Early Generation Selection of Potato Breeding Lines

Abstract

Potato is the third most important food crop in the world in terms of adaptability, yield potential, and nutritional advantages. This study aimed to conduct potato breeding work for cultivation in Kazakhstan; potato breeding for further processing into chips with cultivation in the northern regions; and the selection of potatoes for processing into frozen French fries with cultivation in the southern and south-eastern regions. Potato varieties (Fontane, Santana, and Punchy) were used as reference varieties to check molecular markers linked to maturity, tuber shape, and flesh color. A total of 42 potato breeding lines crossed from Yagodnyi 19 and CIP clone 397079-6 were used in this study to identify prospective breeding lines. The research was carried out between 2023 and 2024 and under greenhouse conditions. According to the results of molecular analysis and phenotypic data, 21 breeding lines were identified as prospective potato breeding lines. The majority of these potato breeding lines had a round tuber shape and were recommended for chip processing. Three breeding lines had a long oval tuber shape, making them suitable for French fries. Six breeding lines with short-oval and oval tuber shapes were found for consumer potato processing. It is recommended that the breeding process and studies of biochemical properties are continued in all of these identified potato breeding lines.

1. Introduction

Potato (Solanum tuberosum L.) is known to be the third most important food crop in the world in terms of adaptability, yield potential, and nutritional advantages. Its cultivation history dates back over 8000 years [1]. Potato growing is one of the key sectors in the agro-industrial complex that determines Kazakhstan’s food security. Potato is a dual-purpose crop used for fresh food and processing. Potatoes are grown annually across more than 193.0 thousand hectares, with a production volume of about 3788.1 thousand tons, and the average potato yield is 30–45 tons/ha [2,3,4,5]. According to the Bureau of National Statistics of the Republic of Kazakhstan, imports and exports of potatoes in 2023 were 52.9 thousand tons and 241.7 thousand tons, respectively [5]. The import volume of seed potatoes is 1.73 thousand tons. In 2023, the export volume of seed potatoes was 11.9 thousand tons to Uzbekistan and 0.1 thousand tons to Tajikistan [5]. Since the 2000s, potato growers in Kazakhstan have imported modern, highly productive potato varieties from European countries for seed production and for the processing industry. However, most of these varieties are not adapted for cultivation in Kazakhstan, and therefore have low yields. Simultaneously, the breeding program in Kazakhstan does not meet modern requirements, in particular due to factors such as rapid variety change caused by shifting market requirements and global climate change. The main requirements of Kazakh potato varieties are: high yield, excellent presentation, high-keeping quality, and resistance to biotic and abiotic stresses. There is an urgent need for potato producers to produce domestic varieties for various purposes that are competitive in domestic and foreign markets. Furthermore, the presence of competitive domestic potato varieties is one of the key components of the country’s food security. At the same time, Kazakhstan has a number of advantages for the development of potato production: firstly, there are no problems with observing a four-field crop rotation; secondly, the sharply continental climate: severe winters help to destroy pathogens, and dry summers simplify control over bacterial and fungal diseases and aphids. Kazakh farmers suggest conducting the breeding work of Kazakhstan in three directions: (1) consumer potato selection for cultivation in the northern regions; (2) potato breeding for further processing into chips with cultivation in the northern regions; and (3) selection of potatoes for processing into frozen French fries with cultivation in the southern and south-eastern regions. The development of new varieties may also contribute significantly to climate change adaptation. Solving these problems would give an opportunity to export the potato to CIS countries.

Potato maturity, tuber shape, flesh color, and starch are the most important qualities for potatoes intended for chips and French fries [6]. The breeding of varieties of different maturity is highly significant in the potato industry’s development. Early maturity is important for potato production in the northern region.

Potato maturity is a quantitative trait controlled by multiple genes, and it is one of the major agronomic characteristics or indicators for selecting suitable varieties in different agroecological zones. Early maturity is known as the most important agronomical trait in potato breeding. Potato maturity is controlled by minor recessive polygenes, which are distributed in 12 chromosomes [7]. Since diploid potatoes have simpler genetic ratios compared to tetraploids, it is easy for genetic analysis and molecular operations to be carried out. Three molecular markers (SCARA2-2, SCARA4-21, and SCARA5-16) linked to maturity have been identified by simplified genome 2b-RAD (2b-restriction site-associated DNA) sequencing. These markers have shown positive results for late maturity and negative results for early maturity [8].

In modern varieties, shallow eyes, tuber color, and a round or oblong shape have become significant factors for ease of processing. As a result of long-term artificial selection and domestication, only potatoes with uniform shapes have been preserved, which has reduced the polymorphism in potato tuber shapes [9]. Tuber shape is one of the most significant morphological traits in the potato processing industry and for fresh market use [6,10]. In order to meet the processing needs of the industry and market, it is important to breed varieties with different tuber shapes and guarantee the stable inheritance of those shapes [11]. A poor and irregular shape increases peeling losses, which leads to higher costs in the processing industry [11,12]. Tubers can be categorized into two (round, long), three (round, oval, and long), four (round, oval, long oval, very long oval), or six (long, long oval, oval, round oval, round, compressed) shapes, according to LW values [13,14,15]. For potato processing purposes, round tubers are usually used to make chips, while long tubers are used for frying [14,16,17]. Previous studies have shown that the Ro locus on chromosome X is the major locus controlling tuber shape, and the round shape allele, Ro, is dominant compared to the long shape allele, ro [12,18].

Tuber flesh color is a vital trait, as the biological variation (white to yellow/dark yellow) in this variable indirectly relates to the carotenoids in the tuber tissue. Several candidate genes, like β-carotenehydroxylase (CHY) [19,20,21] and zeaxanthin epoxidase (ZEP) [22,23,24], have been found to relate to tuber flesh color. Further studies [25] show that among eleven alleles of β-carotene hydroxylase 2 (Chy2), only one dominant allele has a major effect, changing the flesh from a white to a yellow color. The content of micronutrients (vitamins and minerals) varies, depending on flesh color. Yellow flesh is primarily due to the presence of minerals, carotenoids, and vitamin C compared to red, purple, and blue flesh colors. Over the past 7–8 years, varieties with yellow flesh in Kazakhstan have become popular on the local market.

In potato tubers, the main component of dry matter is carbohydrates, making up about 75% of the total dry matter. These carbohydrates are mostly made up of starch [26]. There is a large variation in starch content in cultivated potatoes, ranging from approximately 15 to 20% of the fresh weight [27]. Despite the fact that starch content has a strong genetic basis, much of the variation is due to the length of the potato plant’s life cycle [28]. Late-maturing varieties tend to have higher starch yields compared to early-maturing varieties [29]. Different sets of genes (AGPase [30,31,32,33], SSSI, SSSII, SSSIII, GBSSI [34,35], StPho1a, StPho2 [30,36,37]) control the synthesis and the degradation of starch granules and influence potato quality traits. For most of the genes above, genome sequences are known, opening up an avenue for marker-assisted breeding for starch content.

The use of molecular markers in potato breeding offers new opportunities for genotype selection. To date, many markers have been discovered that are associated with useful traits such as cultivar identification [38,39], genetic diversity [40,41], the molecular improvement of potato tuber traits [42,43,44,45,46], the identification of gene-controlling traits [47,48], and assisted selection [38,49]. Marker-assisted selection (MAS) is one of the most effective applications of biotechnology in plant breeding since it makes selection more efficacious and speeds up the breeding process.

The aim of the present research is to examine the association between the presence of genes responsible for the most important traits of table potatoes, French fries, and chips, including early maturity, tuber shape, flesh color, and starch-related genes. We have attempted to increase the efficiency of breeding work in the early stages of the breeding process. Therefore, several molecular markers were used, which would increase the reliability of the obtained data and reduce the number of potato breeding lines that do not meet the requirements of farmers and potato cultivation in Kazakhstan.

2. Materials and Methods

2.1. Plant Materials

Potato genotypes (Yagodnyi 19 and CIP 397079-6) were selected and crossed according to different selection criteria related to early maturity, tuber shape, starch-related genes, and flesh color, with the aim of creating a potato variety for table potatoes, chips, and French fries. This study was carried out on potato genotypes (Yagodnyi 19, CIP 397079-6, Fontane, Santana, and Punchy) and 42 potato breeding lines. Potato varieties (Fontane, Santana, and Punchy) with early maturity, different tuber shapes, and flesh colors were used as reference varieties to select molecular markers (

Table 1. Characterization of potato varieties for the breeding program.

Name	Origin	Maturity Type	Tuber Shape	Flesh Color	References
Yagodnyi 19	North-West Scientific and Production Center of Agriculture, Kazakhstan	Medium early	Round oval	White	[50]
CIP 397079-6	Clonal selection cross between “386768.10” and “392820.1”, International Potato Center (CIP), Peru	Early	Oblong	White creme	[51]
Fontane	Svalof Weibull BV, Netherlands	Early	Oval to long oval	Medium yellow	[52]
Santana	HZPC Holland BV, Netherlands	Medium early	Big long oval	Crème	[53]
Punchy	Germicopa, France	Medium early	Round	Yellow	[54]

).

2.2. True Potato Seed Planting

One berry was obtained after the pollination of 10 flowers. The number of botanical seeds was 55, of which 42 formed plants. True potato seeds from potato berry were hydrated and treated with 1500 ppm gibberellic acid (GA) overnight. The GA-treated true potato seeds were then surface-sterilized by submersion in 10% bleach, followed by 70% ethanol and distilled water washes. The sterilized true potato seeds were placed on a 1% agar plate and allowed to germinate for up to seven days. Once signs of germination had been observed, the seeds were transferred to a tube containing MS medium and GA (0.2 mg/L) for two weeks. Ten clonal plantlets from each initial seedling were propagated. The plantlets were grown in a growth chamber for four weeks. Indoor growing conditions were a 16:8 day/night cycle and a constant temperature of 20–22 °C. Plants were allowed to grow in the greenhouse for approximately 4–5 months, until they entered senescence and formed microtubers.

2.3. Growing of Minitubers in the Greenhouse

Ten microtubers from each breeding lines were planted in 200 mL plastic pots with soil-neutral Agrobalt (pH-5.5). The plants were watered every 3 days and treated with Fertilizer Aquarin Universal (N: NO3-3.9%, NH2-12.0%, NH4-2.1%, and P2O5-18.0%) after sowing, twice a month, and additionally treated with Kornevin (Indole-3-butyric acid, 5 g/kg) to develop the plant root system. Once plants had grown up to 8 cm, they were transferred into pots measuring 13 cm wide and 30 cm long. After 3 days, the plants were treated with Epin (24-Epibrassinolide, 0.025 g/L) every 2 weeks for 90 days. When the plants reached a height of 15 cm, they were transplanted into pots measuring 10 cm wide, 18 cm long, and 6 cm deep, with 1 plant per pot. Plants were allowed to grow in the greenhouse for approximately 6 months, until they entered senescence and produced the maximum number of minitubers. Minitubers were harvested from each pot on two occasions, 20 May and 26 July 2024, forming a sample of minitubers.

2.4. Phenotypic Data Measurements

Tuber shape was measured as the ratio of tuber length to width (roundness score) and tuber length to thickness (flatness score). The length (mm) of the tuber was the distance from the stolon end to the bud end, the width (mm) was the highest dimension in the equatorial area of the tuber, and thickness (mm) was measured perpendicularly to the width [46]. The tuber shape was determined according to Hara-Skrzypiec’s research [55], which described six tuber shapes: tubers with LW ≤ 0.8 are compressed; 0.8 < LW ≤ 1.2 are round; 1.2 < LW ≤ 1.6 are round-oval; 1.6 < LW ≤ 2 are oval; 2 < LW ≤ 2.4 are long-oval; and LW > 2.4 are long. The total tuber number of breeding lines was calculated per pot/plant. The total tuber weight per plant was calculated from each tuber yield of the pot. The average tuber weight was calculated by dividing the total tuber yield of the pot by the number of tubers [43].

2.5. DNA Extraction

Potato DNA samples were extracted from 100 g of potato leaves using the Qiagen Plant DNeasy Kit, according to the manufacturer’s instructions (Qiagen, Valencia, CA, USA). DNA quality was measured according to the OD260nm/OD280nm ratio, using a Nanodrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA), and by 1% agarose gel electrophoresis. The DNA concentration was quantified using a Qubit 4 fluorometer (Thermo Fisher Scientific, Waltham, MA, USA).

2.6. Molecular Markers

The molecular screening of potato breeding lines was carried out with 29 molecular markers, as suggested by researchers [8,18,19,56,57,58,59,60,61,62], based on early maturity, tuber shape, starch-related genes, and flesh color (

Table 2. Characterization of molecular markers for early maturity, tuber shape, flesh color, and starch-related genes.

Name	Primer sequence (5′-3′)	Product Length (bp)	Reference
Early maturity
SCARA2-2	ACAGCTCGGCGAGAAAACAG TCAAGCAATTAGGGCGGTG	500	Hui et al., 2022 [8]
SCARA4-21	TCACTTTGGCGACCACACTT CAGACCCGCTTACGCTAAGAT	700	Hui et al., 2022 [8]
SCARA5-16	TTTTTGTGATCAGGGGCGG TGCATTGCATCCTCCCAAC	100	Hui et al., 2022 [8]
Tuber shape
SCAR14S6	CTTTTTTATGCTCTTTCATACCTAAC CAAAAATTGTCACAACTTATATACTGAC	570	Chen et al., 2019 [18]
SCAR14S15	TTCGATGGAGTATATTAGTCAGAGG GCAGAGACGAAACTAGAATTTCAAA	750	Chen et al., 2019 [18]
SCAR17S9	CAGGCTACCGCCATTTTTAC TTTCACATCTCACAAAGTTTAGCAAT	700	Chen et al., 2019 [18]
SCAR20S2	ATTAGACTTGTCTGTAAATGTGAGTAAA CTCTAGGAGATAGCCTAGAACCTAAAT	850	Chen et al., 2019 [18]
SCAR26S35	CGTGGCATATTTAAGACGACG GAATCAATAGTTAGGACAAATGAATTG	300	Chen et al., 2019 [18]
Flesh color
AWZEP25/AWZEP20	CTGGCTGCATCACTGGTCAAAG TCATTCATAATTGTATCCTCCC	572	Sulli et al., 2017 [56]
StZEP_RT_F/StZEP_RT_R	AAGTGCCGAGTCAGGAAGCC CAAGTCCGACGCCAAGATAAGC	2046	Destefano-Beltrán et al., 2006 [57]
AS-chy	TAGAGCTCGGGATTACTTC ATGGATCCTCCTTTTCCAA	2900	Diretto et al., 2007 [58]
Chy1	CTTGGCCCAAAACCCACTT CCTCAAATTGAGGTTTCAGCTTCT	152	Goo et al., 2015 [19]
Chy2	TTTTGCTGTCTCGAAGAAAGCC AGCCAACAGGCAGCTAAACTCT	148	Goo et al., 2015 [19]
StChy2	CGAGATGGGCTCATAGAGCACT GAAAGTAAGGCACGTTGGCAAT	4390	Bourke et al., 2019 [59]
Nxs	CTTGGAGGAGACTTCTTTGGTGA CGGAAGTGGTCCTCCCATAG	100	Sokolowska et al., 2013 [60]
Psy1	CGGTCTGCTATTGTTGCTACTCC CAGGAACAGGTATGTCTGGCTTC	141	Goo et al., 2015 [19]
Psy2	AGCTTTAGATAGGTGGGAGGCA CAAGTCCATACGCATTCCTTCAA	162	Goo et al., 2015 [19]
PDS	AGAGACTTTGCATGCCGATTGT AAAGCATCGCCCTCAACTGT	151	Goo et al., 2015 [19]
ZDS	TTGCCATGTCAAAGGCCA ACAGGCACTCCGACCAATTT	141	Goo et al., 2015 [19]
CrtISO	TTGGCAGCAGTAGGACGTAAAC TCCCTTCCTTTTCATGTGGAA	151	Goo et al., 2015 [19]
Lcy-e	GCCAAAATGGATGTGGCAG CAATGTTGCACCAGTAGGATCAG	151	Goo et al., 2015 [19]
Lut1	CGTTCTCCGCCCAAAAAAC TTGGCCTAAAGTAAGTGACCTGG	140	Goo et al., 2015 [19]
Lcy-b	AATGGGTGGTCCACTTCCAGTA GGATGGATGAACCATGCCAG	76	Goo et al., 2015 [19]
CrtI	GCGACCAGTAGCATCTAC GTTAGATGCCACGGCTTG	623	Cong et al., 2009 [61]
Starch-related genes
AGPaseS	AAGCCTAATATCTGCATGTCA GAGCACATCTTCTATGTCCTT	500	Werij et al., 2012 [62]
SSSIII	AACAAAAGTTCAGGTCCTCTCTC AAATCCCACCATCTTCTCTCTC	1500	Werij et al., 2012 [62]
StPho1b	ACACACTATGTTCTGCTTCTCTTC ACTATCCTCCACCTCAACCTTC	6000	Werij et al., 2012 [62]
StPho2	GCATACTATGCTGCTACTGCTG GCACATCATATGCAAGAGCCTG	850	Werij et al., 2012 [62]
StUCP	GAACCCTTTTAGTTTCTCTTT TGCCAACAGTACCTAATAATC	1300	Werij et al., 2012 [62]

). Molecular markers were synthesized by Macrogen Inc. (Seoul, South Korea).

2.7. PCR Analysis

PCRs were performed in 20 μL volume tubes containing 1× reaction buffer with 1.6 mM MgCl2, 0.2 mM of each dNTP, 30 pM forward primer, 30 pM reverse primer, 5 U/uL unit of Dream Taq polymerase (Thermo Fisher Scientific, Waltham, MA, USA), and 30 ng of genomic DNA. Amplification consisted of 1 cycle at 94 °C for 45 s; 33 cycles of 30 s 94 °C, 30 s 55 °C, 1 min 72 °C; and 5 min 72 °C. Amplification products were checked and quantified on 2% agarose/TAE gel using 1 Kb plus ladder (Thermo Fisher Scientific, Waltham, MA, USA) and displayed in the gel documentation (Gel Doc XR+ Gel Documentation System, BioRAD, CA, USA).

2.8. Statistical Analysis

Multivariate analyses were performed, including basic statistics and correlation analysis to categorize each breeding line. A multivariate scatterplot matrix was analyzed to calculate correlation coefficients, using Pearson’s correlation method for phenotypic components of each potato line. Breeding lines were treated as the main fixed effects, while other indicators such as tuber shape, skin and flesh color, average tuber number per plant, average weight per tuber, and length/width (L/W) ratio were treated as random effects and were conducted for each tuber trait using mixed fit models. Tuber morphological traits were analyzed with other effects to generate the best linear unbiased estimates (BLUE). BLUE was calculated for each breeding line, and was estimated as

$$Y_i=m_i+\sum _i{R}_i$$

where $m_i$ is the mean value of main morphological traits and $R_i$ is the sum of breeding lines’ phonotypical traits. All the analyses were carried out using statistical software package JMP Pro 17 (SAS Institute, Cary, NC, USA).

3. Results

3.1. Molecular Analysis of Potato Genotypes for Tuber Shape Traits Using Molecular Markers

The evaluation of breeding lines in early breeding stages should be based on traits with high heritability (i.e., quality traits such as tuber shape and tuber flesh color) and for resistance to pathogens, while evaluations at later stages should be conducted in many target environments and based on traits with lower heritability (yield and yield components, dormancy, dry matter and starch content, and tuberization). In the first step of the breeding program, potato varieties were screened as candidates of parent forms for table potatoes, chips, and French fries. The CIP clone 397079-6 was chosen as a parent form and selected for French fries. However, it is a clone, and thus, it is genetically unstable. Therefore, the CIP clone 397079-6 was selected in order to increase the genetic diversity of the breeding materials for the processing industry. Subsequently, the identified potato genotypes were used for the breeding program. For the evaluation, potato breeding line reference potato varieties were studied using molecular markers for quality traits such as early maturity, tuber shape, flesh color, and starch-related genes (

Table 3. Identification of potato varieties for early maturity and tuber traits.

Traits	Molecular Markers	Fontane	Santana	Punchy	Yagodnyi 19	CIP 397079-6
Maturity type	SCARA2-2	0 *	1 *	1	1	0
	SCARA4-21	0	1	1	0	0
	SCARA5-16	0	1	1	0	0
Tuber shape	SCAR14S6	0	0	1	1	0
	SCAR17S9	0	0	1	1	0
	SCAR26S35	0	0	1	1	0
Flesh color	AWZEP25/AWZEP20	0	0	1	0	0
	AS-chy	0	0	1	0	0
	CHY2	0	1	1	0	1
	CrtISO	1	0	1	0	0
	Lcy-e	0	1	1	0	0
	Lcy-b	1	1	1	0	0
Starch-related genes	AGPaseS	0	0	1	0	1
	SSSIII	0	0	1	0	0
	StPho1b	0	1	1	0	0
	StPho2	0	0	1	0	0
	StUCP-	0	0	1	0	0

* Note—“1” means amplification product is present; “0” means amplification product is not present.

). In order to identify informative molecular markers, we selected reference varieties that, according to previous studies [52,53,54], match with regard to maturity, tuber shape, and flesh color. We conducted molecular screening on reference varieties with all the molecular markers that are listed in Table 1; however, some markers were uninformative. Therefore, in Table 3, there are only those molecular markers that were confirmed by phenotypic data of reference varieties for traits such as early maturity, tuber shape, and flesh color.

Three molecular markers (SCARA2-2, SCARA4-21, and SCARA5-16) linked to maturity were identified by simplified genome 2b-RAD (2b-restriction site-associated DNA) sequencing. Extremely early maturity varieties did not form PCR amplification products, while extremely late maturity varieties gave positive reactions, according to Hui et al., 2022 [8]. According to molecular analysis, Fontane and CIP 397079-6 potato genotypes did not form the expected amplification product, while Santana and Punchy varieties confirmed a positive reaction according to all three markers. Fontane and CIP 397079-6 are early maturity genotypes, while Yagodnyi 19, Santana, and Punchy are medium–early varieties. The maturity type of these genotypes was confirmed with molecular markers. Yagodnyi 19 showed a negative reaction using two molecular markers, SCARA4-21 and SCARA5-16, which confirmed a mid-early maturity type.

Chen et al. (2019) [18] developed SCAR markers (SCAR14S6, SCAR14S15, SCAR17S9, SCAR20S2, and SCAR26S35) in order to breed lines for the tuber shape gene Ro. According to this study, genotypes that have the Ro region amplify PCR products. In our study, potato varieties with round tuber shape varieties (Punchy and Yagodnyi 19) were positive, while genotypes with an oval or long tuber shape (Fontane, Santana, and CIP 397079-6) did not form the expected PCR product. The results of the molecular screening to check tuber shape showed that three markers (SCAR14S6, SCAR17S9, and SCAR26S35) were informative when identifying potato tuber shape based on referent potato varieties.

The flesh color in most tetraploid potato cultivars ranges from white, via cream and yellow, to dark yellow. The yellow color is caused by the presence of specific carotenoids. Potato genotypes are yellow-fleshed and characterized by high levels of epoxy-xanthophylls and xanthophyll esters and by the presence of at least one copy of a dominant allele of the β-carotene hydroxylase 2 (CHY2) gene, and white-fleshed genotypes are characterized by low carotenoid levels and the presence of recessive chy2 alleles [56]. In our study, the referent variety Punchy, with a yellow flesh color, formed the expected PCR product using six molecular markers (AWZEP25/AWZEP20, AS-chy, CHY2, CrtISO, Lcy-e, and Lcy-b) among sixteen molecular markers, while Yagodnyi 19, with white flesh, did not show a positive PCR product.

Different sets of genes control the synthesis and degradation of starch granules and affect the quality traits of potatoes. To analyze the influence of these genes on the phenotypic variability of starch properties and chip color, the use of molecular markers associated with starch is a suitable method. We identified genotypes that have genes involved in starch metabolism in the AGPaseS, SSSIII, StPho1b, StPho2, and StUCP loci using five different SCAR and CAPS markers. The results of the PCR showed that, in Punchy, all five starch-related genes were present, while in Fontane and Yagodnyi 19 varieties, the expected PCR product did not form.

3.2. Molecular Screening and Phenotypic Data of Potato Breeding Lines

In total, 42 potato breeding lines from the Yagodnyi 19×CIP 397079-6 cross were characterized for the presence of genes for early maturity (SCARA2-2, SCARA4-21, and SCARA5-16), tuber shape (SCAR14S6, SCAR14S15, SCAR17S9, SCAR20S2, and SCAR26S35), flesh color (AWZEP25/AWZEP20, StZEP-F/StZEP-R, AS-chy, Chy1, CHY2, StChy2, Nxs, Psy1, Psy2, PDS, ZDS, CrtISO, Lcy-e, Lut1, Lcy-b, and CrtI), and starch-related genes (AGPaseS, SSSIII, StPho1b, StPho2, and StUCP) using molecular markers (

Table 4. Identification of potato breeding lines for early maturity, tuber shape, and starch-related genes.

Name of the Breeding Lines	Maturity Type			Tuber Shape					Starch-Related Genes
	SCARA202	SCARA4021	SCARA5016	SCAR14S6	SCAR14S15	SCAR17S9	SCAR20S2	SCAR26S35	AGPaseS	SSSIII	StPho1b	StPho2	StUCP0
YF-1	1 *	0 *	1	1	1	1	0	1	0	0	0	1	1
YF-2	0	0	0	0	1	0	0	1	1	1	0	0	0
YF-3	0	0	0	0	0	0	0	0	0	0	0	0	0
YF-4	1	1	0	0	0	1	0	1	0	0	0	1	1
YF-5	0	0	0	0	1	1	0	0	0	0	0	0	1
YF-6	1	1	0	0	0	1	1	1	0	0	1	0	1
YF-7	1	1	0	0	0	1	1	0	0	0	0	1	1
YF-8	1	1	0	0	1	1	1	1	1	0	0	0	0
YF-9	1	1	0	0	1	1	1	1	0	0	1	0	1
YF-10	0	1	1	0	1	1	1	0	0	0	1	1	1
YF-11	0	0	0	0	1	0	0	0	0	0	0	0	0
YF-12	1	1	0	0	1	1	1	1	1	0	1	1	0
YF-13	1	1	1	0	1	1	1	1	1	0	0	1	1
YF-14	1	1	1	0	0	1	1	0	0	0	1	1	1
YF-15	0	0	0	0	0	1	0	1	0	0	0	0	1
YF-16	1	0	0	0	1	1	0	0	0	0	0	0	1
YF-17	0	0	0	0	1	0	0	0	0	0	0	0	0
YF-18	1	0	1	0	0	1	0	1	1	0	1	1	1
YF-19	1	0	0	0	0	1	0	0	0	0	0	0	1
YF-20	1	0	0	0	1	0	0	1	1	0	1	1	1
YF-21	0	0	0	0	1	0	0	1	0	0	1	1	1
YF-22	0	0	0	0	1	0	0	1	1	0	1	0	1
YF-23	0	0	0	0	1	1	0	1	0	0	1	1	1
YF-24	0	1	0	0	1	1	1	1	1	0	1	1	1
YF-25	0	0	0	0	0	0	0	0	0	0	0	0	0
YF-26	1	1	1	1	1	1	1	0	0	0	0	0	1
YF-27	0	0	0	0	0	0	0	1	0	0	1	0	0
YF-28	1	0	1	0	1	1	0	0	1	0	1	1	1
YF-29	0	0	0	0	1	0	0	0	0	0	0	0	0
YF-30	0	0	1	0	1	1	0	0	1	0	1	0	1
YF-31	0	0	0	0	1	1	0	0	0	0	0	1	1
YF-32	1	0	0	0	1	1	0	0	0	0	1	1	1
YF-33	0	0	0	0	0	1	0	0	0	0	0	1	1
YF-34	1	0	0	1	1	1	0	0	0	0	1	1	1
YF-35	1	0	1	0	0	1	0	0	1	0	1	1	1
YF-36	0	0	0	0	0	1	0	0	0	0	0	1	0
YF-37	0	0	0	0	1	1	0	0	0	0	0	1	1
YF-38	1	0	1	0	0	1	0	0	1	0	1	1	1
YF-39	0	0	0	0	0	0	0	0	0	0	1	0	1
YF-40	0	0	0	0	1	0	0	0	0	0	0	0	0
YF-41	0	0	0	0	0	1	0	1	0	0	0	1	1
YF-42	1	0	0	0	0	0	0	0	0	0	0	0	0

* Note—“1” means amplification product is present; “0” means amplification product is not present.

and

Table 5. Identification of potato breeding lines for tuber flesh color.

Name of the Breeding Lines	AWZEP20/AWZEP25	StZEP_RT	AS0chy	Chy1	Chy2	StChy2	Nxs	Psy1	Psy2	PDS	ZDS	Crtlso	Lcy0e	Lut1	Lcy0b	CrtI
YF-1	1 *	1	1	0	1	0	1	1	0	0	1	1	1	1	1	1
YF-2	0 *	0	0	0	0	0	1	1	0	0	0	0	1	1	1	0
YF-3	0	1	0	0	0	1	1	1	1	1	0	0	1	0	1	0
YF-4	1	1	1	0	0	1	1	0	1	1	1	1	0	0	1	1
YF-5	1	1	0	0	0	1	1	1	1	1	1	1	1	1	1	0
YF-6	1	0	1	0	0	1	1	1	1	1	1	1	1	1	1	1
YF-7	1	0	1	0	1	1	1	1	1	1	1	1	1	1	1	1
YF-8	1	1	1	1	0	0	1	1	1	1	1	0	1	1	1	0
YF-9	0	0	0	1	0	0	1	1	0	1	1	0	1	1	1	1
YF-10	1	1	1	0	0	0	1	1	1	1	1	0	1	1	1	1
YF-11	1	0	0	1	0	0	1	0	0	1	0	0	1	0	1	0
YF-12	1	1	0	0	1	0	0	1	0	1	1	1	1	1	1	1
YF-13	0	0	1	1	0	1	1	1	0	1	1	1	0	1	1	1
YF-14	1	0	1	1	0	0	1	1	1	1	1	1	0	1	1	1
YF-15	1	1	1	0	0	0	0	1	1	1	1	0	0	1	1	1
YF-16	1	0	1	0	0	1	0	0	0	1	1	1	1	0	1	1
YF-17	0	0	0	0	0	0	0	0	0	1	0	0	0	1	1	0
YF-18	1	0	1	0	0	1	0	1	0	1	0	1	1	0	0	1
YF-19	1	0	1	0	0	1	0	1	0	1	1	0	1	0	1	1
YF-20	0	0	0	0	0	1	1	1	0	1	1	1	1	1	0	1
YF-21	1	1	1	0	0	1	1	1	1	1	0	1	1	1	1	1
YF-22	0	0	1	0	0	1	0	0	1	1	0	1	1	1	1	0
YF-23	1	1	1	0	0	1	0	1	1	1	0	1	1	1	1	0
YF-24	0	0	1	0	0	1	0	1	0	0	0	1	1	1	1	1
YF-25	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	0
YF-26	0	1	1	0	0	0	0	1	0	0	1	1	1	1	1	0
YF-27	1	0	0	0	0	1	0	1	0	1	0	0	0	1	1	0
YF-28	0	0	1	0	0	0	0	1	1	1	1	0	1	0	1	0
YF-29	1	0	0	0	0	1	0	1	1	0	0	0	1	1	0	0
YF-30	1	1	1	0	0	0	1	1	1	1	0	1	1	0	1	1
YF-31	1	0	1	0	0	1	1	1	0	1	0	1	1	1	1	1
YF-32	1	0	1	0	0	0	1	1	1	1	1	0	0	0	1	0
YF-33	1	1	1	0	0	1	1	1	0	1	1	1	0	0	1	1
YF-34	1	0	1	0	0	1	1	1	1	1	1	0	0	1	1	1
YF-35	1	0	1	0	0	1	0	0	1	1	1	0	0	1	0	1
YF-36	1	1	1	0	0	1	0	0	0	1	1	1	0	0	0	0
YF-37	1	0	1	0	0	1	1	1	0	1	1	0	0	1	1	0
YF-38	0	1	1	0	0	1	1	1	1	1	0	0	0	1	0	0
YF-39	0	0	0	0	0	0	0	0	0	0	0	0	0	1	0	1
YF-40	1	0	0	0	0	0	0	0	0	0	1	0	0	0	1	0
YF-41	0	1	1	1	0	1	1	1	1	1	0	0	1	1	1	0
YF-42	0	0	0	0	0	0	0	0	0	1	0	0	1	0	1	0

* Note—“1” means amplification product is present; “0” means amplification product is not present.

).

The molecular screening of 42 breeding lines showed that 22 breeding lines did not form the expected PCR product using SCARA202. In 31 and 32 breeding lines, PCR detection was negative with SCARA4021 and SCARA5016, respectively. Nineteen breeding lines (YF-2, YF-3, YF-5, YF-11, YF-15, YF-17, YF-21, YF-22, YF-23, YF-25, YF-27, YF-29, YF-31, YF-33, YF-36, YF-37, YF-39, YF-40, and YF-41) were at early maturity according to all three markers.

Based on the genotyping results of breeding lines, the Ro locus was found in 3, 25, 29, 10, and 17 breeding lines by markers SCAR14S6, SCAR14S15, SCAR17S9, SCAR20S2, and SCAR26S35, respectively. The tuber shapes of seven (YF-1, YF-8, YF-9, YF-12, YF-13, YF-24, and YF-26) and four (YF-6, YF-10, YF-23, and YF-34) breeding lines were round, as confirmed by four and three molecular markers, respectively. According to phenotypic data, a round tuber shape was detected in twelve breeding lines (Figure 1A and Figure 2A).

In YF-6, the Ro locus was confirmed by SCAR17S9, SCAR20S2, and SCAR26S35 markers, but phenotypic data showed a long-oval tuber shape. In two breeding lines, YF-15 and YF-41, the tuber shape was round according to phenotypic data, while this was confirmed by only SCAR17S9 and SCAR26S35 molecular markers. The results of the molecular screening by identifying the Ro locus corresponded to 92.3% breeding lines with phenotypic data.

The flesh color of breeding lines varied from white to yellow. In eighteen breeding lines, an expected PCR product was found using more than ten molecular markers (Table 5). However, phenotypic data showed that only two lines (YF-1 and YF-23) had a yellow-fleshed color, while fifteen breeding lines (YF-7, YF-8, YF-9, YF-10, YF-11, YF-12, YF-14, YF-16, YF-19, YF-20, YF-21, YF-22, YF-24, YF-25, and YF-27) had a light flesh color (Figure 1B and Figure 2E). An important gene, Chy2, is responsible for the yellow flesh color confirmed by molecular markers in one (YF-1) yellow-fleshed breeding line and in two (YF-7 and YF-12) light-yellow-fleshed genotypes.

Starch-related genes such as AGPaseS, StPho1b, StPho2, and StUCP were confirmed in six (YF-18, YF-20, YF-24, YF-28, YF-35, and YF-38) and ten (YF-10, YF-12, YF-13, YF-14, YF-21, YF-22, YF-23, YF-30, YF-32, and YF-34) breeding lines by three and four molecular markers, respectively. However, SSSIII was identified as only one breeding line.

The frequency distribution of phenotypic data showed that most tuber traits were not normally distributed (Figure 2).

Analyzing the relationships among the breeding lines, Pearson correlations (r) for the tuber traits were positive between the average weight per tuber and the average tuber length (r = 0.68); the average weight per tuber and the average tuber width (r = 0.84); the average tuber length and the average tuber width (r = 0.66); and the average tuber length and the L/W ratio (r = 0.66) at p < 0.05 (Figure 3, Table S1). Our results demonstrated that there was a clear correlation in the average weight per tuber with the average tuber length and width and the average tuber length between the L/W ratio. Also, a slightly negative correlation was observed between the average tuber number per plant and all components. Minitubers production for planting material is different compared to regular tuber production. There are different priorities for the production of planting material, as a large number of minitubers are of particular interest. Potato genotypes respond differently to transplantation from in vitro to soil. Consequently, the correlation relationship may be different compared to field conditions. The tuber shape was correlated with tuber weight; tubers with long shapes were more productive compared to round shapes.

Using the JMP fit model, we predicted BLUE for each breeding line. Five different shapes were found in all traits; the most prevalent shapes were oval and round categories, according to Figure 2A. There were differences among the BLUE of breeding lines according to tuber shape, which ranged from 0.828 to 5. After scaling, tuber shapes had a mean of 2.5, which varied between 1 and 5 (

Table 6. Summary statistics based on best linear unbiased estimators (BLUEs) for the tuber morphological traits of 42 potato breeding lines.

Breeding Lines	Tuber Shape	Total Tuber Number per Plant	Average Tuber Weight per Plant	L/W Ratio	Flesh Color
BLUE	2.50	41.71	1.45	1.37	1.93
Range	0.83–5.00	0.90–118.92	0.09–3.05	1.04–2.08	0.89–4.08
SD	1.07	33.79	0.61	0.23	1.12
CV	42.86	81.02	41.77	16.77	57.83

). The average tuber number per plant produced by one potato plant depended on breeding lines. The average tuber numbers in our study were 41.71 per plant, ranging from 1 to 119, which demonstrated a standard deviation of 33.79 (Figure 2B). BLUE results according to average tuber number ranged from 0.90 to 118.90 (Table S2). Also, the average weight per tuber was 1.45 g, with a 3.05 g maximum weight per tuber (Figure 2C). The YF-4 breeding line showed the maximum results by average weight per tuber; otherwise, there were only two tubers per plant with a long-shaped form. The L/W ratio of these breeding lines ranged from 1.04 to 2.08. The range of L/W ratio distribution (Figure 2D) showed mean results of 1.37. Flesh color results ranged from 0.89 to 4.08 after scaling. These blue results clearly showed the extensive variation for each breeding line according to all traits. White-flesh-colored potatoes showed the highest results among all breeding lines (Figure 2E). Only two breeding lines demonstrated a yellow color with a round-shaped form, and there were fifteen genotypes with a light-yellow color.

Twenty-one breeding lines were determined to be prospective potato breeding lines based on phenotypic data and the outcomes of molecular investigation. These potato breeding lines (YF-1, YF-8, YF-9, YF-10, YF-12, YF-13, YF-15, YF-23, YF-24, YF-26, YF-34, and YF-41) are mostly suited for chip production because of their round tuber shape. French fries can benefit from the long oval tuber shape of three breeding lines: YF-6, YF-7, and YF-14. For consumption, six breeding lines (YF-5, YF-21, YF-22, YF-30, YF-31, and YF-33) with short-oval and oval tuber forms were identified. It is advised to carry out breeding studies and to research the biochemical characteristics of all these identified advanced potato breeding lines.

4. Discussion

Potato maturity, tuber shape, and flesh color are important agronomic traits of potatoes, and they have different acceptable ranges depending on the intended processing market. The length-to-width ratio is a widely used measurement to assess the quality and suitability of new varieties destined for the processing industry. Due to the complex breeding process, about 10 years are needed to develop new potato varieties. The use of MAS is one of the most effective applications in plant breeding. Our objective in the current work was to use molecular markers to investigate the presence of genes responsible for the most significant features for genotypes of table potatoes, French fries, and chips in order to create Kazakh potato varieties.

The genetic variability observed among the evaluated breeding lines in the present study indicated the presence of advanced breeding lines that can be used for the potato improvement program in Kazakhstan. The presence of highly significant differences among potato hybrid lines suggests that there are sufficient genetic differences that may be related to the parental varieties used in the creation of these hybrid lines. Genetic differences among potato hybrid lines regarding maturity, tuber shape, flesh color, and starch-related genes have also been reported [63,64,65]. Pandey et al. also reported similar significant differences among hybrid lines for their phenological and growth traits, tuber yield, and physical, internal, and quality traits for chip production from an evaluation of 16 potato genotypes, including two farmer varieties, in eastern Ethiopia [43].

We selected nineteen breeding lines with early maturity according to molecular markers since these markers have been confirmed in our research on reference varieties with early maturity. In a previous study, the maturity phenotypic association rate of the three-marker combination for the early and late maturity genotype verification reached 87.5% and 93.0%, respectively [8]. We consider that these molecular markers can be used for breeding work, to improve the efficiency of the breeding process.

In the current study, among the 42 breeding lines examined, five different shapes (from round to long) were found, and the most prevalent shapes were oval and round shapes. Considering that the parent forms have round (Yagodnyi 19), and oblong tuber shapes (CIP 397079-6), the last one is genetically unstable. In this case, the genetic variability of traits is expected to be higher in the next generation, compared to crossings of genetically stable varieties. Therefore, in our study, the genetic and phenotypic expression of tuber shape (from round to long) was highly varied, in order to increase the efficiency of the selection process. On the other hand, a single dominant locus, Ro, was postulated by Masson [66], in which the round shape was dominant over the elongated shape, while the range of observed tuber shapes from round to oval or elongated indicated polygenic inheritance. In addition, De Jong and Burns [67] could phenotypically identify all three possible genotypes (RoRo, Roro, and roro) that were segregated in their genetic material; however, previous studies indicate that tuber shape is regulated by Ro. This shows incomplete dominance at the Ro-locus. Nevertheless, tuber shape phenotypes are not confined to these three classes but display a continuous distribution. At the Ro-locus, a series of multiple alleles can explain all intermediate shapes between round (going to flat) and long [68]. At the tetraploid level, multiple alleles can create large numbers of allele combinations and intralocus allele interactions, which may explain the continuous range of tuber shape phenotypes [69]. We also suggested using SCAR14S6, SCAR17S9, and SCAR26S35, which were developed by Chen et al. [18] and confirmed with reference genotypes in our study, to identify the Ro-locus in the early stages of the breeding process.

In our study, the flesh color of breeding lines was white, light-yellow, or yellow. Potato genotypes with yellow flesh were characterized by high levels of epoxy-xanthophylls and xanthophyll esters and by the presence of at least one copy of a dominant allele of the β-carotene hydroxylase 2 (CHY2) gene; white-fleshed genotypes were characterized by low carotenoid levels and by the presence of recessive chy2 alleles [6,70]. A crucial gene, Chy2 was identified in one yellow- and in two light-yellow-fleshed genotypes using molecular markers. However, some markers were not informative for the identification of the tuber flesh color. According to the results of this study, the identification of the tuber flesh color by markers at the early stage of the breeding process needs further investigation.

The selection of genotypes with starch-related genes suggested the identification of higher starch phosphate levels and indirect selection via molecular markers in an effort to improve the existing potato varieties using the traits related to starch recommended in the previous study [65]. According to our study, starch-related genes were confirmed in six and ten breeding lines by three and four molecular markers, respectively. Additionally, Li et al. [71] suggested using the CAPS markers chr2-CAPS6 and chr2-CAPS21 to determine extremely high- or low-starch individuals from the F2 population and tetraploid potato varieties. Our future studies will aim to continue the breeding process of selected breeding lines with new molecular markers related to starch, and will test for correlation to starch yield of potato tuber in field conditions.

It should be noted that we were able to find a difference in the formation of tubers in plants transplanted from in vitro conditions into the soil compared to the formation of tubers in field conditions. In plants that were transplanted from in vitro conditions into the soil, a significant difference in the formation of minitubers was observed; some plants produced more than 100 minitubers, and some plants produced only 1 minituber. Consequently, the correlation analysis showed a low value of the correlation relationship between average tuber numbers per plant and the average weight per tuber.

5. Conclusions

Based on the results of molecular analysis and phenotypic data, 21 breeding lines were identified as prospective potato breeding lines. The majority of these potato breeding lines (YF-1, YF-8, YF-9, YF-10, YF-12, YF-13, YF-15, YF-23, YF-24, YF-26, YF-34, and YF-41) have a round tuber shape and are recommended for chip purposes. Three breeding lines, YF-6, YF-7, and YF-14, have a long oval tuber shape and are suitable for French fries. Six breeding lines (YF-5, YF-21, YF-22, YF-30, YF-31, and YF-33), with short-oval and oval tuber shapes, were designated for consumer potato purposes. We consider that SCAR molecular markers for maturity (SCARA2-2, SCARA4-21, and SCARA5-16) and for tuber shape (SCAR14S6, SCAR17S9, and SCAR26S35) can be used to identify prospective potato lines in the early stages of the breeding process. In the future, it is proposed that new molecular markers be used to determine extremely high- or low-starch individuals from the identified breeding lines. It will also be useful to backcross selected prospective potato breeding lines to consolidate the desired traits to meet the requirements of potato growers for consumer potatoes, as well as those of the chip industry for cultivation in the northern regions of Kazakhstan and for French fries for the southern and south-eastern regions. In addition, biochemical properties of the identified potato breeding lines will be studied.