Next Article in Journal
Technical and Economic Assessment of Tomato Cultivation Through a Macro-Tunnel Production System with the Application of Gluconacetobacter diazotrophicus
Previous Article in Journal
Physical Ripening Indices Improve the Assessment of Mechanical Harvesting Time for Olive Cultivars Resistant to Xylella fastidiosa subsp. pauca
Previous Article in Special Issue
MTS-YOLO: A Multi-Task Lightweight and Efficient Model for Tomato Fruit Bunch Maturity and Stem Detection
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 10
10.3390/horticulturae10101109
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Application of Ethephon Manually or via Drone Enforces Bud Dormancy and Enhances Flowering Response to Chilling in Litchi (Litchi chinensis Sonn.)

by
Bingyi Wen
1,2,†,
Cailian Deng
3,†,
Qi Tian
1,
Jianzhong Ouyang
2,
Renfang Zeng
1,
Huicong Wang
1 and
Xuming Huang
1,*
1
College of Horticulture, South China Agricultural University, Guangzhou 510642, China
2
Guangzhou Conghua Hualong Fruit and Vegetable Company, Guangzhou 510920, China
3
Agricultural Technology Promotion Center of Conghua District, Guangzhou 510999, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2024, 10(10), 1109; https://doi.org/10.3390/horticulturae10101109
Submission received: 29 August 2024 / Revised: 29 September 2024 / Accepted: 11 October 2024 / Published: 18 October 2024
(This article belongs to the Special Issue Advances in Intelligent Orchard)
Browse Figures
Review Reports Versions Notes

Abstract

:
Ethephon (2-chloroethylphosphonic acid) is frequently used for flush management in order to maximize flowering in litchi. However, the optimal dosage of ethephon, which balances between flush control effect and the detrimental effect on leaves, is unknown. This study aimed to identify the optimal ethephon dosage and test more efficient ethephon application methods, using a drone for flush control and flowering promotion in litchi. The effects of a single manual full-tree spray of 250, 500 or 1000 mg/L of ethephon in early November on the bud break rate, leaf drop rate, net photosynthetic rate, LcFT1 expression and floral induction (panicle emergence rate and panicle number) in ‘Jingganghongnuo’ litchi were examined in the season of 2021–2022. In the season of 2022–2023, the effects of drone application of 1000 mg/L of ethephon in early November on bud growth and floral induction were observed. The results showed that the manual ethephon treatments were effective at enforcing bud dormancy and elongating the dormancy period and that the effects were positively dependent on dosage. One manual spray of 1000 mg/L of ethephon in late autumn enabled a dormancy period of 6 weeks. The treatments advanced seasonal abscission of old leaves in winter and caused short-term suppression on photosynthesis within 2 weeks after treatment. Ethephon treatments, especially at 1000 mg/L, enhanced the expression of LcFT1 in the mature leaves and promoted floral induction reflected by earlier panicle emergence and increased panicle emergence rate and number in the terminal shoot. The floral promotion effect was also positively dosage dependent. The cumulative chilling hours below 15 °C from the date of treatment to the occurrence of a 20% panicle emergence rate were lowered in ethephon treatments. A drone spray of 1000 mg/L of ethephon solution consumed a sixth of the manual spray solution volume and was two thirds less effective in suppressing bud break compared with manual spraying. However, it achieved a significant flowering promotion effect comparable to traditional manual spraying. The results suggest that ethephon application enhanced flowering responsiveness to chilling as well as enforced bud dormancy. The application of ethephon with a drone proved to be an efficient method for flush control and flower promotion.

1. Introduction

Litchi (Litchi chinensis Sonn.) is one of the most economically important fruit crops in China and is widely cultivated in warm subtropical regions across the world. Flowering in litchi is one of the critical events that determines the productivity of the crop and is regulated by the interplay between chilling temperatures, leaf maturity, status of the terminal buds and carbohydrate reserves. Chilling temperature is the key environmental stimulus that induces the terminal buds to exit the vegetative flush growth cycle and enter reproductive growth [1,2,3].
The leaf serves as a sensor for chilling temperature [4], which induces the expression of the florigen gene LcFT1 (FLOWERING LOCUS T) in the leaves [4,5]. However, only mature leaves respond to chilling with the activation of LcFT1, while young expanding leaves are unable to respond to chilling [6]. The LcFT1 protein [5] or LcFT1-mRNA [7] formed in mature leaves is transported to the meristem of the terminal buds, where FT binds with other proteins to activate genes involved in the flowering program, turning the vegetative meristem into a floral meristem.
Beside leaf maturity, the bud status may also exert crucial effects on the flowering response to chilling [3,8]. Buds alternate between dormancy and growth, resulting in the recurrent pattern of vegetative flush growth [9]. New flush growth occurs after bud break with the outgrowth of a number of new leaves at the same time. With the expansion of the new leaves, the terminal buds re-enter and maintain a dormant state until the new leaves become fully mature [8]. Dormant buds fail to respond to chilling temperatures, while fast elongating buds have a low flowering probability; therefore, breaking buds of litchi are most sensitive to chilling temperatures [10].
The build-up of carbohydrate reserves also plays an important role in flower differentiation in litchi [3,11,12,13,14]. Huang and Chen (2014) suggested that sufficient carbohydrate reserves may enhance the flowering response of litchi to chilling [3]. A period of growth check in evergreen litchi is favorable for carbohydrate accumulation [3,13]. Ethephon administered at 1000 mg/L extended bud dormancy, increased carbohydrate reserves and promoted flowering [15].
Therefore, the flush cycle in litchi needs to be carefully managed to allow (1) a period of growth check for buildup of carbohydrate reserve; (2) maturation of the terminal flush before winter; (3) waking up of the terminal buds from dormancy in the coldest month [3].
Management of the flush cycle is carried out through various practices. Pruning, irrigation and supplying nitrogen-rich fertilizers promote bud growth, while water holding, girdling and applying growth suppressors enforce bud dormancy of litchi [3]. Among the growth regulators, ethephon (2-chloroethylphosphonic acid) is one of the most effective chemical tools for flush cycle management and flowering improvement. In bromeliads, such as pineapple, ethephon is commercially used to directly induce flowering [16]. Ethephon serves as an efficient tool for eradicating alternative bearing by increasing return flower during the “off-year” in apple [17,18]. However, the mechanism behind the flower-inducing effect of ethylene is not well illustrated. It suppresses vegetative growth and reduces plant height but promotes flowering in some herbaceous perennials [19]. Similarly, ethephon suppresses shoot growth and increases flowering in sweet cherry [20]. In litchi, ethephon is commonly used for preventing the outgrowth of buds or killing any new flush growth at a dosage ranging from 50 to 500 mg/L, to ensure that there will be no vegetative flush growth in winter, which improves flowering [21]. However, in practice, ethephon at this dosage range needs to be applied repeatedly for long-term suppression of vegetative flush, especially in warmer litchi-producing regions. Researchers in South Africa found that a single full-coverage spray of ethephon at a high concentration (1000 mg/L) inhibited new flush growth in autumn and winter, delayed bud break and panicle emergence, and promoted the formation of pure floral flushes in ‘Mauritius’ [15,22]. This single high-dosage application was more effective in flush control than the frequent spot spray applications at lower concentrations. Timely spraying of ethephon for flush control is important. Manual spraying is time-consuming and labor-intensive in large litchi orchards built mostly on terraced slopes in China, where machine spraying is difficult. Under the current situation where agricultural labor is rare and expansive in China, evaluating the replacement of manual spraying with drone spraying for flush control is of great significance.
Cronje et al. (2022) found that ethephon application at 1000 mg/L increased carbohydrates in leaves and terminal shoots and promoted the expression of LcFT2 during budbreak in winter [15]. However, there was no information regarding the effect of ethephon on LcFT1, which is activated in response to chilling.
Ethylene is a senescence-inducing hormone, and ethylene releaser may lead to leaf senescence and drop if used at high dosages. In mustard (Brassica juncea), ethephon treatments at concentrations within 1.5 mM (216 mg/L) promoted photosynthesis [23]. In Mondo grass (Ophiopogon japonicus), ethephon from 200 to 1500 mg/L reduced the leaf photosynthetic rate [24]. In ‘Hamlin’ sweet orange (Citrus sinensis), ethephon treatments at 400 and 800 mg/L induced significant leaf drop and a short-term (within 2 days) decrease in the photosynthetic rate [25]. There has been no report regarding the effect of ethephon used in flush control on leaf abscission and photosynthetic function in litchi. It is our hypothesis that higher concentrations of ethephon have a longer-lasting effect on flush control but may cause heavier leaf damage. In this study, ethephon was manually applied at different concentrations to trees of litchi cv. Jingganghongnuo, a high-quality late cultivar, and the effects on budbreak, floral induction, florigen gene (LcFT1) expression, leaf drop and the net photosynthetic rate were examined in order find the optimal concentration of ethephon for flush control. A trial to spray ethephon at a high concentration (1000 mg/L) with a drone was carried out in the next season to examine its effects on bud growth and flowering in order to find a more efficient way to apply ethephon for flush control.

2. Materials and Methods

2.1. Site and Plant Materials for the Study

The experiment was carried out during the autumn and winter in 2021–2022 and 2022–2023 in the demonstration orchard of Conghua Litchi Exposition Park, Guangzhou, China (N: 23.586014°; E: 113.613877°). The orchard was equipped with an HR-GS-3A meteorological station supplied by Hoire (Guangzhou, China). Air temperatures were collected at intervals of 10 min throughout the experiment (Figure 1). Cumulative hours of chilling temperatures below 15 °C from the date of ethephon treatment to the occurrence of certain flowering-related events could be calculated. Cronje et al. (2022) calculated cumulative chilling hours of below 20 °C for ‘Mauritius’ [15], which is a relatively low-chilling-requiring cultivar. ‘Jingganghongnuo’ is a late cultivar with a higher chilling requirement for flowering. Studies by Chen (2002) showed that flowering of ‘Nuomici’, another late litchi cultivar, is secured under temperatures below 15 °C [26]. Therefore, we took 15 °C as the up-line temperature for calculating cumulative chilling hours for flowering of ‘Jingganghongnuo’.
Temperature readings were collected from 00:00 1 November 2021 at intervals of 10 min. The dashed line is 15 °C, below which litchi cv. Jingganghongnuo has a flowering response.
The plant materials used for the study were trees of litchi cv. Jingganghongnuo top-grafted on ‘Huaizhi’ in the spring of 2018. The tree canopies were approximately 3.6 m in height and 5 m in width.

2.2. Treatments

In the season of 2021–2022, 20 trees of similar size and at similar phenological stages were selected and evenly divided into four groups subjected to foliar spays with four ethephon concentrations (0, 250, 500, and 1000 mg/L). The treatments were carried out on 1 November 2021, when the latest flush had fully matured and about 60% of the terminal buds resumed growth from dormant status. A single full coverage spray with ethephon solutions added with 0.01% tween 20 was carried out with a back-packed battery-powered sprayer until drip-off. The effects of the treatments on bud growth, leaf drop, net photosynthetic rate, expression of LcFT1, and flowering were examined at regular intervals. Five tree-based biological replicates were set for the experiment.
In the season of 2022–2023, 35 trees in the same orchard were sprayed with 1000 mg/L of ethephon using a DJi-T40 drone (DJi, Shenzhen, China) flying at 3 m/s 3 m above the tree crown in the evening of 9 November 2022. A total volume of 24 L of ethephon solution was sprayed within 2 min. Five trees receiving no spray in the same orchard were used as the control. Five trees of similar size and phenological stages were selected from the neighboring plot under traditional flush control management (traditional treatment), which involved spraying 300 mg/L of ethephon to suppress outgrowth of late flushes in early November 2022 and killing any new outgrowth of flush before late December with a spotty spray of 50 mg/L oxyfluorfen. Bud growth and panicle emergence were observed in all the treated trees.

2.3. Bud Status Observation

Starting from the day of treatment, the status of terminal buds was observed weekly. Thirty randomly selected shoot terminals from different directions of the canopy were observed in each tree, and the status (dormancy, bud break or panicle emergence with appearance of “whitish millet”) of the terminal bud was recorded. As shown by Zhang et al. (2016) [8], a breaking bud is characterized by greening, swelling and opening of the closely embraced rudimentary leaves. The bud break (including shoot outgrowth) rate and panicle emergence rate of the shoot terminals could be calculated. The beginning of panicle emergence in a tree was arbitrarily set as the date on which 20% of shoot terminals showed panicle emergence. Changes in the panicle emergence rate with time were plotted for different treatments, and from the curves, dates of the beginning of panicle emergence in trees under different treatments could be found. Then, cumulative chilling hours below 15 °C from the date of treatment could be calculated based on the air temperature data shown in Figure 1.

2.4. Leaf Drop Observation

Ten shoots were selected from different directions of the canopy in each tree and tagged. The number of compound leaves in each tagged shoot was recorded prior to and after ethephon treatment at weekly intervals, and the number of dropped leaves from the shoots and, thus, leaf drop rate could be calculated.

2.5. Net Photosynthetic Rate Measurement

Five mature leaves from the latest flush of each tree were tagged and the net photosynthetic rate was measured from 8:30 to 11:30 in the morning with a CIRAS-2 PP system (Amesbury, MA, USA) under ambient conditions, with an artificial light intensity of 1000 μmol m−2 s−1. The measurements were carried out at 5, 12, 19 and 29 days after ethephon treatment (DAT).

2.6. LcFT1 Expression Analysis

Samples of mature leaves in the latest flush were collected biweekly four times from 15 December 2021 to 30 January 2022. RNA from the leaf samples was extracted with a quick RNA isolation kit according to the instructions provided by Huayueyang Biotechnology (Beijing, China). The RNA extracted was reverse-transcribed into cDNA using a Hifair® AdvanceFast 1st Strand cDNA Synthesis Kit (Yeasen Biotechnology, Shanghai, China). Primer sequences for qPCR analysis of LcFT1 were designed according to Ding et al. (2015) [5]. A ONE TUBE PCR reaction kit (AccurSTART U+ One Step RT-Qpcr Super Premix) (Vazyme, Nanjing, China) was used for qPCR analysis with LcActin as the reference. Sequences of the primers of the target gene and reference gene are shown in Table 1. The PRC reactions and measurements were carried out using a CFX384-RealTime system (Bio-Rad Laboratories, Shanghai, China).

2.7. Statistics

The above analyses were carried out with five biological replicates unless otherwise stated. One-way ANOVA and Tukey’s multiple range test were performed with SPSS (version 19.0; IBM Corp., Armonk, NY, USA).

3. Results and Analysis

3.1. Effects of Manually Spraying Ethephon at Different Concentrations

3.1.1. Effect on Bud Growth

Bud break rate ranged from 58% to 70% on the day of ethephon treatments. After treatments with different concentrations of ethephon, the bud break rate significantly reduced, indicating that ethephon was effective at forcing a breaking/growing bud back to dormant status as well as maintaining bud dormancy. The greening growing terminal buds shed the swelling and opening rudimentary leaves and became darker after ethephon treatment, especially at concentrations above 500 mg/L (Figure 2). The effect was clearly dosage-dependent in terms of both the bud break rate and time duration of bud dormancy maintenance (Figure 3). A measure of 250 mg/L of ethephon reduced the bud break rate to around 33% and maintained this low level for 3 weeks; 500 mg/L of ethephon reduced the bud break rate to around 13% and maintained this for 5 weeks. A measure of 1000 mg/L of ethephon completely inhibited bud break, and this effect lasted for 6 weeks.

3.1.2. Effect on Leaf Drop and Net Photosynthetic Rate

The cumulative leaf drop rate increased with time in the control and ethephon treatments. In the control group, leaf drop increased to 17.3% by 8 weeks after treatment (WAT), while ethephon treatments significantly increased the leaf drop rate to around 20% within 5 weeks (Figure 4). There was no significant difference among ethephon concentrations. In all treatments, the abscised leaves were the old, shaded leaves that were at lower positions of shoots, while no drop of the exposed leaves in the terminal flushes was observed.
Ethephon treatments caused a short-term reduction in the net photosynthetic rate (Pn) (Figure 5). The effect was significant at 5 and 12 days after treatment (DAT) and showed a clear dosage dependence. At 19 and 29 DAT, there was no significant difference in Pn among the control group and treatment groups. Therefore, ethephon may have a detrimental effect on photosynthesis, but the effect is reversible, and photosynthesis can be recovered within 2 weeks.

3.1.3. Effect on Floral Characters

“Whitish millet” or panicle emergence occurred with bud break in winter and was observable from 29 December 2021. The panicle emergence rate increased with time in all treatments (Figure 6). Ethephon treatments all significantly increased the panicle emergence rate, showing a positive dosage effect. By 11 January 2022, the panicle emergence rate increased to 44.0% in the control group, while it increased to 75.2%, 68.8% and 82.8% with 250, 500 and 1000 mg/L of ethephon treatments, respectively. Ethephon treatments not only increased the panicle emergence rate but also advanced the occurrence of panicle emergence, and a higher dosage of ethephon treatment resulted in earlier panicle emergence. Taking 20% of terminal shoots showing “whitish millet” as the beginning of panicle emergence for a tree, and based on the change trend in the panicle emergence rate shown in Figure 5, the beginning of panicle emergence occurred on day -8 (24 December 2021), day -1 (31 December 2021), day 2 (3 January 2022) and day 5 (6 January 2022) for ethephon treatments at 1000 mg/L, 500 mg/L, 250 mg/L and 0 mg/L (control), respectively, corresponding to cumulative chilling hours of 298.7, 416.7, 443.8 and 468.5 h, respectively (Table 2). These results clearly show that ethephon reduced the chilling requirement for flowering induction in litchi, and the higher concentration, the more effective the treatment.
Ethephon significantly increased the node numbers with panicles in a terminal shoot (Table 3, Figure 7), suggesting that ethephon treatment had a long-term effect on the promotion of dormancy release of the axillary buds. The treatments also increased the percentage of pure floral panicles and reduced the incidence of leafy flush. These effects became stronger as the concentration of ethephon applied increased (Table 3). These results show that ethephon treatments promote flowering in litchi.

3.1.4. Effect on Expression of the Florigen Gene LcFT1

The expression level of LcFT1 in the mature leaves tended to increase with time in all treatments (Figure 8). However, the increase in LcFT1 expression was first observed in ethephon treatment at 1000 mg/L, which had a significantly higher expression level than the control by 15 December 2021, when the cumulative number of chilling hours below 15 °C was 213.5 h. The expression levels of LcFT1 in the control group and all the other ethephon treatments did not increase until 30 December 2021, when cumulative number of chilling hours below 15 °C was 415.3 h. On 29 January, LcFT1 expression was higher in treatments with higher ethephon concentrations. These results suggest that ethephon enhanced the activation of LcFT1 and that ethephon at 1000 mg/L reduced the chilling hours required to activate LcFT1.

3.2. Trial of Spraying 1000 mg/L of Ethephon with a Drone

3.2.1. Effect on Bud Break and Leaf Drop

Spraying 1000 mg/L of ethephon with a drone failed to completely inhibited bud break as a manual spray of 1000 mg/L of ethephon did in the previous season. There was a bud break rate of around 35% from 3 to 6 WAT (Figure 9A). Although the leaf drop rate increased with time, the leaf drop rate maintained below 10% within 4 WAT (Figure 9B). Compared with manual application of 1000 mg/L of ethephon (Figure 3 and Figure 4), drone spray was less effective in enforcing bud dormancy and inducing leaf drop.

3.2.2. Effect on Flowering

The panicle emergence rate, pure panicle rate and number of nodes with panicles in the treatment involving spraying 1000 mg/L of ethephon with a drone were all significantly higher than those in the control group but similar to those in the traditional treatment (Table 4).

4. Discussion

4.1. Ethephon Enforces Bud Dormancy in Litchi

Bud dormancy is an important strategy for plants to survive adverse conditions, and its entry and release is subject to subtle regulations by the interplay between environmental factors and endogenous hormones [27]. Ethylene plays a vital role in the regulation of multiple biological events, such as seed germination, flowering, senescence and abscission. Studies have shown that ethylene has a regulatory role in both dormancy onset and release [27]. Exogenous ethylene at concentrations between 0.1 and 200 μL L−1 was reported to be effective in promoting germination of dormant seeds [28]. In grapevine, dormancy-breaking chemicals, hydrogen cyanamide (HC) and azide, induced transient ethylene biosynthesis, and ethephon application induced dormancy release, while inhibitors of ethylene biosynthesis (CoCl2) and signaling inhibitors (silver thiosulfate and norbornadiene) weakened the dormancy-breaking effect of HC and azide and inhibited bud break [29,30]. These findings suggest that ethylene plays a vital role in dormancy release. However, there have been more reports showing that ethylene is involved in bud dormancy onset and maintenance. Ethylene mediates dormancy-inducing stimuli (short-day photoperiod and cold temperature) and ABA [31,32]. In potato microtuber, ethylene signaling inhibitor 2,5-norbornadiene (NBD) treatment advanced dormancy break [33]. Ethylene-insensitive mutation (etr1-1) of birch caused delayed bud dormancy onset as well as abolishing the formation of terminal buds under a short-day photoperiod [34]. Similarly, chrysanthemum mutants with an impaired ethylene receptor gene (DG-ERS1) failed to enter dormancy under chilling temperature [35]. Application of the ethylene precursor ACC (10 mM) was able to induce dormancy and enhance cold tolerance in Prunus mume [36]. An earlier study by Durner and Gianfagna (1991) showed that ethephon treatment at 100 mg/L reduced the effectiveness of the chilling temperature at breaking dormancy [37]. In litchi, ethephon has been commercially used in flush cycle management to prevent outgrowth of a winter flush [15,21,22]. The present study showed that exogenous ethylene treatment forced growing bud to reenter dormancy as well as extending the dormancy period. These effects became stronger at higher concentrations. Therefore, a higher dosage of ethephon can be applied for enforcing a longer dormancy period for litchi. The results agree with the report by Liu et al. (2022), who found that ethephon inhibited dormancy release and budburst in peach [38]. They also found that ethephon enforced dormancy by impeding pathways related to antioxidants and cell wall formation instead of up-regulating dormancy-associated MADS (DAM) or SHORT VEGETATIVE PHASE (SVP) genes [38]. However, Ma et al. (2024) reported ethephon enforced bud dormancy in litchi via short-term up-regulation of LcSVP2 and SMALL ORGAN SIZE1 (LcSMOS1) [39], both of which are involved in the regulation of dormancy onset [8,39].

4.2. Ethephon Causes Leaf Drop and a Short-Term Reduction in Photosynthesis

As expected, ethephon treatments induced increased leaf drop in litchi (Figure 4). The results agree with those obtained for sweet orange [25] and olive [40]. The abscised leaves were mostly shaded old leaves, while no mature leaves of the latest flush dropped, suggesting that the old, shaded leaves are more sensitive to ethephon than the new mature leaves. However, during the experiment, the control trees had some leaf drop, indicating seasonal old leaf drop of litchi occurring in late autumn and winter. At 8 WAT, there was no difference in the cumulative leaf drop rate among the control and ethephon treatments at different concentrations, indicating that ethephon treatments within 1000 mg/L may fasten the process of natural leaf abscission but are not strong enough to induce a significant drop in naturally non-abscising leaves in litchi cv. Jingganghongnuo, which is different from ‘Feizixiao’ [41] and ‘Guiwei’ [42], where the leaf drop rate was significantly increased with the increase in ethephon concentration applied. Therefore, differences in sensitivity to ethephon among litchi cultivars need to be further explored.
Different from the report on mustard by Khan (2004), who found that ethephon within 216 mg/L promoted photosynthesis [23], the present study showed that ethephon reduced the photosynthetic rate, which aligns with reports on cocklebur weed [43], Mondo grass [27], and sweet orange [25]. The suppression effect of ethephon on photosynthesis seemed to be dosage-dependent and temporary. The effect lasted for 2 weeks despite the dosage in ‘Jingganghongnuo’ litchi (Figure 5). In ‘Hamlin’ sweet orange, ethephon at 400 and 800 mg/L induced a photosynthetic rate reduction within two days. Therefore, the ethephon-induced reduction in photosynthesis is reversible. According to Woodrow et al. (1989), ethylene treatment did not directly inhibit photosynthesis but reduced the net carbon fixing rate via reducing light interception (epinasty effect) in cocklebur weed [43]. However, in litchi, no epinasty effect was observed. Cronje et al. (2022) found that ethylene production from leaves peaked immediately after ethephon treatment followed by a sharp decrease in litchi, which may explain the short-term effect of ethephon on photosynthesis [15]. The mechanisms behind ethylene inhibiting photosynthesis and the following recovery of photosynthesis remain unknown and require in-depth study.

4.3. Ethephon Enhances the Flowering Response to Chilling in Litchi

Litchi flower is induced by chilling temperatures [1,2,3,26], and mature leaves act as sensors of chilling [4], where the florigen LcFT1 is induced by chilling and transported to the buds [4,5]. Young expanding leaves are insensitive to chilling [6], and the dormant buds during leaf expansion failed to turn on flowering under chilling [8,10]. The build-up of carbohydrate reserves also plays an important role in flower differentiation in litchi [11,12,13,14].
Ethephon suppresses vegetative growth and promotes flowering in some herbaceous perennials [19]. In bromeliads, it is effective at directly inducing flowering [16]. Our result showing that ethephon suppressed vegetative flush growth and promoted flowering in litchi agrees well with previous reports [15,17,44]. However, how ethephon promotes flowering in litchi is largely unclear. Cronje et al. (2022) suggested that ethephon treatment increased carbohydrate accumulation due to an extended rest period and more cumulative chilling hours [15], which promotes carbohydrate accumulation and, thus, flowering response to chilling [3]. Cronje et al. (2022) also found that ethephon upregulated LcFT2 in the leaves at bud break [3]. LcFT2 is another florigen gene that advanced flowering in transgenic arabidopsis [5]. However, LcFT2 expression has been found not to be induced by chilling and may play a minor role in flowering of litchi [5]. Our present study showed that LcFT1 expression increased with time in winter or with the accumulation of chilling hours and that ethephon treatments, especially at 1000 mg/L, advanced and intensified its expression, which aligns with the increased panicle emergence rate, pure panicle rate and panicle number in ethephon treatments [15] (Figure 6, Table 3 and Table 4). Unlike the report by Cronje et al. (2022), which found an increase in cumulative chilling hours from ethephon treatment to panicle emergence [15], the present study displayed a reduction in cumulative chilling hours from ethephon treatment to 20% panicle emergence, as well as from ethephon treatment to LcFT1 activation. The results clearly show that ethephon treatment reduces the chilling requirement for floral induction in litchi. In another word, ethephon enhances the chilling response for flowering.
Unlike leaves, which quickly lose ethylene after ethephon application, buds maintain higher post-ethephon treatment ethylene release for a longer period [15]. This may explain why effects on photosynthesis diminished within two weeks while the bud suppression effect lasted for over six weeks. The effect of ethephon on flowering in litchi might vary depending on the time and concentration applied. High concentrations (500 and 1000 mg/L) applied prior to flowering may inhibit flowering [22,44], possibly due to extended dormancy enforced by ethephon causing failure of the dormant buds to receive a flowering signal (LcFT1) sent from the mature leaves exposed to chilling. Bearing in mind the long residue of ethylene in litchi [15], the application of ethephon for flush management should be carefully planned, reducing the dosage closer to panicle emergence to allow timely evocation of the buds.

4.4. Spraying Ethephon with a Drone for Flush Management Is Highly Feasible

Drone technology integrated with multiple sensors, precise positioning and artificial intelligence has increasingly been applied in farming for crop monitoring and pesticide spraying, as part of precision agriculture [45]. Flush control with ethephon has limited the time window, as sensitivity to ethephon reduces as the flush matures [41]. Therefore, applying ethephon for controlling flush growth should be carried out as quickly as possible. In addition, compared with drone spraying, manual spraying is much more labor-intensive and time-consuming in large litchi orchards built mostly on terraced slopes in China, where machine spraying is difficult. Under the current situation in which agricultural labor is rare and expansive in China, it is of great significance to evaluate the replacement of manual spraying with drone spraying for flush control. In our trial, drone spraying was highly efficient, requiring less labor and saving time as well as chemicals. Drone spraying 1000 mg/L of ethephon failed to completely inhibit bud break as manual full coverage spray did, which can be explained by the fact that the trees received much less (about one sixth) liquid from drone spraying than from manual spraying. Therefore, a stronger ethephon solution needs to be tested. However, it showed a significant flowering promotion effect compared with the non-sprayed control, and the effect was comparable to traditional manual spraying at 300 mg/L (Table 4). Therefore, it is highly feasible to apply drone spray of ethephon for flush control and flower promotion, which can greatly improve the efficiency of flush management.

5. Conclusions

Ethephon is effective at enforcing bud dormancy and elongating the dormancy period; the effects are positively dependent on dosage. One spray of 1000 mg/L applied in late autumn triggers a dormancy period of 6 weeks. Ethephon application advances seasonal abscission of old leaves in winter and causes short-term suppression of photosynthesis. Ethephon treatment also enhances the expression of LcFT1 in mature leaves and promotes floral induction, reflected in earlier panicle emergence and increased panicle emergence rate and panicle number in the terminal shoot. Ethephon treatment reduces the chilling requirement for flowering and enhances the flowering response to chilling. Drone spraying 1000 mg/L of ethephon solution consumes much less solution and is less effective at suppressing flush compared to manual spraying. However, it achieves a significant flowering promotion effect comparable to traditional manual spraying.

Author Contributions

B.W.: investigation, formal analysis, writing—original draft preparation; C.D.: investigation, formal analysis; Q.T.: investigation, formal analysis; J.O.: conceptualization, supervision, funding acquisition; R.Z.: conceptualization and methodology; H.W.: conceptualization and methodology; X.H.: supervision, conceptualization, methodology, writing (review and editing) and funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by the China Litchi and Longan Industry Technology Research System (project no. CARS-32-08), and 2023 Special Project for Key Areas of Research and Development of Guangzhou Municipality (2023B01J2002).

Data Availability Statement

The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

Jianzhong Ouyang was employed by the company (Guangzhou Conghua Hualong Fruit and Vegetable Company). The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Menzel, C.M.; Simpson, D.R. Effect of temperature on growth and flowering of litchi (Litchi chinensis Sonn.) cultivars. J. Hortic. Sci. Biotechnol. 1988, 63, 349–360. [Google Scholar] [CrossRef]
  2. Chen, H.B.; Huang, H.B. Low temperature requirements for floral induction in lychee. Acta Hortic. 2005, 665, 195–202. [Google Scholar] [CrossRef]
  3. Huang, X.B.; Chen, H.B. Studies on shoot, flower and fruit development in litchi and strategies for improved litchi production. Acta Hortic. 2014, 1029, 127–136. [Google Scholar] [CrossRef]
  4. Zhang, H.; Shen, J.; Wei, Y.; Chen, H. Transcriptome profiling of litchi leaves in response to low temperature reveals candidate regulatory genes and key metabolic events during floral induction. BMC Genom. 2017, 18, 363. [Google Scholar] [CrossRef]
  5. Ding, F.; Zhang, S.; Chen, H.; Su, Z.; Zhang, R.; Xiao, Q.; Li, H. Promoter difference of LcFT1 is a leading cause of natural variation of flowering timing in different litchi cultivars (Litchi chinensis Sonn.). Plant Sci. 2015, 241, 128–137. [Google Scholar] [CrossRef] [PubMed]
  6. Zhang, H. Studies of Floral Induction and Initiation in Litchi (Litchi chinensis Sonn.). Ph.D. Thesis, South China Agricultural University, Guangzhou, China, 2014. [Google Scholar]
  7. Yang, M.C.; Wu, Z.C.; Chen, R.Y.; Abbas, F.; Hu, G.B.; Huang, X.M.; Guan, W.S.; Xu, Y.S.; Wang, H.C. Single-nucleus RNA sequencing and mRNA hybridization indicate key bud events and LcFT1 and LcTFL1-2 mRNA transportability during floral transition in litchi. J. Exp. Bot. 2023, 74, 3613–3629. [Google Scholar] [CrossRef] [PubMed]
  8. Zhang, H.F.; Li, H.; Lai, B.; Xia, H.Q.; Wang, H.C.; Huang, X.M. Morphological characterization and gene expression profiling during bud development in a tropical perennial, Litchi chinensis Sonn. Front. Plant Sci. 2016, 7, 1517. [Google Scholar] [CrossRef]
  9. Fu, X.Y.; Mo, W.P.; Zhang, J.Y.; Zhou, L.Y.; Wang, H.C.; Huang, X.M. Shoot growth pattern and quantifying flush maturity with SPAD value in litchi (Litchi chinensis Sonn.). Sci. Hortic. 2014, 174, 29–35. [Google Scholar] [CrossRef]
  10. Batten, D.; Mcconchie, C. Floral induction in growing buds of lychee (Litchi chinensis) and mango (Mangifera indica). Aust. J. Plant Physiol. 1995, 22, 783–791. [Google Scholar] [CrossRef]
  11. Chen, H.; Huang, H.; Liu, Z. Flower formation and patterns of carbohydrate distribution in litchi trees. Acta Hortic. Sin. 2004, 31, 1–6. [Google Scholar]
  12. Cronje, R.B.; Ratlapane, I.M.; Rohwer, E.A.; Hoffman, E.W.; Huang, X.M. Carbohydrate reserve dynamics as influenced by shoot control strategies and climatic conditions prior to flowering in ‘Mauritius’ litchi. Acta Hortic. 2020, 1293, 155–165. [Google Scholar] [CrossRef]
  13. Menzel, C.M.; Rasmussen, T.S.; Simpson, D.R. Carbohydrate reserves in lychee trees (Litchi chinensis Sonn.). J. Hortic. Sci. 1995, 70, 245–255. [Google Scholar] [CrossRef]
  14. Yang, H.F.; Kin, H.J.; Chen, H.B.; Rahman, J.; Lu, X.Y.; Zhou, B.Y. Carbohydrate accumulation and flowering-related gene expression levels at different developmental stages of terminal shoots in Litchi chinensis. Hortic. Sci. 2014, 49, 1381–1391. [Google Scholar] [CrossRef]
  15. Cronje, R.B.; Hajari, E.; Jonker, A.; Ratlapane, I.M.; Huang, X.; Theron, K.I.; Hoffman, E.W. Foliar application of ethephon induces bud dormancy and affects gene expression of dormancy- and flowering-related genes in ‘Mauritius’ litchi (Litchi chinensis Sonn.). J. Plant Physiol. 2022, 276, 153768. [Google Scholar] [CrossRef]
  16. De Greef, J.A.; De Proft, M.P.; Mekers, O.; Van Dijck, R.; Jacobs, L.; Philippe, L. Floral Induction of Bromeliads by Ethylene. In Biochemical and Physiological Aspects of Ethylene Production in Lower and Higher Plants; Clijstersv, H., Proft, M., Marcelle, R., Poucke, M., Eds.; Kluwer Academic Publishers: Alphen aan den Rijn, The Netherlands, 1989; pp. 313–322. [Google Scholar]
  17. Bukovac, M.J.; Sabbatini, P.; Schwallier, P.G. Modifying alternate bearing of spur-type ‘Delicious’ apple with ethephon. HortScience 2006, 41, 1606–1611. [Google Scholar] [CrossRef]
  18. Pasa, M.D.S.; Carra, B.; Brighenti, A.F.; Pinto, F.A.M.F.; de Mello-Farias, P.C.; Herter, F.G. Ethephon as a potential tool to manage alternate bearing of ‘Fuji’ apple trees. Rev. Ceres 2021, 68, 180–184. [Google Scholar] [CrossRef]
  19. Hayashi, T.; Heins, R.D.; Cameron, A.C.; Carlson, W.H. Ethephon influences flowering, height, and branching of several herbaceous perennials. Sci. Hortic. 2001, 91, 305–324. [Google Scholar] [CrossRef]
  20. Elfving, D.C.; Lang, G.A.; Visser, D.B. Prohexadione-Ca and ethephon reduce shoot growth and increase flowering in young, vigorous sweet cherry trees. HortScience 2003, 38, 293–298. [Google Scholar] [CrossRef]
  21. Liu, H.; Chen, T.Q.; Wang, G.; Liang, Z.Q. Techniques in flush control and flower promotion in litchi. China Trop. Agric. 2012, 46, 82–83. (In Chinese) [Google Scholar]
  22. Cronje, R.B.; Ratlapane, I.M. Effect of full-cover ethephon applications on flowering and yield of ‘Mauritius’ litchi in South Africa. Acta Hortic. 2018, 1211, 71–78. [Google Scholar] [CrossRef]
  23. Khan, N.A. An evaluation of the effects of exogenous ethephon, an ethylene releasing compound, on photosynthesis of mustard (Brassica juncea) cultivars that differ in photosynthetic capacity. BMC Plant Biol. 2004, 4, 21. [Google Scholar] [CrossRef] [PubMed]
  24. Liu, J.; Xu, L.X.; Wang, Y.B.; Han, L.B. Ethephon treatment reduced Mondo grass (Ophiopogon japonicus) gas exchange rate and gene expression of Rbcs. Euro. J. Hortic. Sci. 2019, 84, 106–112. [Google Scholar] [CrossRef]
  25. Li, K.T.; Burns, J.K.; Syvertsen, J.P. Recovery from phytotoxicity after foliar application of fruit-loosening abscission compounds to citrus. J. Am. Soc. Hortic. Sci. 2008, 133, 535–541. [Google Scholar] [CrossRef]
  26. Chen, H. Studies on Flower Induction and Differentiation in Litchi Chinensis Sonn. with Emphasis on Their Relations to Temperature. Ph.D. Thesis, South China Agricultural University, Guangzhou, China, 2002. [Google Scholar]
  27. Liu, J.; Sherif, M. Hormonal orchestration of bud dormancy cycle in deciduous woody perennials. Front. Plant Sci. 2019, 10, 1136. [Google Scholar] [CrossRef]
  28. Corbineau, F.; Xia, Q.; Bailly, C.; El-Maarouf-Bouteau, H. Ethylene, a key factor in the regulation of seed dormancy. Front. Plant Sci. 2014, 5, 39. [Google Scholar] [CrossRef]
  29. Ophir, R.; Pang, X.; Halaly, T.; Venkateswari, J.; Lavee, S.; Galbraith, D.; Or, E. Gene-expression profiling of grape bud response to two alternative dormancy-release stimuli expose possible links between impaired mitochondrial activity, hypoxia, ethylene-ABA interplay and cell enlargement. Plant Mol. Biol. 2009, 71, 403–423. [Google Scholar] [CrossRef] [PubMed]
  30. Shi, Z.; Halaly-Basha, T.; Zheng, C.; Weissberg, M.; Ophir, R.; Galbraith, D.W.; Pang, X.; Or, E. Transient induction of a subset of ethylene biosynthesis genes is potentially involved in regulation of grapevine bud dormancy release. Plant Mol. Biol. 2018, 98, 507–523. [Google Scholar] [CrossRef]
  31. Ruttink, T.; Arend, M.; Morreel, K.; Storme, V.; Rombauts, S.; Fromm, J.; Bhalerao, R.P.; Boerjan, W.; Rohde, A. A molecular timetable for apical bud formation and dormancy induction in poplar. Plant Cell 2007, 19, 2370–2390. [Google Scholar] [CrossRef]
  32. Pan, W.; Liang, J.; Sui, J.; Li, J.; Liu, C.; Xin, Y.; Zhang, Y.; Wang, S.; Zhao, Y.; Zhang, J.; et al. ABA and bud dormancy in perennials: Current knowledge and future perspective. Genes 2021, 12, 1635. [Google Scholar] [CrossRef]
  33. Suttle, J.C. Physiological regulation of potato tuber dormancy. Am. J. Potato Res. 2004, 81, 253–262. [Google Scholar] [CrossRef]
  34. Ruonala, R.; Rinne, P.L.H.; Baghour, M.; Moritz, T.; Tuominen, H.; Kangaja¨rvi, J. Transitions in the functioning of the shoot apical meristem in birch (Betula pendula) involve ethylene. Plant J. 2006, 46, 628–640. [Google Scholar] [CrossRef] [PubMed]
  35. Sumitomo, K.; Narumi, T.; Satoh, S.; Hisamatsu, T. Involvement of the ethylene response pathway in dormancy induction in chrysanthemum. J. Exp. Bot. 2008, 59, 4075–4082. [Google Scholar] [CrossRef] [PubMed]
  36. Li, P.; Zheng, T.; Zhuo, X.; Zhang, M.; Yong, X.; Li, L.; Wang, J.; Cheng, T.; Zhang, Q. Photoperiod- and temperature-mediated control of the ethylene response and winter dormancy induction in Prunus mume. Hortic. Plant J. 2021, 7, 232–242. [Google Scholar] [CrossRef]
  37. Durner, E.F.; Gianfagna, T.J. Ethephon prolongs dormancy and enhances supercooling in peach flower buds. J. Am. Soc. Hortic. Sci. 1991, 116, 500–506. [Google Scholar] [CrossRef]
  38. Liu, J.Y.; Islam, M.T.; Laliberte, S.; Haak, D.C.; Sherif, S.M. Fall applications of ethephon modulates gene networks controlling bud development during dormancy in peach (Prunus persica). Int. J. Mol. Sci. 2022, 23, 6801. [Google Scholar] [CrossRef]
  39. Ma, M.M.; Zhang, H.F.; Tian, Q.; Wang, H.C.; Zhang, F.Y.; Tian, X.; Zeng, R.F.; Huang, X.M. MIKC type MADS-box transcription factor LcSVP2 is involved in dormancy regulation of the terminal buds in evergreen perennial litchi (Litchi chinensis Sonn). Hortic. Res. 2024, 11, uhae150. [Google Scholar] [CrossRef]
  40. Burns, J.K.; Ferguson, L.; Glozer, K.; Krueger, W.H.; Rosecrance, R.C. Screening fruit loosening agents for black ripe processed table olives. HortScience 2008, 43, 1449–1453. [Google Scholar] [CrossRef]
  41. Dai, Y.W. A Study on Sensitive Difference of Flush and Panicle at Different Developmental Stages to Ethylene in Litchi and Related Physiological Mechanisms. Master’s Thesis, South China Agricultural University, Guangzhou, China, 2016. [Google Scholar]
  42. Tian, Q. A Study on the Sensitivity of ‘Guiwei’ Shoots to Ethylene and Exploration of Using Ethephon for Flush Control and Flower Promotion. Master’s Thesis, South China Agricultural University, Guangzhou, China, 2024. [Google Scholar]
  43. Woodrow, L.; Jiao, J.; Tsujita, M.J.; Grodzinski, B. Whole plant and leaf steady state gas exchange during ethylene exposure in Xanthium strumarium L. Plant Physiol. 1989, 90, 85–90. [Google Scholar] [CrossRef]
  44. Subhadrabandhu, S.; Koo-Duang, A. Effect of ethephon on flowering of two lychee (Litchi chinensis Sonn.) cultivars. Acta Hortic. 1987, 201, 181–186. [Google Scholar] [CrossRef]
  45. Hafeez, A.; Husain, M.A.; Singh, S.P.; Chauhan, A.; Khan, M.T.; Kumar, N.; Chauhan, A.; Soni, S.K. Implementation of drone technology for farm monitoring & pesticide spraying: A review. Inf. Process. Agric. 2023, 10, 192–203. [Google Scholar] [CrossRef]
Horticulturae 10 01109 g001
Figure 1. Changes in temperature during the experiment (from 1 November 2021 to 15 February 2022).
Figure 1. Changes in temperature during the experiment (from 1 November 2021 to 15 February 2022).
Horticulturae 10 01109 g001
Horticulturae 10 01109 g002
Figure 2. Morphological changes in terminal bud of litchi cv. Jingganghongnuo after ethephon treatments at different concentrations. WAT stands for “Weeks after treatment”.
Figure 2. Morphological changes in terminal bud of litchi cv. Jingganghongnuo after ethephon treatments at different concentrations. WAT stands for “Weeks after treatment”.
Horticulturae 10 01109 g002
Horticulturae 10 01109 g003
Figure 3. Effect of ethephon treatment on bud break rate in litchi cv. Jinganghongnuo. Arrows show the time point from which the bud break rate started to increase, indicating the ending of the bud-break-suppressing effect of ethephon.
Figure 3. Effect of ethephon treatment on bud break rate in litchi cv. Jinganghongnuo. Arrows show the time point from which the bud break rate started to increase, indicating the ending of the bud-break-suppressing effect of ethephon.
Horticulturae 10 01109 g003
Horticulturae 10 01109 g004
Figure 4. Effect of ethephon treatments on cumulative leaf drop rate. Bars above the columns indicate standard error of means; different letters indicate significant difference among treatments at the same time point at p < 0.05 (n = 5).
Figure 4. Effect of ethephon treatments on cumulative leaf drop rate. Bars above the columns indicate standard error of means; different letters indicate significant difference among treatments at the same time point at p < 0.05 (n = 5).
Horticulturae 10 01109 g004
Horticulturae 10 01109 g005
Figure 5. Effect of ethephon treatments on net photosynthesis (Pn) of litchi cv. Jingganghongnuo. Bars above the columns indicate standard error of means; different letters indicate significant difference among treatments at the same time point at p < 0.05 (n = 5).
Figure 5. Effect of ethephon treatments on net photosynthesis (Pn) of litchi cv. Jingganghongnuo. Bars above the columns indicate standard error of means; different letters indicate significant difference among treatments at the same time point at p < 0.05 (n = 5).
Horticulturae 10 01109 g005
Horticulturae 10 01109 g006
Figure 6. Effect of ethephon treatments on the panicle emergence rate. Different letters next to data points (means ± standard error) indicate significant difference among treatments on the same date at p < 0.05, (n = 5). Arrows indicate day of beginning of panicle emergence for trees, arbitrarily set as 20% of panicle emergence.
Figure 6. Effect of ethephon treatments on the panicle emergence rate. Different letters next to data points (means ± standard error) indicate significant difference among treatments on the same date at p < 0.05, (n = 5). Arrows indicate day of beginning of panicle emergence for trees, arbitrarily set as 20% of panicle emergence.
Horticulturae 10 01109 g006
Horticulturae 10 01109 g007
Figure 7. Panicle growth in shoots under ethephon treatment at different concentrations. (A–D) indicate treatments at 0 (control), 250, 500 and 1000 mg/L of ethephon, respectively. Arrows show positions (nodes) with panicle emergence. Photos were taken on 18 February 2022.
Figure 7. Panicle growth in shoots under ethephon treatment at different concentrations. (A–D) indicate treatments at 0 (control), 250, 500 and 1000 mg/L of ethephon, respectively. Arrows show positions (nodes) with panicle emergence. Photos were taken on 18 February 2022.
Horticulturae 10 01109 g007
Horticulturae 10 01109 g008
Figure 8. Effect of ethephon on the expression of LcFT1 in mature leaves of litchi cv. Jingganghongnuo. Different letters beside data points (means ± standard error) indicate significant difference among treatments on the same day at p < 0.05, (n = 3).
Figure 8. Effect of ethephon on the expression of LcFT1 in mature leaves of litchi cv. Jingganghongnuo. Different letters beside data points (means ± standard error) indicate significant difference among treatments on the same day at p < 0.05, (n = 3).
Horticulturae 10 01109 g008
Horticulturae 10 01109 g009
Figure 9. Changes in bud break rate (A) and leaf drop rate (B) after spraying 1000 mg/L of ethephon with a drone. Bars = standard errors.
Figure 9. Changes in bud break rate (A) and leaf drop rate (B) after spraying 1000 mg/L of ethephon with a drone. Bars = standard errors.
Horticulturae 10 01109 g009
Table 1. Primer sequences for RT-qPCR analysis of LcFT1.
Table 1. Primer sequences for RT-qPCR analysis of LcFT1.
GeneSequence
(F: Upper Stream Primer; R: Lower Stream Primer)
LcFT1F: CAAAGAATTTGCTGAGCTTTGCA
R:ACTTTATCGTCTCCTTCCACC
LcActinF: AGTTTGGTTGATGTGGGAGAC
R: TGGCTGAACCCGAGATGAT
Table 2. Dates of beginning of panicle emergence and corresponding cumulative chilling hours below 15 °C from ethephon application in different treatments.
Table 2. Dates of beginning of panicle emergence and corresponding cumulative chilling hours below 15 °C from ethephon application in different treatments.
TreatmentControl250 mg/L500 mg/L1000 mg/L
Date of beginning of panicle emergence24 December 202131 December 20213 January 20226 January 2022
Cumulative chilling hours below 15 °C (h)468.5443.8416.7298.7
Table 3. Effect of ethephon treatment on number and purity of floral panicles.
Table 3. Effect of ethephon treatment on number and purity of floral panicles.
TreatmentNumber of Nodes with Panicles in a Terminal ShootPure Panicle
(%)		Leafy Panicle
(%)		Vegetative Flush
(%)
Control0.44 ± 0.14 d23.0 ± 11.20 c31.0 ± 6.50 b46.0 ± 13.00 a
250 mg/L1.66 ±0.10 c38.0 ± 10.05 b45.0 ± 7.50 a22.0 ± 9.60 b
500 mg/L4.35± 0.82 b50.2 ± 14.00 b30.0 ± 7.50 b17.0 ± 6.10 b
1000 mg/L8.23 ±0.11 a67.0 ± 12.50 a20.0 ± 8.10 c13.0 ± 4.50 a
The number of nodes with panicles on a terminal shoot was counted on 18 February 2022. Panicle or flush types were investigated on 19 March 2022. Different letters beside means ± standard error indicate significant difference among treatments on the same date at p < 0.05 (n = 5).
Table 4. Effect of spraying 1000 mg/L of ethephon with a drone on flowering of litchi cv. Jingganghongnuo.
Table 4. Effect of spraying 1000 mg/L of ethephon with a drone on flowering of litchi cv. Jingganghongnuo.
TreatmentPanicle Emergence Rate (%)Pure Panicle Rate
(%)		Number of Nodes with Panicle
Control37.8 ± 4.94 b14.5 ± 2.68 b0.59 ± 0.03 b
Traditional treatment65.7 ± 8.45 a43.8 ± 4.57 a3.78 ± 1.51 a
Drone spray60.5 ± 9.62 a40.5 ± 3.61 a5.65 ± 1.19 a
Different letters beside means ± standard error indicate significant difference among treatments at p < 0.05, (n = 5). The panicle emergence rate was investigated on 19 February 2023, and the pure panicle rate and panicle number were assessed on 5 March 2023.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wen, B.; Deng, C.; Tian, Q.; Ouyang, J.; Zeng, R.; Wang, H.; Huang, X. Application of Ethephon Manually or via Drone Enforces Bud Dormancy and Enhances Flowering Response to Chilling in Litchi (Litchi chinensis Sonn.). Horticulturae 2024, 10, 1109. https://doi.org/10.3390/horticulturae10101109

AMA Style

Wen B, Deng C, Tian Q, Ouyang J, Zeng R, Wang H, Huang X. Application of Ethephon Manually or via Drone Enforces Bud Dormancy and Enhances Flowering Response to Chilling in Litchi (Litchi chinensis Sonn.). Horticulturae. 2024; 10(10):1109. https://doi.org/10.3390/horticulturae10101109

Chicago/Turabian Style

Wen, Bingyi, Cailian Deng, Qi Tian, Jianzhong Ouyang, Renfang Zeng, Huicong Wang, and Xuming Huang. 2024. "Application of Ethephon Manually or via Drone Enforces Bud Dormancy and Enhances Flowering Response to Chilling in Litchi (Litchi chinensis Sonn.)" Horticulturae 10, no. 10: 1109. https://doi.org/10.3390/horticulturae10101109

APA Style

Wen, B., Deng, C., Tian, Q., Ouyang, J., Zeng, R., Wang, H., & Huang, X. (2024). Application of Ethephon Manually or via Drone Enforces Bud Dormancy and Enhances Flowering Response to Chilling in Litchi (Litchi chinensis Sonn.). Horticulturae, 10(10), 1109. https://doi.org/10.3390/horticulturae10101109

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop