Next Article in Journal
Biogas Production and Energy Balance in a Two-Stage Anaerobic Digestion of Fruit and Vegetable Waste: Thermophilic versus Mesophilic
Next Article in Special Issue
Application of Synthetic Biology Approaches to High-Yield Production of Mycosporine-like Amino Acids
Previous Article in Journal
Prognostic Metamodel Development for Waste-Derived Biogas-Powered Dual-Fuel Engines Using Modern Machine Learning with K-Cross Fold Validation
Previous Article in Special Issue
Recent Advances in the Hydroxylation of Amino Acids and Its Derivatives
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Improved Glutamic Acid Production Capacity of Corynebacterium glutamicum by the ARTP Mutagenesis Method

1
Key Laboratory of Fermentation Engineering (Ministry of Education), Cooperative Innovation Center of Industrial Fermentation (Ministry of Education & Hubei Province), National “111” Center for Cellular Regulation and Molecular Pharmaceutics, School of Bioengineering, Hubei University of Technology, Wuhan 430068, China
2
ABI Group, Donghai Laboratory, College of Marine Science and Technology, Zhejiang Ocean University, Zhoushan 316022, China
3
State Key Laboratory of Biocatalysis and Enzyme Engineering, School of Life Sciences, Hubei University, Wuhan 430062, China
*
Authors to whom correspondence should be addressed.
Fermentation 2023, 9(7), 599; https://doi.org/10.3390/fermentation9070599
Submission received: 5 May 2023 / Revised: 16 June 2023 / Accepted: 25 June 2023 / Published: 27 June 2023
(This article belongs to the Special Issue New Insights into Amino Acid Biosynthesis)

Abstract

Glutamic acid is an important amino acid that is used widely in the fields of food, medicine, and agriculture. One of the methods of glutamic acid production is direct microbial fermentation, so the genetic stability and glutamic-acid-producing capacity of the producing strain are the keys to improving glutamic acid concentration. Experiments were carried out using Corynebacterium glutamicum GL−6 as the parental strain, with two iterations of mutagenesis by atmospheric and room temperature plasma (ARTP) and screening with agar plates tolerant to high sugar and malonic acid, and the best strains with stable phenotypes were verified by fermentation in 20 L tanks. The results show that the optimal mutagenesis time of ARTP was 140 s, with lethality and positive mutation rates of 93.0% and 15.6%, respectively. The concentrations of the high-sugar and malonic acid agar plates were 240 g/L and 35 g/L, respectively. A mutant strain, P−45, with improved glutamic acid production capacity and genetic stability, was obtained through two rounds of iterative mutagenesis screening. The concentration of this strain in the Erlenmeyer flasks was 17.7 g/L, which was 18.8% higher than that of the parental strain, GL−6, and could be inherited stably for 10 generations. In the glutamic acid synthesis pathway, the upregulation of the gene encoding citrate synthase (cs), gene encoding isocitrate dehydrogenase (icdh), and gene encoding glutamate dehydrogenase (gdh), and the downregulation of the gene encoding oxoglutarate dehydrogenase complex (odhc) increased the carbon flows of the TCA cycle and its branch metabolic flow to glutamic acid synthesis. P−45 showed a glutamic acid concentration of 147.0 g/L under fed-batch fermentation conditions in 20 L tanks, which was 81.5% higher than the starting strain, GL−6. This study provides a new technical solution for improving microbial metabolites and genetic stability.

1. Introduction

Glutamic acid is one of the most important amino acids that is extensively utilized in the food industry as a flavor enhancer. In addition, it has a high application value in medicine, cosmetics, industry, and agriculture [1]. The current glutamic acid production has been steadily increasing with the development of gene editing and microbial breeding technology. However, the genetic stability and production efficiency of production strains are still intrinsic to the industrialization of microbial glutamic acid production. Therefore, it is important to improve the genetic stability and increase the glutamic acid yield of production strains through mutagenic selection for the clean production of glutamic acid and increase the profit of enterprises [2].
Microbial breeding methods have been intended for the fermentation industry, and traditional mutagenesis methods include UV mutagenesis and chemical mutagenesis for individual or repeated mutagenesis treatments, etc. [3,4,5]. Nevertheless, traditional breeding techniques have problems such as a lack of directionality, large screening workloads, and unsafe operations, and some chemical mutagens are especially toxic and harmful to humans [6]. In addition, the common genetic engineering breeding techniques are difficult to industrialize due to their disadvantages of an easy loss of recombinant plasmids, poor stability, and low yields of gene expression products. In recent years, a new mutagenesis technology, atmospheric and room temperature plasma (ARTP), has been adopted much more for mutagenesis breeding of more than 100 kinds of microorganisms, including bacteria [7,8,9,10], fungi, and algae, because of its advantages of an easy operation, safety and efficiency, mild conditions, and a friendly environment [11,12,13,14,15,16,17]. For instance, Yu et al. [18] obtained a mutant with a high cysticercin yield by ARTP mutagenesis using Streptomyces hygroscopicus ATCC 14,891 as the parental strain. The yield was significantly improved compared to the original strain; production had a 32.5% increase, and the mutants were stable. Zhang et al. [19] also treated Candida tropicalis SK36.001 by ARTP mutagenesis and screened the highest xylitol yield of mutant T31 from 200 mutants, which had a xylitol yield of 0.61 g/g, 22.0% higher than the parental strain, and the expressions of related genes and the xylitol reductase activity were higher than those of the parental strain.
Mutagenesis breeding for high glutamic acid production is mainly based on metabolic regulation, where glutamic acid synthesis is mainly influenced by carbon metabolic flows and feedback inhibition by succinate itself. Therefore, it is a high-sugar and respiratory chain-inhibitor malonic acid that could screen dual-tolerant strains which would accumulate more glutamic acid. These strains might be capable of increasing carbon flow and deregulating the strain’s feedback [20,21]. In traditional strain selection, the metabolite yield can be improved by screening mutant strains for tolerance or resistance, but the genetic stability of single mutagenesis screening is poor, which is not conducive to the industrial application of strains. To address the occurrence of such problems, most researchers have mainly used multiple rounds of repeated iterative mutagenesis. For example, Wang et al. [22] screened a genetically stable and high-yielding ε-poly-l-lysine mutant strain, AS3-14, after three iterations of ARTP breeding, and the yield was increased by 66.3% compared to the parental strain. Gu et al. [23] obtained the high-enzyme-producing mutant strain A2-13 after multiple rounds of repeated mutagenesis by ARTP combined with ethyl methanesulfonate (EMS), which had stable genetic traits and a 61.1% higher yield than the parental strain. Thus, multiple rounds of iterative mutagenesis are an effective way to improve the genetic stability of mutant strains.
In this experiment, a two-round iterative screening method of ARTP mutagenesis combined with high-sugar-tolerant and malonic-acid-resistant plates was established using C. glutamicum GL−6 as the parental strain, and a mutant strain with genetic stability and glutamic acid production capacity was screened and validated by glutamic acid fermentation in a 20 L fermentation tank (Figure 1).

2. Materials and Methods

2.1. Microbiological Cultivation

The parental strain of this study was Corynebacterium glutamicum GL−6, which was obtained from the Key Laboratory of Fermentation Engineering, Ministry of Education, Hubei University of Technology.
The seeding medium (SM): glucose—25.0 g/L, K2HPO4·3H2O—1.5 g/L, MgSO4·7H2O—0.6 g/L, corn steep liquor—30.0 g/L, urea—3.0 g/L, MnSO4·H2O—4.0 mg/L, FeSO4·7H2O—4.0 mg/L. The fermentation medium (FM): glucose—22.0 g/L, yeast powder—30.0 g/L, succinic acid—1.0 g/L, urea—10.0 g/L, MgSO4·7H2O—0.4 g/L, methionine—0.5 g/L, K2HPO4·3H2O—2.4 g/L, biotin—0.3 mg/L, vitamin B1—0.2 mg/L, MnSO4·H2O—10.0 mg/L [24]. The basic medium (BM): glucose—20.0 g/L, (NH4)2SO4—1.5 g/L, KH2PO4—4.5 g/L, K2HPO4·3H2O—1.5 g/L, MgSO4·7H2O—0.1 g/L, MnSO4·H2O—0.02 g/L, FeSO4·7H2O—0.02 g/L, biotin—50 μg/L, thiamine—0.1 mg/L, agar—20.0 g/L. The high glucose medium: high concentrations of (180 g/L, 200 g/L, 220 g/L, and 240 g/L) glucose were added to the basic medium. The malonic-acid-resistant medium: sodium malonate at concentrations of 20 g/L, 25 g/L, 30 g/L, and 35 g/L was added to the basic medium. The pH of the above medium was adjusted to 7.1 ± 0.1 before the sterilization at 115 °C for 20 min.
The strain was incubated overnight (200 rpm, 32 °C, OD600 nm = 20) in a Cillin flask containing 5 mL of the SM to obtain the seed solution. Then, 500 μL of the seed solution was inoculated in an Erlenmeyer flask containing 50 mL of FM for 36 h (32 °C, 200 rpm). Finally, the glutamic acid concentration, OD600 nm, and glucose concentration were measured.

2.2. ARTP Mutagenesis

The ARTP mutagenesis system (Wuxi Yuanqing Tianmu Biotechnology Co., Ltd., China) was used with reference to the previous research methods and with slight modifications [9]. After centrifugation, the supernatant was removed, and the bacterium was collected from the logarithmic growth period (12~14 h), washed 2~3 times with 0.9% saline, and diluted to make a bacterial suspension. The bacteria suspension was diluted, evenly applied to the surface of the slide, and then transferred to the center of the UV-sterilized ARTP chamber. The instrument parameters were set, and the sample was processed by clicking “Start” (Table 1). After the mutagenesis was completed, the carriers were placed into EP tubes with 1 mL of sterile saline to elute into a new bacterial suspension and set aside.
The bacterial suspensions before and after mutagenesis were diluted in a 10-fold gradient, and 100 μL of diluted samples at 10−2, 10−3, and 10−4 concentrations were applied to the BM plates. The number of single colonies was counted after 24~48 h of inversion incubation at a constant temperature in a 32 °C incubator to calculate the lethality (%), which was calculated as follows: L e t h a l i t y   r a t e ( % ) = ( 1 N u n b e r   o f   c o l o n i e s   a f t e r   m u t a g e n e s i s N u m b e r   o f   b e f o r e   m u t a g e n e s i s ) × 100 % .
Under the same treatment conditions, single colonies treated with a different time mutagenesis were picked out, activated, and fermented for 36 h in a Cillin flask containing 5 mL of FM, and their glutamic acid concentration was measured. The glutamic acid concentration of the control strain (mutagenesis treatment: 0 s) was used as the benchmark for comparison, and a positive mutation was considered when the glutamic acid concentration of the mutant bacterium was greater than that of the control strain, which was calculated as follows: P o s i t i v e   m u t a t i o n   r a t e ( % ) = N n m b e r   o f   p a s i t i v e   m u t a n t   c o l o i e s T o t a l   n u m b e r   o f   c o l o n i e s × 100 % , where the total number of colonies in the calculation formula refers to all colonies growing on the screening plate.
Cross-iterative mutagenesis: Using the same ARTP mutagenesis method, the high-yielding mutant strain obtained in the first round of mutagenesis was used as the parental strain for the second round of repeated mutagenesis. The high-sugar-resistant second-round mutant strain was diluted and coated in malonic acid agar plates in a crossover manner, and then the malonic-acid-resistant second-round mutant strain was diluted and coated in a high-sugar medium to screen for mutant strains with both high sugar resistance and malonic acid resistance.

2.3. Mutant Strain Screening

Determining the best screening plate: C. glutamicum GL−6 strains were diluted at certain concentrations, coated in high-sugar and malonic acid plates with different concentration gradients, incubated at 32 ℃ for 4~6 d at a constant temperature, and inverted. The best growth condition of the strains in the plates was observed to determine the best medium for glucose and malonic acid concentrations.
Primary screening and re-screening of mutant strains: Using a biosensor as a method to detect glutamic acid concentrations, single colonies of mutant strains with vigorous growth in the screening plate were firstly picked out and fermented in a Cillin bottle with 5 mL of FM, and their glutamic acid concentration was compared to obtain the Cillin bottle primary screening mutant strains.
Verification of genetic stability: The high-yielding mutant strains obtained from the combination of the primary screening and re-screening methods were passed through the FM every 36 h for a total of 10 generations, and then the glutamic acid concentration and OD600 nm of each generation were measured to verify the genetic stability of the mutant strains.

2.4. qRT-PCR Assay

GL-6 and the final mutant strain were taken as samples when they grew at log phase and were in a high-sugar and malonic acid screening medium. The RNA was extracted using the Cell Total RNA Isolation Kit (Foregene, Chengdu, China) and reverse-transcribed using the PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TaKaRa, Beijing, China). The cDNA was obtained by reverse transcription with the PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TaKaRa, Beijing, China), and quantitative PCR reactions were performed using the ChamQ SYBR qPCR Master Mix (Nanjing Novozymes Biological Co., Ltd., China) to detect the gene transcript levels. The primers used for qPCR were synthesized by (Shanghai Bioengineering Co., Ltd., Shanghai, China), as shown in Table 2, using the 16S rRNA gene as an internal reference. The CT method (2-ΔΔCT) was used to calculate the relative expression of different genes [25].

2.5. 20 L Fermenter with Fed-Batch Fermentation

The strain was activated for logarithmic growth (OD600 nm = 20) in a 500 mL Erlenmeyer flask containing 100 mL of SM, and then inoculated at 10% (v/v) in a 20 L fermenter (Shanghai Baoxing Biochemical Equipment Co., Ltd., Shanghai, China) containing 12 L of the fermentation medium for 56 h of fed-batch fermentation. The batch replenishment parameters were controlled as follows: the tank pressure was maintained at 0.030~0.035 MPa; the initial air flow was 1.0 L/min and adjusted to 1.3 L/min after 24 h of fermentation; the initial pH was 6.5~7.0, and pH 7.2~7.5 was maintained by the flow addition of ammonia during replenishment; stirring was controlled at 100~500 r/min; dissolved oxygen was set at 20% and coupled with stirring; and the final concentration of sugar during fermentation was maintained at 1.0~3.0 g/L by the flow addition of 500 g/L glucose (100 mL/h) after 8 h of fermentation. The temperature was maintained at 32 °C during the first period, and the temperature was increased to 37 °C to induce glutamic acid secretion when the OD600 nm reached 70~80 at the later stage of fermentation (44 h). The replenishment was stopped 2~3 h before the end of fermentation, and the fermentation was finished when the residual sugar was depleted. During the fermentation period, samples were taken every 4 h to determine the glutamic acid concentration, the OD600 nm, and the residual sugar concentration.

2.6. Analysis Method

The glutamic acid and glucose concentrations were determined using the S−10 biosensor analyzer (Shenzhen Sillman Biotechnology Co., Ltd., Shenzhen, China). The OD600 nm was determined by the visible spectrophotometer method (Shanghai Meisei Instruments Co., Ltd., Shanghai, China), and the absorbance was measured at 600 nm [26,27].

2.7. Data Analysis

All experiments were repeated in parallel three times. GraphPad Prism 8.0.1 and Origin 2019b software were used to analyze the data and plot the experimental graphs.

3. Results and Discussion

3.1. Determining the Optimal Time for Mutagenesis

To effectively screen the high-yield strains, the lethality and positive mutation curves were plotted after mutagenesis of the parental strain GL−6 using the ARTP technique, respectively. The lethality rates of the strain were 54.0%, 83.0%, and 96.0% after exposure to the ARTP system for 120 s, 140 s, and 160 s, respectively (Figure 2). When the radiation time was extended to 200 s, there was no cell survival. Meanwhile, different treatment times also affected the positive mutation rates, which were 14.5%, 15.6%, and 13.8% at 120 s, 140 s, and 160 s of the mutagenesis treatment, respectively (Figure 2). Therefore, the positive mutation rate and lethality rate were highest when the ARTP mutagenesis treatment was 140 s, with 15.6% and 93.0%, respectively, and this experimental result is consistent with the results of previous studies [28]. Single colonies obtained under the lethality rate of 90.0%~95.0% are considered mutants with altered physiological characteristics. According to the results, 140 s was selected as the appropriate time for mutagenesis in this study, according to the literature.

3.2. Mutant Strain Screening

3.2.1. Mutant Strain Primary Screening

In order to obtain a mutant strain with high sugar tolerance, the parental strain, GL−6, was first screened on a high-sugar plate. The growth of the GL−6 parental strain was inhibited in the high-sugar medium of 240 g/L, and its colony number decreased by 19.6% compared to that in the BM (Figure 3a). Therefore, the sugar concentration of 240 g/L was chosen as the high-sugar-tolerant medium to screen the mutant strain. Then, 155 mutant strains were randomly selected in 240 g/L high-sugar plates according to the size, roundness, and abundance of the single-colony growth (Table A1) in 40 mL Cillin bottles for primary screening. The results indicate that the majority of the mutant strains had a glutamic acid production capacity comparable to that of the GL−6 parental strain. Among the 55 positive mutant strains, only 16 mutants showed about 10% and higher increases in the glutamic acid concentration compared to the GL−6 parental strain, including one high-sugar-tolerant mutant strain P17 with 15.5 g/L of glutamic acid production, which was an increase of 17.4% compared to the GL−6 parental strain (Figure 3b). After re-screening these 16 positive mutant strains using 250 mL Erlenmeyer flasks, the mutant strain P17 remained the most glutamic-acid-producing mutant strain with 16.7 g/L of glutamic acid production, which was 12.8% higher than that of the GL−6 parental strain (Figure 3c).
For the purpose of obtaining malonic-acid-resistant mutant strains, the GL−6 parental strain was first screened on malonic acid agar plates. The GL−6 parental strain grew weakly in the malonic acid plates with 30 g/L and did not grow on plates with 35 g/L (Figure 4a). Therefore, the plates with a critical concentration of 35 g/L of malonic acid were selected for the screening of mutant strains. Then, 72 single colonies were randomly picked from the 35 g/L malonic acid agar plates (Table A2). The results of the initial sieving in the Cillin bottles showed that 10 of the 32 positive mutant strains had a 10% and higher improvement in the glutamic acid production capacity compared to that of the GL−6 parental strain (Figure 4b), including one mutant strain B58 with 15.4 g/L of glutamic acid production, which was 15.8% higher than that of the GL−6 parental strain. After re-screening these 10 positive mutant strains using 250 mL Erlenmeyer flasks, B58 was still the most glutamic-acid-producing mutant strain, with 16.4 g/L of glutamic acid production, which was 13.1% higher than that of the GL−6 parental strain (Figure 4c).
To verify the genetic stability of the mutant strains, the P17 mutant strain and the B58 mutant strain with malonic acid resistance were cultured for 10 generations. The results show that the glutamic acid yield was basically maintained at 16.0 g/L, and the OD600 nm was basically kept at 18.0 for the P17 mutant strain in the first eight generations of culture, but the glutamic acid yield and OD600 nm of the P17 mutant strain showed a gradual decrease after the eighth generation (Figure 5a). Although single mutagenesis can improve the glutamic acid yield, it is prone to the genetic instability of the trait. Similar to the P17 mutant strain, mutant strain B58 had the highest initial glutamic acid concentration, but it decreased significantly during the subsequent passaging cultures. The reason for this is the frequent reversion of mutant genes during the mutagenic selection of the strains (Figure 5b).

3.2.2. Cross-Iterative Mutagenic Strain Re-Screening

To solve the problems of the genetic instability and low glutamic acid production capacity of the mutant strains, we used cross-iterative mutagenesis. The high-sugar-resistant mutant strain P17 was mutagenized in two rounds and then coated on agar plates with a malonic acid concentration of 35 g/L. A total of 61 single colonies were picked out (Table A3), and the highest glutamic-acid-producing mutant strain P−3 was obtained with a glutamic acid yield of 16.9 g/L, which was 11.2% and 22.5% higher than those of the B58 control strain and the GL−6 parental strain, respectively (Figure 6a). Among them, there were 12 positive mutant strains, and after activation and re-screening using Erlenmeyer flasks, P−45, a mutant strain, with a glutamic acid production of 17.7 g/L, was obtained, which was 14.9% and 18.8% higher than those of the B58 control strain and the GL−6 parental strain, respectively (Figure 6b).
Then, the B58 mutant strain with malonic acid resistance was repeatedly mutagenized and coated on high-sugar plates at a concentration of 240 g/L. A total of 22 single colonies were selected (Table A4), and the highest glutamic-acid-producing mutant strain B−8 was obtained with a glutamic acid yield of 15.7 g/L, which was 10.6% and 15.4% higher compared to those of the P17 control strain and the GL−6 parental strain, respectively (Figure 7a). There were five positive mutant strains, and a mutant strain, B−13, with a glutamic acid production of 17.0 g/L, was obtained after activation and re-screening by shaking the Erlenmeyer flasks, with increases of 2.4% and 14.1% compared to the P17 control strain and the GL−6 parental strain, respectively (Figure 7b).
The mutant strains P−45 and B−13 were cultured for 10 consecutive generations to verify their genetic stability. The results show that the P−45 mutant strain was stable in terms of genetic stability traits for 10 consecutive generations of culture. The glutamic acid concentration was held at 17.3 g/L and the OD600 nm was maintained at around 18.5 (Figure 8a). The genetic traits of mutant strain B−13 were also more stable than those of B58 under the same conditions (Figure 8b). It is further shown that multiple rounds of repeated cross-iterative mutagenesis were effective at enhancing high-sugar-tolerant and malonic-acid-resistant mutants while stabilizing their genetic traits. The results also show that P−45 had slightly better genetic stability and glutamic acid production than B−13, so mutant strain P−45 should be selected for experiments in subsequent studies.

3.3. qRT-PCR Analysis

To further investigate the reason for the increased glutamic acid concentration in the P−45 mutant strain, we first analyzed the key genes in the glutamic acid synthesis pathway (cs, icdh, gdh, and odhc) by qRT-PCR assay (Figure 9A). We detected a significant upregulation of the expression level of the cs gene (encoding citrate synthase (CS)) mutant strain, which was increased 1.3−fold compared to the GL−6 parental strain (Figure 9B). It also had a 16% upregulation of the expression level of the icdh gene (encoding isocitrate dehydrogenase (ICDH)), which catalyzes the synthesis of glutamic acid precursors (Figure 9B). The enzymes encoded by these two genes are key rate-limiting enzymes in the tricarboxylic acid cycle (TCA), and it is possible that the high-glucose-tolerant mutant strain obtained from the screening increased the efficiency of glucose utilization to maximize the carbon flow of this strain in glycolysis (EMP) and the tricarboxylic acid cycle (TCA) to enhance glutamic acid synthesis. Varela et al. [29] found that 90% of the carbon flow in C. glutamicum was directed to the pentose phosphate pathway (PPP) under hyperosmotic stress, resulting in a 3.5-fold increase in glycolytic (EMP) flow. This result may be one of the main reasons for the upregulation of the gene and the increase in the glutamic acid concentration in this study.
In addition, the expression level of the odhc gene (encoding the oxoglutarate dehydrogenase complex (ODHC)) of the mutant strain was significantly downregulated by 1.6-fold compared to that of the GL−6 parental strain (Figure 9B). ODHC is the enzyme that catalyzes the formation of succinyl-CoA from glutamic acid synthesis precursors (α-ketoglutarate). A reduced quantity of ODHC could alter the metabolic distribution, allowing for more α-ketoglutarate to be used for glutamic acid synthesis. It was shown that the α-ketoglutarate dehydrogenase complex-encoding gene odhc has a low level of enzymatic activity for high glutamic-acid-producing strains in another study [30]. In this study, odhc gene expression levels were significantly downregulated due to the screening of the mutant strains with malonic acid resistance. Malonic acid is a structural analog of succinic acid, and mutant bacteria with structural analog resistance can release succinic acid’s own feedback inhibition and feedback blockage, which can concentrate intracellular carbon sources in the glutamic acid synthesis pathway. The expression level of the gdh gene (encoding glutamate dehydrogenase (GDH)) in the mutant strain was increased 4-fold compared to the GL−6 parental strain (Figure 9B). In short, the high-sugar and malonic-acid-tolerant mutant strains with better producing capacity of the glutamic acid could increase the glutamic acid anabolic flow, resulting in a significant increase in glutamic acid concentration.

3.4. Comparison of Erlenmeyer Flasks Fermentation Processes

To verify the fermentation performance of the P−45 mutant strain and the GL−6 parental strain, the two strains were subjected to Erlenmeyer flask fermentation experiments. The trends of the sugar consumption and OD600 nm of the two strains during the Erlenmeyer flask fermentation were basically the same (Figure 10). In terms of sugar consumption, the glucose concentration of both strains was depleted to below 3.0 g/L after 24 h of fermentation and remained stable, but the sugar consumption rate of mutant strain P−45 was slightly higher than that of the GL−6 parental strain during this fermentation. In addition, the OD600 nm of mutant strain P−45 increased from 1.5 to a maximum of about 21.8, and the OD600 nm of mutant strain P−45 was always higher than that of parental strain GL−6 at the same fermentation time, indicating that the growth and glutamic-acid-producing capacity of mutant strain P−45 was stronger than that of parental strain GL−6. Comparing the changes in the glutamic acid concentration of the two strains, it is found that the glutamic acid concentration of mutant strain P−45 was also consistently higher than that of parental strain GL−6, and the glutamic acid concentration of mutant strain P−45 reached a maximum of 17.1 g/L at the growth arrest stage of the strain, which was 2.4 g/L higher than that of GL−6 (14.7 g/L), an increase of 16.3%. From the results of the Erlenmeyer flask experiments, it could be inferred that ARTP ‘high sugar-malonic acid’ cross-iterative mutagenesis might be related to improving glutamic acid synthesis, resulting in a higher glutamic acid yield.

3.5. 20 L Fermenter with Fed-Batch Fermentation

Although the glutamic acid concentration of the mutant strain was significantly higher than that of the parental strain in the Erlenmeyer flask fermentation, it is unclear whether this high productivity can be sustained in large-scale fermentations to meet industrial demands. Therefore, the production performances of the GL−6 parental strain and the P−45 mutant strain were compared in a 20 L bioreactor in a fed-batch fermentation. The P−45 mutant strain and the GL−6 parental strain had similar growth curves, but the cell growth performance of P−45 was better than that of the GL−6 parental strain, and the OD600 nm was always maintained at a higher level. The P−45 mutant strain reached the highest OD600 nm at 48 h of fermentation and increased by 14.7% compared to the GL−6 parental strain, after it gradually decreased until the end of fermentation (Figure 11). The glucose consumption rate of the P−45 mutant strain also converged with that of the parental strain, with the residual sugar decreasing from 20.7 g/L to 2.1 g/L at 8 h of fermentation.
For longer strain growth and glutamic acid production, we used batch replenishment in the fermenter [31]. After 8 h of fermentation, the nutrient concentration in the fermentation environment was maintained by uniformly flowing 500 g/L of glucose at 1.0~2.0 g/L, and the pH was controlled by flowing ammonia in the range of 7.2~7.5 as a way to promote strain growth and glutamic acid accumulation. After fed-batch fermentation, the fermentation time of mutant strain P−45 was extended from 32 to 48 h. The highest glutamic acid concentration was 147 g/L, which was 81.5% higher than that of the GL−6 parental strain (81 g/L), and the glutamic acid synthesis capacity was significantly enhanced compared to the Erlenmeyer flask fermentation (17.1 g/L). The reason is that the batch replenishment method could meet the nutritional requirements of the strain for the growth and accumulation of metabolites. The above results indicate that glucose utilization was improved by performing ARTP iterative mutagenesis combined with dual-resistance selection. Under the conditions of a sufficient carbon source (batch replenishment), the conversion of α-ketoglutarate to glutamic acid catalyzed by glutamic acid dehydrogenase was enhanced, resulting in a large accumulation of glutamic acid by the P−45 mutant strain.

4. Conclusions

Well-performing strains are a prerequisite for industrial production. To improve the performance of glutamic-acid-producing strains, most researchers have used traditional methods, such as UV mutagenesis or chemical mutagens, to produce mutant loci in the genome of the strains, but such methods are associated with safety risks and unstable genetic traits of the strains.
In this study, two high glutamic-acid-producing strains, P17 and B58, were obtained by ARTP mutagenesis screening on the basis of 240 g/L of high-sugar and 35 g/L of malonic acid agar plates, with increases of 13.0% and 13.3%, respectively, compared to the starting strain, GL−6. However, the single mutagenized strain showed unstable genetic traits, so we used cross-iterative mutagenesis and successfully screened a high glutamic-acid-yielding strain, P−45, with an Erlenmeyer flask concentration of 17.7 g/L, which was 18.8% higher than that of the GL−6 parental strain and could be inherited stably for 10 generations. These results demonstrate that crossover iterative mutagenesis could make up for the shortcomings of a single mutagenesis and obtain mutant strains with more stable genetic traits. In addition, it was found that the upregulation of the cs, icdh, and gdh gene expression levels of P−45 by 1.3-fold, 0.2-fold, and 4-fold, respectively, and the downregulation of the odhc gene expression levels by 1.6-fold could lead to a greater flow of carbon metabolism towards glutamic acid synthesis. To meet future industrial production needs, the glutamic acid concentration was further increased to 147.0 g/L by batch replenishment, which is 81.5% higher than that of the GL−6 parental strain. In a similar study, Zheng et al. [32], using Corynebacteria glutamicum as the starting strain, conducted three rounds of genomic modification followed by UV irradiation and diethyl sulfate mutagenesis, which resulted in a high glutamic-acid-yielding mutant strain, F343, which showed a 1.8-fold increase in L-glutamate production (65.8 g/L) compared to the starting strain (35.6 g/L) at a controlled temperature of 38 °C in a 5 L fermenter. In addition, Li et al. [33] obtained a mutant strain, GTS 190, with high L-glutamic acid production by mutagenesis using protoplasts, UV irradiation, and diethyl sulfate, using Brevibacterium flavum as the starting strain, which achieved a glutamic acid yield of 195 g/L after fermentation in batch replenishment. The above studies have shown that traditional mutagenesis breeding, whose damage to cells is greater, although studied for many years, might lead to aggregated lesions. Compared to traditional mutagenesis, ARTP mutagenesis is safer and more efficient in the strain’s selection. It is simple to perform as well.
The selection strategy based on ARTP mutagenesis in this study was able to enhance the genetic stability of the strain while improving the glutamic acid production capacity of the wild-type strain, and fermentation with batch replenishment for glutamic acid production could further increase the glutamic acid concentration. The establishment of this research method can provide a reference for steadying the genetic traits and improving the metabolites of microorganisms’ production.

Author Contributions

Methodology, validation, investigation, formal analysis, writing—original draft, L.S.; methodology, investigation, formal analysis, H.Z. and Z.L.; writing—review and editing, F.A. and Q.Y.; investigation, X.Z. and S.Y.; resources, writing—review and editing, L.Y. and X.C.; conceptualization, resources, supervision, project administration, funding acquisition, writing—review and editing, J.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundations of China (Grant Nos. 31871789 and 41876114), the Open Funding Project of the State Key Laboratory of Biocatalysis and Enzyme Engineering (No. SKLBEE2018013), the Natural Science Foundation of Hubei Provincial Department of Education (No. B2016046), the Science Foundation of Donghai Laboratory (No. DH-2022KF0218), and the Natural Science Foundation of Zhejiang Province (No. LY18D060007).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All research data were presented in this paper.

Conflicts of Interest

The authors declare no conflict of interest.

Appendix A

Table A1. Initial screening results of the first round of mutagenic high-sugar-resistant mutant strains.
Table A1. Initial screening results of the first round of mutagenic high-sugar-resistant mutant strains.
NumberGlutamic Acid Concentration
(g/L)
Positive and Negative MutationsNumberGlutamic Acid Concentration
(g/L)
Positive and Negative Mutations
GL−612.7 ± 0.7CKP7812.5 ± 0.7
P115.2 ± 0.6+P7914.1 ± 0.6+
P210.8 ± 1.4P8011.7 ± 0.3
P311.8 ± 0.3P8112.2 ± 1.1
P411.5 ± 1.0P8212.0 ± 2.3
P510.1 ± 0.1P8310.7 ± 0.7
P615.3 ± 1.0+P8412.9 ± 0.4+
P714.7 ± 0.4+P8514.2 ± 0.0+
P814.9 ± 0.4+P8614.0 ± 0.0+
P915.0 ± 0.4+P8710.0 ± 0.3
P1010.1 ± 0.7P8814.1 ± 0.4+
P1112.0 ± 2.3P8910.5 ± 1.0
P1210.9 ± 1.8P9013.3 ± 0.1+
P1314.7 ± 0.7+P9113.2 ± 1.1+
P1410.0 ± 1.4P9213.0 ± 0.3
P1513.0 ± 0.3+P9313.7 ± 0.6+
P1610.3 ± 0.4P9412.2 ± 0.3
P1712.3 ± 0.7+P9513.4 ± 0.9+
P1813.9 ± 0.5+P9612.6 ± 0.1
P1914.2 ± 0.9+P9711.2 ± 0.9
P2014.9 ± 0.5+P9812.1 ± 0.1
P2112.0 ± 0.3P9910.6 ± 0.6
P2213.0 ± 0.3+P10011.9 ± 0.7
P2310.1 ± 1.3P10110.9 ± 1.8
P2411.2 ± 0.3P10212.0 ± 0.6
P2511.4 ± 0.6P10311.6 ± 0.9
P2612.7 ± 1.0/P10410.3 ± 0.6
P2715.2 ± 0.0+P10512.2 ± 0.6
P2815.6 ± 0.4+P10612.4 ± 0.3
P2914.4 ± 0.1+P10712.0 ± 0.9
P3014.2 ± 1.1+P10812.0 ± 0.3
P3114.8 ± 0.9+P10911.9 ± 2.1
P3212.4 ± 1.1P11012.0 ± 0.9
P3311.7 ± 1.0P11113.4 ± 0.3+
P3413.6 ± 0.9+P11211.6 ± 0.9
P3511.5 ± 0.7P11310.5 ± 0.7
P3611.2 ± 0.0P11412.0 ± 0.9
P3712.5 ± 0.7P11511.6 ± 0.3
P3812.4 ± 0.3P11612.5 ± 0.4
P3912.3 ± 0.1P11710.3 ± 1.0
P4013.1 ± 0.1+P11811.4 ± 0.0
P4113.6 ± 0.0P11911.5 ± 0.1
P4213.0 ± 0.6P12012.7 ± 1.0/
P4314.1 ± 0.7+P12112.5 ± 0.1
P4410.7 ± 0.4P12211.1 ± 0.4
P4510.0 ± 1.1P12310.7 ± 1.0
P4612.4 ± 0.9P12414.3 ± 0.7+
P4711.2 ± 0.3P12512.9 ± 1.1+
P4813.1 ± 1.3+P12613.2 ± 0.3+
P4910.6 ± 0.9P12711.1 ± 0.8
P5011.1 ± 1.6P12812.3 ± 0.1
P5111.8 ± 0.3P12912.7 ± 0.4/
P5213.3 ± 0.1+P13011.5 ± 1.6
P5312.5 ± 0.4P13111.8 ± 1.4
P5410.8 ± 0.9P13212.8 ± 0.0+
P5513.9 ± 1.8+P13312.6 ± 0.6
P5612.9 ± 0.4P13412.6 ± 0.6
P5711.1 ± 1.3P13513.6 ± 0.6+
P5811.4 ± 0.6P13611.9 ± 0.1
P5912.6 ± 0.9P13713.9 ± 0.1+
P6013.5 ± 0.7+P13810.7 ± 0.4
P6113.1 ± 1.0P13911.4 ± 0.9
P6212.9 ± 0.4P14010.8 ± 0.3
P6312.9 ± 1.3P14112.8 ± 0.3
P6412.4 ± 0.0P14213.8 ± 0.3+
P6514.5 ± 0.4+P14314.7 ± 0.4+
P6614.7 ± 0.4+P14410.7 ± 0.4
P6713.9 ± 0.1+P14513.1 ± 0.2+
P6811.8 ± 1.1P14611.7 ± 1.0
P6914.3 ± 0.4+P14713.0 ± 1.1+
P7012.5 ± 0.4P14813.5 ± 0.7+
P7112.1 ± 1.3P14911.0 ± 1.2
P7212.6 ± 0.0P15011.7 ± 0.4
P7313.8 ± 0.3+P15112.5 ± 0.6
P7413.7 ± 1.3+P15211.9 ± 0.2
P7512.0 ± 0.0P15311.2 ± 1.3
P7613.7 ± 0.7+P15412.8 ± 0.9+
P7711.5 ± 0.0P15513.5 ± 0.6+
Note: “+” indicates positive mutation, “−” indicates negative mutation, and “/” indicates no change.
Table A2. Primary screening results of malonic-acid-resistant mutant strains.
Table A2. Primary screening results of malonic-acid-resistant mutant strains.
NumberGlutamic Acid Concentration
(g/L)
Positive and Negative MutationsNumberGlutamic Acid Concentration
(g/L)
Positive and Negative Mutations
GL−613.3 ± 0.7CKB3613.7 ± 3.2+
B113.8 ± 0.3+B3712.6 ± 0.5
B214.7 ± 0.4+B3810.4 ± 0.8
B313.1 ± 0.4B3912.9 ± 1.0
B413.9 ± 0.4+B4013.5 ± 1.8+
B514.7 ± 0.6+B4111.1 ± 2.7
B612.7 ± 1.0B4212.6 ± 0.5
B711.6 ± 0.5B4312.5 ± 2.1
B813.1 ± 1.5B4410.7 ± 0.4
B912.8 ± 0.3B4513.2 ± 1.1
B1013.2 ± 1.1B4613.5 ± 2.1+
B1112.2 ± 0.6B4710.5 ± 0.7
B1214.6 ± 0.6+B4812.2 ± 1.1
B1313.0 ± 0.5B4913.8 ± 2.2+
B1412.6 ± 0.3B5012.7 ± 0.1
B1512.6 ± 0.6B5112.1 ± 1.3
B1610.8 ± 0.3B5213.6 ± 1.1+
B1713.8 ± 0.5+B5314.0 ± 0.57+
B1813.1 ± 0.6B5413.0 ± 0.6
B1912.0 ± 1.1B5514.4 ± 0.4+
B2012.6 ± 0.6B5614.2 ± 0.1+
B2112.8 ± 0.2B5714.8 ± 0.2+
B2213.0 ± 0.6B5815.4 ± 0.6+
B2315.0 ± 0.1+B5914.8 ± 0.2+
B2411.9 ± 0.1B6011.5 ± 0.7
B2514.4 ± 0.6+B6114.0 ± 0.8+
B2613.4 ± 0.8+B6212.8 ± 0.2
B2714.4 ± 0.8+B6312.5 ± 0.7
B2811.9 ± 1.3B6413.8 ± 1.1+
B2912.8 ± 0.2B6513.8 ± 0.3+
B3011.1 ± 2.4B6612.7 ± 0.4
B3112.8 ± 1.1B6812.8 ± 0.3
B3214.1 ± 0.4+B6914.6 ± 0.6+
B3313.5 ± 1.3+B7014.7 ± 0.7+
B3414.2 ± 2.2+B7115.2 ± 0.6+
B3513.4 ± 2.0/B7215.1 ± 1.0+
Note: “+” indicates positive mutation, “−” indicates negative mutation, and “/” indicates no change.
Table A3. Re-screening results of cross-iterative mutagenesis of high-sugar-resistant mutant strains.
Table A3. Re-screening results of cross-iterative mutagenesis of high-sugar-resistant mutant strains.
NumberGlutamic Acid Concentration
(g/L)
Positive and Negative MutationsNumberGlutamic Acid Concentration
(g/L)
Positive and Negative Mutations
GL−613.8 ± 0.6parentalP−3111.6 ± 3.7
B5815.2 ± 0.2CKP−3214.1 ± 0.7
P−114.3 ± 0.1P−3313.2 ± 0.3
P−214.4 ± 0.3P−3413.6 ± 1.4
P−316.9 ± 0.1+P−3514.8 ± 0.3
P−413.6 ± 0.6P−3611.8 ± 0.5
P−516.2 ± 0.6+P−3713.8 ± 0.6
P−616.1 ± 0.4+P−3813.5 ± 0.1
P−714.8 ± 0.3P−3913.5 ± 2.1
P−816.1 ± 0.7+P−4012.9 ± 0.4
P−915.4 ± 0.3+P−4112.6 ± 0.5
P−015.1 ± 0.2P−4211.1 ± 0.6
P−1113.2 ± 0.3P−4310.4 ± 4.8
P−1214.7 ± 0.1P−4412.1 ± 0.7
P−1315.9 ± 0.1+P−4515.3 ± 0.5+
P−1415.5 ± 0.1+P−4615.6 ± 0.2+
P−1514.2 ± 1.1P−4714.3 ± 0.4
P−1614.4 ± 0.6P−4814.0 ± 0.0
P−1715.5 ± 0.1+P−4914.8 ± 1.1
P−1814.8 ± 0.0P−5014.1 ± 0.7
P−1916.0 ± 0.0+P−5113.7 ± 0.7
P−2015.0 ± 0.9P−5213.6 ± 1.1
P−2114.8 ± 0.6P−5313.8 ± 0.3
P−2215.4 ± 0.6+P−5412.6 ± 0.9
P−2313.9 ± 0.7P−5511.2 ± 3.4
P−2415.1 ± 0.7P−5611.3 ± 4.1
P−2512.8 ± 0.3P−5712.8 ± 0.3
P−2612.2 ± 1.1P−5813.9 ± 0.6
P−2710.2 ± 2.0P−5913.4 ± 0.9
P−2814.1 ± 1.0P−6014.0 ± 0.9
P−2913.4 ± 0.9P−6115.2 ± 0.2+
P−3012.8 ± 0.3
Note: “+” indicates positive mutation, “−” indicates negative mutation, and “/” indicates no change.
Table A4. Re-screening results of crossed iterative mutagenesis of malonic-acid-resistant mutant strains.
Table A4. Re-screening results of crossed iterative mutagenesis of malonic-acid-resistant mutant strains.
NumberGlutamic Acid Concentration
(g/L)
Positive and Negative MutationsNumberGlutamic Acid Concentration
(g/L)
Positive and Negative Mutations
GL−613.7 ± 0.4parentalB−1114.1 ± 1.0 +
P1714.2 ± 1.1CKB−1215.1 ± 0.3 +
B−114.2 ± 0.5/B−1315.2 ± 0.4 +
B−213.6 ± 1.3B−1415.2 ± 0.6 +
B−315.1 ± 0.7+B−1514.2 ± 1.2 /
B−414.2 ± 0.5/B−1613.5 ± 1.3
B−514.0 ± 0.7+B−1712.6 ± 0.5
B−613.5 ± 0.3B−1812.6 ± 0.4
B−713.5 ± 1.9B−1913.6 ± 0.5
B−815.7 ± 0.8+B−2012.9 ± 2.4
B−913.6 ± 0.9B−2112.1 ± 1.0
B−1013.9 ± 0.5+B−2213.0 ± 1.0
Note: “+” indicates positive mutation, “−” indicates negative mutation, and “/” indicates no change.

References

  1. Sano, C. History of glutamate production. Am. J. Clin. Nutr. 2009, 90, 728S–732S. [Google Scholar] [CrossRef] [Scilit]
  2. Vikramachakravarthi, D.; Kumar, R.; Pal, P. Production of L (+) Glutamic Acid in a Fully Membrane-Integrated Hybrid Reactor System: Direct and Continuous Production under Non-Neutralizing Conditions. Ind. Eng. Chem. Res. 2014, 53, 19019–19027. [Google Scholar] [CrossRef] [Scilit]
  3. Kanakdande, A.P.; Khobragade, C.N.; Sakharam Mane, R. Ultraviolet induced random mutagenesis in Bacillus amyloliquefaciens (MF 510169) for improving biodiesel production. Fuel 2021, 304, 121380. [Google Scholar] [CrossRef] [Scilit]
  4. Liu, Y.; Xu, Y.; Wang, D.; Jiang, W. Selection of Zygosaccharomyces rouxii strains resistant to cadmium with improved removal abilities through ultraviolet-diethyl sulfate cooperative mutagenesis. Environ. Sci. Pollut. Res. 2017, 24, 18630–18639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Huang, D.; Song, Y.; Liu, Y.; Qin, Y. A new strain of Aspergillus tubingensis for high-activity pectinase production. Braz. J. Microbiol. 2019, 50, 53–65. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Zhang, X.; Zhang, X.; Xu, G.; Zhang, X.; Shi, J.; Xu, Z. Integration of ARTP mutagenesis with biosensor-mediated high-throughput screening to improve l-serine yield in Corynebacterium glutamicum. Appl. Microbiol. Biotechnol. 2018, 102, 5939–5951. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Fang, M.; Jin, L.; Zhang, C.; Tan, Y.; Jiang, P.; Ge, N.; Heping, L.; Xing, X. Rapid mutation of Spirulina platensis by a new mutagenesis system of atmospheric and room temperature plasmas (ARTP) and generation of a mutant library with diverse phenotypes. PLoS ONE 2013, 8, e77046. [Google Scholar] [CrossRef] [Scilit]
  8. An, J.; Gao, F.; Ma, Q.; Xiang, Y.; Ren, D.; Lu, J. Screening for enhanced astaxanthin accumulation among Spirulina platensis mutants generated by atmospheric and room temperature plasmas. Algal Res. 2017, 25, 464–472. [Google Scholar] [CrossRef] [Scilit]
  9. Ma, X.; Zhang, H.; Lu, X.; Han, J.; Zhu, H.; Wang, H.; Yao, R. Mutant breeding of Starmerella bombicola by atmospheric and room-temperature plasma (ARTP) for improved production of specific or total sophorolipids. Bioprocess Biosyst. Eng. 2020, 43, 1869–1883. [Google Scholar] [CrossRef] [Scilit]
  10. Hou, J.L.; Zhang, X.Y.; Wang, G.X.; Sun, Z.H.; Du, W.; Zhao, Y.X.; Si, F.; Wang, L.Y.; Xing, X.H.; Wang, Y.F. Novel breeding approach for Japanese flounder using atmosphere and room temperature plasma mutagenesis tool. BMC Genom. 2019, 20, 323. [Google Scholar]
  11. Liu, B.; Sun, Z.; Ma, X.; Yang, B.; Jiang, Y.; Wei, D.; Chen, F. Mutation Breeding of Extracellular Polysaccharide-Producing Microalga Crypthecodinium cohnii by a Novel Mutagenesis with Atmospheric and Room Temperature Plasma. Int. J. Mol. Sci. 2015, 16, 8201–8212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Cui, L.Y.; Wang, S.S.; Guan, C.G.; Liang, W.F.; Xue, Z.L.; Zhang, C.; Xing, X.H. Breeding of Methanol-Tolerant Methylobacterium extorquens AM1 by Atmospheric and Room Temperature Plasma Mutagenesis Combined With Adaptive Laboratory Evolution. Biotechnol. J. 2018, 13, e1700679. [Google Scholar] [CrossRef] [Scilit]
  13. Hu, Z.C.; Li, W.J.; Zou, S.P.; Niu, K.; Zheng, Y.G. Mutagenesis of echinocandin B overproducing Aspergillus nidulans capable of using starch as main carbon source. Prep. Biochem. Biotechnol. 2020, 50, 745–752. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Jiang, Y.; Shang, Y.; Li, H.; Zhang, C.; Pan, J.; Bai, Y.; Li, C.; Xu, J. Enhancing transglutaminase production of Streptomyces mobaraensis by iterative mutagenesis breeding with atmospheric and room-temperature plasma (ARTP). Bioresour. Bioprocess. 2017, 4, 37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Ottenheim, C.; Nawrath, M.; Wu, J.C. Microbial mutagenesis by atmospheric and room-temperature plasma (ARTP): The latest development. Bioresour. Bioprocess. 2018, 5, 12. [Google Scholar] [CrossRef] [Scilit]
  16. Shi, F.; Tan, J.; Chu, J.; Wang, Y.; Zhuang, Y.; Zhang, S. A qualitative and quantitative high-throughput assay for screening of gluconate high-yield strains by Aspergillus niger. J. Microbiol. Methods 2015, 109, 134–139. [Google Scholar] [CrossRef] [Scilit]
  17. Tan, Y.; Fang, M.; Jin, L.; Zhang, C.; Li, H.; Xing, X. Culture characteristics of the atmospheric and room temperature plasma-mutated Spirulina platensis mutants in CO2 aeration culture system for biomass production. J. Biosci. Bioeng. 2015, 120, 438–443. [Google Scholar] [CrossRef] [Scilit]
  18. Yu, Z.; Shen, X.; Wu, Y.; Yang, S.; Ju, D.; Chen, S. Enhancement of ascomycin production via a combination of atmospheric and room temperature plasma mutagenesis in Streptomyces hygroscopicus and medium optimization. AMB Express 2019, 9, 25. [Google Scholar] [CrossRef] [Scilit]
  19. Zhang, C.; Qin, J.; Dai, Y.; Mu, W.; Zhang, T. Atmospheric and room temperature plasma (ARTP) mutagenesis enables xylitol over-production with yeast Candida tropicalis. J. Biotechnol. 2019, 296, 7–13. [Google Scholar] [CrossRef] [Scilit]
  20. Chen, C.; Cui, Z.; Zhao, J.; Li, S.; Ren, X.; Chen, T.; Wang, Z. Improving diacetyl production in Corynebacterium glutamicum via modifying respiratory chain. J. Biotechnol. 2021, 332, 20–28. [Google Scholar] [CrossRef] [Scilit]
  21. Bott, M.; Niebisch, A. The respiratory chain of Corynebacterium glutamicum. J. Biotechnol. 2003, 104, 129–153. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Wang, L.; Chen, X.; Wu, G.; Li, S.; Zeng, X.; Ren, X.; Tang, L.; Mao, Z. Improved ε-poly-l-lysine production of Streptomyces sp. FEEL-1 by atmospheric and room temperature plasma mutagenesis and streptomycin resistance screening. Ann. Microbiol. 2015, 65, 2009–2017. [Google Scholar] [CrossRef] [Scilit]
  23. Gu, L.; Tan, M.; Li, S.; Zhang, T.; Zhang, Q.; Li, C.; Luo, X.; Feng, J.; Zhao, S. ARTP/EMS-combined multiple mutagenesis efficiently improved production of raw starch-degrading enzymes in Penicillium oxalicum and characterization of the enzyme-hyperproducing mutant. Biotechnol. Biofuels 2020, 13, 187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Lu, H.; Shangguan, L.; Xia, H.; Song, Q.; Li, P.; Li, K.; Chen, S.; Dai, J. Enzymolysis of fermented corn flour to prepare natural umami flavoring. Chin. Sci. Technol. Food Ind. 2022, 43, 158–166. [Google Scholar]
  25. Zhang, C.; Li, Y.; Zhu, F.; Li, Z.; Lu, N.; Li, Y.; Xu, Q.; Chen, N. Metabolic engineering of an auto-regulated Corynebacterium glutamicum chassis for biosynthesis of 5-aminolevulinic acid. Bioresour. Technol. 2020, 318, 124064. [Google Scholar] [CrossRef] [Scilit]
  26. Jin, C.; Huang, Z.; Bao, J. High-Titer Glutamic Acid Production from Lignocellulose Using an Engineered Corynebacterium glutamicum with Simultaneous Co-utilization of Xylose and Glucose. ACS Sustain. Chem. Eng. 2020, 8, 6315–6322. [Google Scholar] [CrossRef] [Scilit]
  27. Han, X.; Li, L.; Bao, J. Microbial extraction of biotin from lignocellulose biomass and its application on glutamic acid production. Bioresour. Technol. 2019, 288, 121523. [Google Scholar] [CrossRef] [Scilit]
  28. Zheng, S.; Jiang, B.; Zhang, T.; Chen, J. Combined mutagenesis and metabolic regulation to enhance D-arabitol production from Candida parapsilosis. J. Ind. Microbiol. Biotechnol. 2020, 47, 425–435. [Google Scholar] [CrossRef] [Scilit]
  29. Varela, C.; Agosin, E.; Baez, M.; Klapa, M.; Stephanopoulos, G. Metabolic flux redistribution in Corynebacterium glutamicum in response to osmotic stress. Appl. Microbiol. Biotechnol. 2003, 60, 547–555. [Google Scholar] [CrossRef] [Scilit]
  30. Kawahara, Y.; Takahashi-Fuke, K.; Shimizu, E.; Nakamatsu, T.; Nakamori, S. Relationship between the glutamate production and the activity of 2-oxoglutarate dehydrogenase in Brevibacterium lactofermentum. Biosci. Biotechnol. Biochem. 1997, 61, 1109–1112. [Google Scholar] [CrossRef] [Scilit]
  31. Liu, X. Effects of proteases on L-glutamic acid fermentation. Bioengineered 2019, 10, 646–658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Zheng, P.; Liu, M.; Liu, X.; Du, Q.; Ni, Y.; Sun, Z. Genome shuffling improves thermotolerance and glutamic acid production of Corynebacteria glutamicum. World J. Microbiol. Biotechnol. 2012, 28, 1035–1043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Li, Z.H.; Chen, N. Study on the Directional Breeding of High Glutamic-Acid Production Strain GTS190 and the Control on its Fermentation. Adv. Mater. Res. 2012, 573–574, 1029–1033. [Google Scholar] [CrossRef] [Scilit]
Figure 1. ARTP mutagenesis selection process.
Figure 1. ARTP mutagenesis selection process.
Fermentation 09 00599 g001
Figure 2. Effect of treatment time on lethality and positive mutation rate.
Figure 2. Effect of treatment time on lethality and positive mutation rate.
Fermentation 09 00599 g002
Figure 3. Selection of high-sugar-tolerant strains: (a) Growth of the GL−6 glucose gradient concentration plates; (b) results of initial screening of high-sugar-tolerant strains; (c) results of re-screening of high-sugar-tolerant strains. Error bars represent means ± SD of biological replicates.
Figure 3. Selection of high-sugar-tolerant strains: (a) Growth of the GL−6 glucose gradient concentration plates; (b) results of initial screening of high-sugar-tolerant strains; (c) results of re-screening of high-sugar-tolerant strains. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g003
Figure 4. Selection and breeding of malonic acid-resistant strains: (a) Growth of the GL−6 in malonic acid gradient plates; (b) results of the initial screening of malonic acid strains; (c) results of the re-screening of malonic acid-resistant strains. Error bars represent means ± SD of biological replicates.
Figure 4. Selection and breeding of malonic acid-resistant strains: (a) Growth of the GL−6 in malonic acid gradient plates; (b) results of the initial screening of malonic acid strains; (c) results of the re-screening of malonic acid-resistant strains. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g004
Figure 5. Genetic stability validation of high-sugar-tolerant strains: (a) Genetic stability of P17; (b) genetic stability of the B58. Error bars represent means ± SD of biological replicates.
Figure 5. Genetic stability validation of high-sugar-tolerant strains: (a) Genetic stability of P17; (b) genetic stability of the B58. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g005
Figure 6. Screening results of iterative mutagenic high-glucose-tolerant strains: (a) Initial screening results of iterative mutagenic high-glucose-resistant strains; (b) re-screening results of iterative mutagenic high-glucose-resistant strains. Error bars represent means ± SD of biological replicates.
Figure 6. Screening results of iterative mutagenic high-glucose-tolerant strains: (a) Initial screening results of iterative mutagenic high-glucose-resistant strains; (b) re-screening results of iterative mutagenic high-glucose-resistant strains. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g006
Figure 7. Screening results of iterative mutagenesis of malonic-acid-resistant strains: (a) Screening results of iterative mutagenesis of malonic-acid-resistant strains; (b) screening results of iterative mutagenesis of malonic-acid-resistant strains. Error bars represent means ± SD of biological replicates.
Figure 7. Screening results of iterative mutagenesis of malonic-acid-resistant strains: (a) Screening results of iterative mutagenesis of malonic-acid-resistant strains; (b) screening results of iterative mutagenesis of malonic-acid-resistant strains. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g007
Figure 8. Genetic stability validation of mutant strains: (a) Genetic stability results for P−45; (b) genetic stability results for B−13. Error bars represent means ± SD of biological replicates.
Figure 8. Genetic stability validation of mutant strains: (a) Genetic stability results for P−45; (b) genetic stability results for B−13. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g008
Figure 9. (A) Metabolic pathway of P−45, and (B) expression levels of key genes of the GL−6 and P−45 strains: (a) cs gene; (b) icdh gene; (c) gdh gene; (d) odhc gene. * p < 0.05; ** p < 0.01; ns., not significant, by unpaired two-tailed t test. Error bars represent means ± SD of biological replicates.
Figure 9. (A) Metabolic pathway of P−45, and (B) expression levels of key genes of the GL−6 and P−45 strains: (a) cs gene; (b) icdh gene; (c) gdh gene; (d) odhc gene. * p < 0.05; ** p < 0.01; ns., not significant, by unpaired two-tailed t test. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g009
Figure 10. Fermentation results of the P−45 mutant strain and departure of the GL−6 parental strain in Erlenmeyer flasks. Error bars represent means ± SD of biological replicates.
Figure 10. Fermentation results of the P−45 mutant strain and departure of the GL−6 parental strain in Erlenmeyer flasks. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g010
Figure 11. Results of fermentation of the P−45 mutant strain with the starting GL−6 parental strain in batch replenishment. Error bars represent means ± SD of biological replicates.
Figure 11. Results of fermentation of the P−45 mutant strain with the starting GL−6 parental strain in batch replenishment. Error bars represent means ± SD of biological replicates.
Fermentation 09 00599 g011
Table 1. ARTP mutagenesis selection conditions.
Table 1. ARTP mutagenesis selection conditions.
ParametersOperating Conditions
Radio frequency power input/W120
Illumination distance/mm2
aeration rate L/min10
Mutagenesis treatment time/s20, 40, 60, 80, 100, 120, 140, 160, 180, 200
Sample size10 μL (OD600 nm 0.6~0.8)
Table 2. Primers used in this study.
Table 2. Primers used in this study.
PrimersSequences (5′–3′)Uses
CS-FTGATTTCCCTCATCCACTCCCitrate synthetase
CS-RCAGGTTGTGTCCAATGCTTC
ICDH-FGTCTTTTTCCTCGTCGGTGGIsocitrate dehydrogenase
ICDH-RACATCTCCGCTTCTGTTCCA
GDH-FTCCTTGATTTCGCGGAGCTTGlutamate dehydrogenase
GDH-RCGCGATTGAAAAGGCTCAGG
ODHC-FCTTCTTAGCAACGGGAGCCAKetoglutarate dehydrogenasecomplex
ODHC-RCGGCCTTGAGACCAACATCT
16sRNA-FGTAGGGTGCGAGCGTTGTCCreference genes
16sRNA-RCGCCATTGGTGTTCCTCCTG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Shangguan, L.; Zhang, H.; Liu, Z.; An, F.; Yang, Q.; Zhang, X.; Yao, L.; Yang, S.; Dai, J.; Chen, X. Improved Glutamic Acid Production Capacity of Corynebacterium glutamicum by the ARTP Mutagenesis Method. Fermentation 2023, 9, 599. https://doi.org/10.3390/fermentation9070599

AMA Style

Shangguan L, Zhang H, Liu Z, An F, Yang Q, Zhang X, Yao L, Yang S, Dai J, Chen X. Improved Glutamic Acid Production Capacity of Corynebacterium glutamicum by the ARTP Mutagenesis Method. Fermentation. 2023; 9(7):599. https://doi.org/10.3390/fermentation9070599

Chicago/Turabian Style

Shangguan, Lingling, Huiyan Zhang, Zixiong Liu, Feiran An, Qiao Yang, Xiaoling Zhang, Lan Yao, Shihui Yang, Jun Dai, and Xiong Chen. 2023. "Improved Glutamic Acid Production Capacity of Corynebacterium glutamicum by the ARTP Mutagenesis Method" Fermentation 9, no. 7: 599. https://doi.org/10.3390/fermentation9070599

APA Style

Shangguan, L., Zhang, H., Liu, Z., An, F., Yang, Q., Zhang, X., Yao, L., Yang, S., Dai, J., & Chen, X. (2023). Improved Glutamic Acid Production Capacity of Corynebacterium glutamicum by the ARTP Mutagenesis Method. Fermentation, 9(7), 599. https://doi.org/10.3390/fermentation9070599

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop