.; investigation, R.C., G.E., M.O., N.T., and R.S.; methodology, R.C., V.M.G.-M., and B.S.S.; project administration and supervision, B.S.S.; writing—original draft preparation, B.S.S., R.C., and V.M.G.-M.; writing—review and editing, R.C., V.M.G.-M., J.M.C., N.T., R.S., and B.S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by grants PID2021-128825OB-I00 funded by MICIU/AEI/10.13039/501100011033 and by “ERDF/EU” to B.SS. and PID2019-106374RB-I00 funded by MICIU/AEI/10.13039/501100011033 and PID2022-143167NB-I00 funded by MICIU/AEI/10.13039/501100011033 and by “ERDF/EU grants to JC. We acknowledge financial support from CEX2019-000902-S funded by MICIU/AEI/10.13039/501100011033 through the “Severo Ochoa Program for Centres of Excellence in R&D” and the CERCA Program “Generalitat de Catalunya”. We acknowledge support of the publication fee by the CSIC Open Access Publication Support Initiative through its Unit of Information Resources for Research (URICI). We also thank the financial support from the Generalitat de Catalunya (grants 2021SGR00875 and 2021SGR01477). R.C was a recipient of a Juan de la Cierva grant from the Spanish Ministry of Science and Innovation (IJC2020-045949-I) funded by MICIU/AEI/10.13039/501100011033 and by the “European Union Next GenerationEU/PRTR” and a Ramon y Cajal fellowship (RYC2022-037459-I) funded by MICIU/AEI/10.13039/501100011033 and by ESF+.

Data Availability Statement

The original data presented in the study are publicly available in the ENA (European Nucleotide Archive) under accession PRJEB80541.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Savé, R. In food and health, everything is too complex for simple explanations. TECA Tecnol. Ciènc. Aliment. 2023, 22, 13–17. [Google Scholar] [CrossRef]
  2. Bettenfeld, P.; Cadena i Canals, J.; Jacquens, L.; Fernandez, O.; Fontaine, F.; van Schaik, E.; Courty, P.E.; Trouvelot, S. The Microbiota of the Grapevine Holobiont: A Key Component of Plant Health. J. Adv. Res. 2022, 40, 1–15. [Google Scholar] [CrossRef] [PubMed]
  3. Pacifico, D.; Squartini, A.; Crucitti, D.; Barizza, E.; Lo Schiavo, F.; Muresu, R.; Carimi, F.; Zottini, M. The Role of the Endophytic Microbiome in the Grapevine Response to Environmental Triggers. Front. Plant Sci. 2019, 10, 1256. [Google Scholar] [CrossRef] [PubMed]
  4. Liu, D.; Howell, K. Community Succession of the Grapevine Fungal Microbiome in the Annual Growth Cycle. Environ. Microbiol. 2021, 23, 1842–1857. [Google Scholar] [CrossRef] [PubMed]
  5. Calvo-Garrido, C.; Usall, J.; Viñas, I.; Elmer, P.A.G.; Cases, E.; Teixidó, N. Potential Secondary Inoculum Sources of Botrytis cinerea and Their Influence on Bunch Rot Development in Dry Mediterranean Climate Vineyards. Pest. Manag. Sci. 2013, 70, 922–930. [Google Scholar] [CrossRef]
  6. Pinto, C.; Pinho, D.; Sousa, S.; Pinheiro, M.; Egas, C.; Gomes, A. Unraveling the Diversity of Grapevine Microbiome. PLoS ONE 2014, 9, e85622. [Google Scholar] [CrossRef]
  7. Armijo, G.; Schlechter, R.; Agurto, M.; Muñoz, D.; Nuñez, C.; Arce-Johnson, P. Grapevine Pathogenic Microorganisms: Understanding Infection Strategies and Host Response Scenarios. Front. Plant Sci. 2016, 7, 1–17. [Google Scholar] [CrossRef] [PubMed]
  8. Fournier, P.; Pellan, L.; Barroso-Bergad, D.; Bohanc, D.A.; Candresse, T.; Delmotte, F.; Dufour, M.-C.; Lauvergeat, V.; Le Marrec, C.; Marais, A.; et al. The Functional Microbiome of Grapevine Throughout Plant Evolutionary History and Lifetime. Adv. Ecol. Res. 2022, 67, 27–99. [Google Scholar] [CrossRef]
  9. Bokulich, N.A.; Thorngate, J.H.; Richardson, P.M.; Mills, D.A. Microbial Biogeography of Wine Grapes is Conditioned by Cultivar, Vintage, and Climate. Proc. Natl. Acad. Sci. USA 2013, 111, E139–E148. [Google Scholar] [CrossRef] [PubMed]
  10. Hamaoka, K.; Aoki, Y.; Takahashi, S.; Enoki, S.; Yamamoto, K.; Tanaka, K.; Suzuki, S. Diversity of Endophytic Bacterial Microbiota in Grapevine Soot Xylems Varies Depending on Wine Grape-Growing Region, Cultivar, and Shoot Growth Stage. Sci. Rep. 2022, 12, 15772. [Google Scholar] [CrossRef]
  11. Morgan, H.H.; du Toit, M.; Setati, M.E. The Grapevine and Wine Microbiome: Insights from High-Throughput Amplicon Sequencing. Front. Microbiol. 2017, 8, 820. [Google Scholar] [CrossRef] [PubMed]
  12. Stefanini, I.; Cavallieri, A. Metagenomic approaches to investigate the contribution of the vineyard environment to the quality of wine fermentation: Potentials and difficulties. Front. Microbiol. 2018, 9, 991. [Google Scholar] [CrossRef] [PubMed]
  13. Pérez-Cobas, A.E.; Gomez-Valero, L.; Buchrieser, C. Metagenomic Approaches in Microbial Ecology: An Update on Whole-Genome and Marker Gene Sequencing Analyses. Microb. Genomics 2020, 6, e000409. [Google Scholar] [CrossRef] [PubMed]
  14. Baldan, E.; Nigris, S.; Populin, F.; Zottini, M.; Squartini, A.; Baldan, B. Identification of Culturable Bacterial Endophyte Community Isolated from Tissues of Vitis vinifera “Glera”. Plant Biosyst. 2014, 148, 508–516. [Google Scholar] [CrossRef]
  15. Swift, J.F.; Hall, M.E.; Harris, Z.N.; Kwasniewski, M.T.; Miller, A.J. Grapevine microbiota reflect diversity among compartments and complex interactions within and among root and shoot systems. Microorganisms 2021, 9, 92. [Google Scholar] [CrossRef] [PubMed]
  16. Lade, S.B.; Štraus, D.; Oliva, J. Variation in Fungal Community in Grapevine (Vitis vinifera) Nursery Stock Depends on Nursery, Variety, and Rootstock. Fungi 2022, 8, 47. [Google Scholar] [CrossRef]
  17. Langa-Lomba, N.; Grimplet, J.; Sánchez-Hernández, E.; Martín-Ramos, P.; Casanova-Gascón, J.; Julián-Lagunas, C.; González-García, V. Metagenomic Study of Fungal Microbial Communities in Two PDO Somontano Vineyards (Huesca, Spain): Effects of Age, Plant Genotype, and Initial Phytosanitary Status on the Priming and Selection of Their Associated Microorganisms. Plants 2023, 12, 2251. [Google Scholar] [CrossRef]
  18. Azevedo-Silva, D.; Rasmussen, J.A.; Carneiro, M.; Gilbert, M.T.P.; Azevedo, H. Feasibility of Applying Shotgun Metagenomic Analyses to Grapevine Leaf, Rhizosphere and Soil Microbiome Characterization. Aust. J. Grape Wine Res. 2021, 27, 519–526. [Google Scholar] [CrossRef]
  19. Salvetti, E.; Campanaro, S.; Campedelli, I.; Fracchetti, F.; Gobbi, A.; Tornielli, G.B.; Torriani, S.; Felis, G.E. Whole-Metagenome-Sequencing-Based community profiles of Vitis vinifera L. cv. Corvina berries withered in two post-harvest conditions. Front. Microbiol. 2016, 7, 937. [Google Scholar] [CrossRef]
  20. Ghosh, S.; Divol, D.; Setati, M.E. A Shotgun Metagenomic Sequencing Exploration of Cabernet Sauvignon Sauvignon Grape Must Reveals Yeast Hydrolytic Enzymes. S. Afr. J. Enol. Vitic. 2021, 42, 213–222. [Google Scholar] [CrossRef]
  21. Öncü Öner, T.; Temel, M.; Pamay, S.; Abaci, A.K.; Kaya Akkale, H.B. An Improved Method for Efficient DNA Extraction from Grapevine. Int. J. Life Sci. Biotechnol. 2023, 6, 21–36. [Google Scholar] [CrossRef]
  22. Inglis, P.W.; Pappas, M.C.R.; Resende, L.V.; Grattapaglia, D. Fast and Inexpensive Protocols for Consistent Extraction of High-Quality DNA and RNA from Challenging Plant and Fungal Samples for High-Throughput SNP Genotyping and Sequencing Applications. PLoS ONE 2018, 13, e0206085. [Google Scholar] [CrossRef]
  23. Escolà, G.; González-Miguel, V.M.; Campo, S.; Catala-Forner, M.; Domingo, C.; Marqués, L.; San Segundo, B. Development and Genome-Wide Analysis of Blast-Resistant Japonica Rice Variety. Plants 2023, 12, 3536. [Google Scholar] [CrossRef]
  24. Edwards, K.; Johnstone, C.; Thompson, C. A Simple and Rapid Method for the Preparation of Plant Genomic DNA for PCR Analysis. Nucleic Acids Res. 1991, 19, 1349. [Google Scholar] [CrossRef]
  25. Wood, D.E.; Lu, J.; Langmead, B. Improved metagenomic analysis with Kraken2. Genome Biol. 2019, 20, 257. [Google Scholar] [CrossRef] [PubMed]
  26. Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data; Babraham Bioinformatics. 2010. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 1 June 2021).
  27. Lu, J.; Breitwieser, F.P.; Thielen, P.; Salzberg, S.L. Bracken: Estimating Species Abundance in Metagenomics Data. PeerJ Comput. Sci. 2017, 3, e104. [Google Scholar] [CrossRef]
  28. Ondov, B.D.; Bergman, N.H.; Phillippy, A.M. Interactive Metagenomic Visualization in a Web Browser. BMC Bioinform. 2011, 12, 385. [Google Scholar] [CrossRef]
  29. Breitwieser, F.P.; Salzberg, S.L. Pavian: Interactive Analysis of Metagenomics Data for Microbiome Studies and Pathogen Identification. Bioinformatics 2020, 36, 1303–1304. [Google Scholar] [CrossRef] [PubMed]
  30. Khleborodova, A. lefser: R Implementation of the LEfSE Method for Microbiome Biomarker Discovery; R Package, version 1.14.0; 2024. Available online: https://github.com/waldronlab/lefser (accessed on 1 February 2024).
  31. González, V.; Tello, M.L. The Endophytic Mycota Associated with Vitis vinifera in Central Spain. Fungal Divers. 2011, 47, 29–42. [Google Scholar] [CrossRef]
  32. Varanda, C.M.; Oliveira, M.; Materatski, P.; Landum, M.; Clara, M.I.; Félix, M.D. Fungal endophytic communities associated to the phyllosphere of grapevine cultivars under different types of management. Fungal Biol. 2016, 120, 1525–1536. [Google Scholar] [CrossRef]
  33. Del Frari, G.; Gobbi, A.; Aggerbeck, M.R.; Oliveira, H.; Hansen, L.H.; Ferreira, R.B. Characterization of the Wood Mycobiome of Vitis vinifera in a Vineyard Affected by Esca: Spatial Distribution of Fungal Communities and Their Putative Relation with Leaf Symptoms. Front. Plant Sci. 2019, 10, 910. [Google Scholar] [CrossRef]
  34. Knapp, D.G.; Lázár, A.; Molnár, A.; Vajna, B.; Karácsony, Z.; Váczy, K.Z.; Kovács, G.M. Above-Ground Parts of White Grapevine Vitis vinifera cv. Furmint Share Core Members of the Fungal Microbiome. Environ. Microbiol. Rep. 2021, 13, 509–520. [Google Scholar] [CrossRef]
  35. Barata, A.; Malfeito-Ferreira, M.; Loureiro, V. The Microbial Ecology of Wine Grape Berries. Int. J. Food Microbiol. 2012, 153, 243–259. [Google Scholar] [CrossRef] [PubMed]
  36. Bozoudi, D.; Tsaltas, D. The Multiple and Versatile Roles of Aureobasidium pullulans in the Vitivinicultural Sector. Fermentation 2018, 4, 85. [Google Scholar] [CrossRef]
  37. Zhang, S.; Chen, X.; Zhong, Q.; Zhuang, X.; Bai, Z. Microbial community analyses associated with nine varieties of wine grape carposphere based on high-throughput sequencing. Microorganisms 2019, 7, 668. [Google Scholar] [CrossRef] [PubMed]
  38. Rathnayake, R.M.S.P.; Savocchia, S.; Schmidtke, L.M.; Steel, C.C. Characterisation of Aureobasidium pullulans Isolates from Vitis vinifera and Potential Biocontrol Activity for the Management of Bitter Rot of Grapes. Eur. J. Plant Pathol. 2018, 151, 593–611. [Google Scholar] [CrossRef]
  39. Pertot, I.; Giovannini, O.; Benanchi, M.; Caffi, T.; Rossi, V.; Mugnai, L. Combining Biocontrol Agents with Different Mechanisms of Action in a Strategy to Control Botrytis cinerea on Grapevine. Crop Protect. 2017, 97, 85–93. [Google Scholar] [CrossRef]
  40. Galli, V.; Romboli, Y.; Barbato, D.; Mari, E.; Venturi, M.; Guerrini, S.; Granchi, L. Indigenous Aureobasidium pullulans Strains as Biocontrol Agents of Botrytis cinerea on Grape Berries. Sustainability 2021, 13, 9389. [Google Scholar] [CrossRef]
  41. Woudenberg, J.H.; Seidl, M.F.; Groenewald, J.Z.; de Vries, M.; Stielow, J.B.; Thomma, B.P.H.J.; Crous, P.W. Alternaria section Alternaria: Species, formae speciales or pathotypes? Stud. Mycol. 2015, 82, 1–21. [Google Scholar] [CrossRef] [PubMed]
  42. Yan, J.; Jayawardena, R.; Goonasekara, I.; Wang, Y.; Zhang, W.; Liu, M.; Huang, J.B.; Wang, Z.Y.; Shang, J.J.; Peng, Y.L.; et al. Diverse species of Colletotrichum associated with grapevine anthracnose in China. Fungal Divers. 2015, 71, 233–246. [Google Scholar] [CrossRef]
  43. Peng, L.J.; Sun, T.; Yang, Y.L.; Cai, L.; Hyde, K.D.; Bahkali, A.H.; Liu, Z.Y. Colletotrichum Species on Grape in Guizhou and Yunnan Provinces, China. Mycoscience 2013, 54, 29–41. [Google Scholar] [CrossRef]
  44. Echeverrigaray, S.; Scariot, F.J.; Fontanella, G.; Favaron, F.; Sella, L.; Santos, M.C.; Schwambach, J.; Pedrotti, C.; Delamare, P.L. Colletotrichum Species Causing Grape Ripe Rot Disease in Vitis labrusca and Vitis vinifera Varieties in the Highlands of Southern Brazil. Plant Pathol. 2020, 69, 1504–1512. [Google Scholar] [CrossRef]
  45. Cobos, R.; Ibañez, A.; Diez-Galán, A.; Calvo-Peña, C.; Ghoreshizadeh, S.; Coque, J.J.R. The Grapevine Microbiome to the Rescue: Implications for the Biocontrol of Trunk Diseases. Plants 2022, 11, 840. [Google Scholar] [CrossRef]
  46. Bruisson, S.; Zufferey, M.; L’Haridon, F.; Trutmann, E.; Anand, A.; Dutartre, A.; De Vrieze, M.; Weisskopf, L. Endophytes and Epiphytes from the Grapevine Leaf Microbiome as Potential Biocontrol Agents against Phytopathogens. Front. Microbiol. 2019, 10, 2726. [Google Scholar] [CrossRef]
  47. Taylor, M.W.; Tsai, P.; Anfang, N.; Ross, H.A.; Goddard, M.R. Pyrosequencing reveals regional differences in fruit associated fungal communities. Environ. Microbiol. 2014, 16, 2848–2858. [Google Scholar] [CrossRef]
  48. Bokulich, N.A.; Collins, T.S.; Masarweh, C.; Allen, G.; Heymann, H.; Ebeler, S.E.; Mills, D.A. Associations Among Wine Grape Microbiome, Metabolome, and Fermentation Behavior Suggest Microbial Contribution to Regional Wine Characteristics. mBio 2016, 7, e00631-e16. [Google Scholar] [CrossRef] [PubMed]
  49. Perelló, A.E.; Olmo, D.; Busquets, A.; Romero-Munar, A.; Quetglas, B.M.; Gost, P.A.; Berbegal, M.; Armengol, J.; Cabot, C.; Gomila, M.; et al. First Report of Shoot Blight of Grapevine Caused by Sclerotinia sclerotium in Illes Balears, Mallorca, Spain. Plant Dis. 2024, 108, 833–1124. [Google Scholar] [CrossRef] [PubMed]
  50. O’Sullivan, C.A.; Belt, K.; Thatcher, L.F. Tackling Control of a Cosmopolitan Phytopathogen: Sclerotinia. Front. Plant Sci. 2021, 12, 707509. [Google Scholar] [CrossRef] [PubMed]
  51. Pañitrur-De La Fuente, C.; Valdés-Gómez, H.; Roudet, J.; Acevedo-Opazo, C.; Verdugo-Vasquez, N.; Araya-Alman, M.; Lolas, M.; Moreno, Y.; Fermaud, M. Classification of Wine Grape Cultivars in Chile and France According to Their Susceptibility to Botrytis cinerea Related to Fruit Maturity. Aust. J. Grape Wine Res. 2018, 24, 145–157. [Google Scholar] [CrossRef]
  52. Reglinski, T.; Elmer, P.A.G.; Taylor, J.T.; Wood, P.N.; Hoyte, S.M. Inhibition of Botrytis cinerea growth and suppression of botrytis bunch rot in grapes using chitosan. Plant Pathol. 2010, 59, 882–890. [Google Scholar] [CrossRef]
  53. Wurms, K.; Ah Chee, A.; Elmer, P.; Agnew, R.; Wood, P. Developing new biologically-based products for control of botrytis bunch rot. Part 1: Developing a new natural product for mid-season botrytis control—NP2 moves closer to the market. Wine Vitic. J. 2011, 26, 64–72. [Google Scholar]
  54. Calvo-Garrido, C.; Usall, J.; Torres, R.; Teixidó, N. Effective Control of Botrytis Bunch Rot in Commercial Vineyards by Large-Scale Application of Candida sake CPA-1. BioControl 2017, 62, 161–173. [Google Scholar] [CrossRef]
  55. Carbó, A.; Torres, R.; Usall, J.; Marín, A.; Chiralt, A.; Teixidó, N. Novel Film-Forming Formulations of the Biocontrol Agent Candida sake CPA-1: Biocontrol Efficacy and Performance at Field Conditions in Organic Wine Grapes. Pest. Manag. Sci. 2019, 75, 959–968. [Google Scholar] [CrossRef]
  56. Hahn, M. The Rising Threat of Fungicide Resistance in Plant Pathogenic Fungi: Botrytis as a Case Study. J. Chem. Biol. 2014, 7, 133–141. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Shotgun metagenomic profiling of leaves from the grapevine varieties. (A) Principal coordinate analysis (PCoA) of microbial communities in leaves of the grapevine varieties Cabernet Sauvignon (C, red circles), Garnacha (G, green circles), and Marselan (M, blue circles). Datasets from the 3 biological replicates from each variety are represented. (B) Distribution of the fungal community in grapevine varieties Cabernet Sauvignon (C), Garnacha (G), and Marselan (M). For each phylum, the largest fungal classes are indicated. Data are presented as relative abundance (%).
Figure 1. Shotgun metagenomic profiling of leaves from the grapevine varieties. (A) Principal coordinate analysis (PCoA) of microbial communities in leaves of the grapevine varieties Cabernet Sauvignon (C, red circles), Garnacha (G, green circles), and Marselan (M, blue circles). Datasets from the 3 biological replicates from each variety are represented. (B) Distribution of the fungal community in grapevine varieties Cabernet Sauvignon (C), Garnacha (G), and Marselan (M). For each phylum, the largest fungal classes are indicated. Data are presented as relative abundance (%).
Horticulturae 10 01333 g001
Figure 2. Sankey diagrams of the most abundant fungal taxa identified in the grapevine leaves of Cabernet Sauvignon (A), Garnacha (B), and Marselan (C) from the domain on the left to species on the right. The relative abundance of the top 20 taxa in each variety is presented. The width of the bar is proportional to the abundance. Nodes depict the hierarchy levels of microbial taxa. The graph was created with Pavian [29]. Data used for the construction of the Sankey diagrams of fungal communities are shown in Supplemental Table S3.
Figure 2. Sankey diagrams of the most abundant fungal taxa identified in the grapevine leaves of Cabernet Sauvignon (A), Garnacha (B), and Marselan (C) from the domain on the left to species on the right. The relative abundance of the top 20 taxa in each variety is presented. The width of the bar is proportional to the abundance. Nodes depict the hierarchy levels of microbial taxa. The graph was created with Pavian [29]. Data used for the construction of the Sankey diagrams of fungal communities are shown in Supplemental Table S3.
Horticulturae 10 01333 g002
Figure 3. Specific fungal signatures in comparisons of grapevine varieties at the species level. Linear discriminant analysis (LDA) of effect size (LEfSe) was used to identify the most differentially abundant fungal species in the leaves of grapevine varieties. Data shown in Supplemental Table S3 were used for plot generation up to the species level. Significantly enriched fungal species at a p value < 0.05 and log10-transformed LDA score > 2 are presented for each comparison. (A) Cabernet Sauvignon–Garnacha. (B) Cabenet–Marselan. (C) Garnacha–Marselan. Green, fungal species enriched in Garnacha; red, fungal species enriched in Cabernet Sauvignon; blue, fungal species enriched in Marselan.
Figure 3. Specific fungal signatures in comparisons of grapevine varieties at the species level. Linear discriminant analysis (LDA) of effect size (LEfSe) was used to identify the most differentially abundant fungal species in the leaves of grapevine varieties. Data shown in Supplemental Table S3 were used for plot generation up to the species level. Significantly enriched fungal species at a p value < 0.05 and log10-transformed LDA score > 2 are presented for each comparison. (A) Cabernet Sauvignon–Garnacha. (B) Cabenet–Marselan. (C) Garnacha–Marselan. Green, fungal species enriched in Garnacha; red, fungal species enriched in Cabernet Sauvignon; blue, fungal species enriched in Marselan.
Horticulturae 10 01333 g003
Figure 4. Relative abundance of selected fungal species identified as specifically enriched in one or another grapevine variety. C, Cabernet Sauvignon; G, Garnacha; M, Marselan. Asterisks indicate significant differences between varieties (two-tailed t-test, p value < 0.05). Red asterisks indicate significant differences after Bonferroni correction (cutoff p ˂ 0.004).
Figure 4. Relative abundance of selected fungal species identified as specifically enriched in one or another grapevine variety. C, Cabernet Sauvignon; G, Garnacha; M, Marselan. Asterisks indicate significant differences between varieties (two-tailed t-test, p value < 0.05). Red asterisks indicate significant differences after Bonferroni correction (cutoff p ˂ 0.004).
Horticulturae 10 01333 g004
Figure 5. Distribution of bacterial communities in the grapevine varieties Cabernet Sauvignon (C), Garnacha (G), and Marselan (M) at the phylum (A) and class (B) levels. Data are presented as relative abundance (%).
Figure 5. Distribution of bacterial communities in the grapevine varieties Cabernet Sauvignon (C), Garnacha (G), and Marselan (M) at the phylum (A) and class (B) levels. Data are presented as relative abundance (%).
Horticulturae 10 01333 g005
Figure 6. Sankey diagrams of the most abundant bacterial taxa identified in grapevine leaves of Cabernet Sauvignon (A), Garnacha (B), and Marselan (C) from domain (left) to species (right). The relative abundance of the top 20 taxa in each variety is presented. The width of the bar is proportional to the abundance. Nodes depict hierarchy levels of microbial taxa. Data used for the construction of Sankey diagrams are shown in Supplemental Table S3.
Figure 6. Sankey diagrams of the most abundant bacterial taxa identified in grapevine leaves of Cabernet Sauvignon (A), Garnacha (B), and Marselan (C) from domain (left) to species (right). The relative abundance of the top 20 taxa in each variety is presented. The width of the bar is proportional to the abundance. Nodes depict hierarchy levels of microbial taxa. Data used for the construction of Sankey diagrams are shown in Supplemental Table S3.
Horticulturae 10 01333 g006
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Castanera, R.; González-Miguel, V.M.; Escolà, G.; Olivé, M.; Teixidó, N.; Savé, R.; Casacuberta, J.M.; San Segundo, B. Cultivar-Dependent Variations in the Microbiome of Grapevine Leaves. Horticulturae 2024, 10, 1333. https://doi.org/10.3390/horticulturae10121333

AMA Style

Castanera R, González-Miguel VM, Escolà G, Olivé M, Teixidó N, Savé R, Casacuberta JM, San Segundo B. Cultivar-Dependent Variations in the Microbiome of Grapevine Leaves. Horticulturae. 2024; 10(12):1333. https://doi.org/10.3390/horticulturae10121333

Chicago/Turabian Style

Castanera, Raúl, Víctor M. González-Miguel, Glòria Escolà, Marta Olivé, Neus Teixidó, Robert Savé, Josep María Casacuberta, and Blanca San Segundo. 2024. "Cultivar-Dependent Variations in the Microbiome of Grapevine Leaves" Horticulturae 10, no. 12: 1333. https://doi.org/10.3390/horticulturae10121333

APA Style

Castanera, R., González-Miguel, V. M., Escolà, G., Olivé, M., Teixidó, N., Savé, R., Casacuberta, J. M., & San Segundo, B. (2024). Cultivar-Dependent Variations in the Microbiome of Grapevine Leaves. Horticulturae, 10(12), 1333. https://doi.org/10.3390/horticulturae10121333

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop