Development of a Taxon-Specific Real-Time Polymerase Chain Reaction Method to Detect Trichoderma reesei Contaminations in Fermentation Products
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Development and Validation of the Real-Time PCR TR Method
2.2.1. Specificity Evaluation
2.2.2. Sensitivity Evaluation
2.2.3. Applicability Evaluation
3. Results and Discussion
3.1. Development of the Real-Time PCR TR Method
3.2. Specificity Assessment of the Real-Time PCR TR Method
3.3. Sensitivity Assessment of the Real-Time PCR TR Method
3.4. Applicability Assessment of the Real-Time PCR TR Method
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Raveendran, S.; Parameswaran, B.; Ummalyma, S.B.; Abraham, A.; Mathew, A.K.; Madhavan, A.; Rebello, S.; Pandey, A.; Biotechnology, J.R.G.C.F. Applications of Microbial Enzymes in Food Industry. Food Technol. Biotechnol. 2018, 56, 16–30. [Google Scholar] [CrossRef]
- Deckers, M.; Deforce, D.; Fraiture, M.-A.; Roosens, N.H. Genetically Modified Micro-Organisms for Industrial Food Enzyme Production: An Overview. Foods 2020, 9, 326. [Google Scholar] [CrossRef]
- Deckers, M.; Van Braekel, J.; Vanneste, K.; Deforce, D.; Fraiture, M.A.; Roosens, N.H.C. Food Enzyme Database (FEDA): A Web Application Gathering Information about Food Enzyme Preparations Available on the European Market. Database 2021, 2021, 1–7. [Google Scholar] [CrossRef]
- Lübeck, M.; Lübeck, P.S. Fungal Cell Factories for Efficient and Sustainable Production of Proteins and Peptides. Microorganisms 2022, 10, 753. [Google Scholar] [CrossRef]
- El-Gendi, H.; Saleh, A.K.; Badierah, R.; Redwan, E.M.; El-Maradny, Y.A.; El-Fakharany, E.M. A Comprehensive Insight into Fungal Enzymes: Structure, Classification, and Their Role in Mankind’s Challenges. J. Fungi 2021, 8, 23. [Google Scholar] [CrossRef] [PubMed]
- Iram, A.; Ozcan, A.; Turhan, I.; Demirci, A. Production of Value-Added Products as Food Ingredients via Microbial Fermentation. Processes 2023, 11, 1715. [Google Scholar] [CrossRef]
- Liu, X.; Ding, W.; Jiang, H. Engineering microbial cell factories for the production of plant natural products: From design principles to industrial-scale production. Microb. Cell Factories 2017, 16, 1–9. [Google Scholar] [CrossRef]
- Navarrete, C.; Jacobsen, I.H.; Martínez, J.L.; Procentese, A. Cell Factories for Industrial Production Processes: Current Issues and Emerging Solutions. Processes 2020, 8, 768. [Google Scholar] [CrossRef]
- Hussain, M.H.; Mohsin, M.Z.; Zaman, W.Q.; Yu, J.; Zhao, X.; Wei, Y.; Zhuang, Y.; Mohsin, A.; Guo, M. Multiscale engineering of microbial cell factories: A step forward towards sustainable natural products industry. Synth. Syst. Biotechnol. 2022, 7, 586–601. [Google Scholar] [CrossRef] [PubMed]
- Salazar-Cerezo, S.; de Vries, R.P.; Garrigues, S. Strategies for the Development of Industrial Fungal Producing Strains. J. Fungi 2023, 9, 834. [Google Scholar] [CrossRef] [PubMed]
- Boukid, F.; Ganeshan, S.; Wang, Y.; Tülbek, M.; Nickerson, M.T. Bioengineered Enzymes and Precision Fermentation in the Food Industry. Int. J. Mol. Sci. 2023, 24, 10156. [Google Scholar] [CrossRef] [PubMed]
- Bischof, R.H.; Ramoni, J.; Seiboth, B. Cellulases and beyond: The first 70 years of the enzyme producer Trichoderma reesei. Microb. Cell Factories 2016, 15, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Barbau-Piednoir, E.; De Keersmaecker, S.C.J.; Delvoye, M.; Gau, C.; Philipp, P.; Roosens, N.H. Use of next generation sequencing data to develop a qPCR method for specific detection of EU-unauthorized genetically modified Bacillus subtilis overproducing riboflavin. BMC Biotechnol. 2015, 15, 103. [Google Scholar] [CrossRef]
- Barbau-Piednoir, E.; De Keersmaecker, S.C.J.; Wuyts, V.; Gau, C.; Pirovano, W.; Costessi, A.; Philipp, P.; Roosens, N.H. Genome Sequence of EU-Unauthorized Genetically Modified Bacillus subtilis Strain 2014-3557 Overproducing Riboflavin, Isolated from a Vitamin B2 80% Feed Additive. Genome Announc. 2015, 3, e00214-15. [Google Scholar] [CrossRef]
- Fraiture, M.-A.; Bogaerts, B.; Winand, R.; Deckers, M.; Papazova, N.; Vanneste, K.; De Keersmaecker, S.C.J.; Roosens, N.H.C. Identification of an unauthorized genetically modified bacteria in food enzyme through whole-genome sequencing. Sci. Rep. 2020, 10, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Fraiture, M.-A.; Deckers, M.; Papazova, N.; Roosens, N.H. Detection strategy targeting a chloramphenicol resistance gene from genetically modified bacteria in food and feed products. Food Control. 2019, 108, 106873. [Google Scholar] [CrossRef]
- Fraiture, M.-A.; Deckers, M.; Papazova, N.; Roosens, N.H. Are antimicrobial resistance genes key targets to detect genetically modified microorganisms in fermentation products? Int. J. Food Microbiol. 2020, 331, 108749. [Google Scholar] [CrossRef]
- Fraiture, M.-A.; Deckers, M.; Papazova, N.; Roosens, N.H.C. Strategy to Detect Genetically Modified Bacteria Carrying Tetracycline Resistance Gene in Fermentation Products. Food Anal. Methods 2020, 13, 1929–1937. [Google Scholar] [CrossRef]
- Fraiture, M.-A.; Papazova, N.; Roosens, N.H. DNA walking strategy to identify unauthorized genetically modified bacteria in microbial fermentation products. Int. J. Food Microbiol. 2020, 337, 108913. [Google Scholar] [CrossRef]
- Fraiture, M.-A.; Gobbo, A.; Marchesi, U.; Verginelli, D.; Papazova, N.; Roosens, N.H. Development of a real-time PCR marker targeting a new unauthorized genetically modified microorganism producing protease identified by DNA walking. Int. J. Food Microbiol. 2021, 354, 109330. [Google Scholar] [CrossRef] [PubMed]
- Fraiture, M.-A.; Marchesi, U.; Verginelli, D.; Papazova, N.; Roosens, N.H.C. Development of a Real-time PCR Method Targeting an Unauthorized Genetically Modified Microorganism Producing Alpha-Amylase. Food Anal. Methods 2021, 14, 2211–2220. [Google Scholar] [CrossRef]
- Fraiture, M.A.; Gobbo, A.; Papazova, N.; Roosens, N.H.C. Development of a Taxon-Specific Real-Time PCR Method Targeting the Bacillus Subtilis Group to Strengthen the Control of Genetically Modified Bacteria in Fermentation Products. Fermentation 2022, 8, 78. [Google Scholar] [CrossRef]
- Jordan, K.; McAuliffe, O. Listeria Monocytogenes in Foods. In Advances in Food and Nutrition Research; Elsevier: Amsterdam, The Netherlands, 2018; Volume 86, pp. 181–213. ISBN 9780128139776. [Google Scholar]
- Nadeem, S.F.; Gohar, U.F.; Tahir, S.F.; Mukhtar, H.; Pornpukdeewattana, S.; Nukthamna, P.; Ali, A.M.M.; Bavisetty, S.C.B.; Massa, S. Antimicrobial resistance: More than 70 years of war between humans and bacteria. Crit. Rev. Microbiol. 2020, 46, 578–599. [Google Scholar] [CrossRef]
- von Wintersdorff, C.J.H.; Penders, J.; Van Niekerk, J.M.; Mills, N.D.; Majumder, S.; Van Alphen, L.B.; Savelkoul, P.H.M.; Wolffs, P.F.G. Dissemination of Antimicrobial Resistance in Microbial Ecosystems through Horizontal Gene Transfer. Front. Microbiol. 2016, 7, 173. [Google Scholar] [CrossRef]
- von Wright, A.; Bruce, Å. 7. Genetically modified microorganisms and their potential effects on human health and nutrition. Trends Food Sci. Technol. 2003, 14, 264–276. [Google Scholar] [CrossRef]
- Tóth, A.G.; Csabai, I.; Krikó, E.; Tőzsér, D.; Maróti, G.; Patai, Á.V.; Makrai, L.; Szita, G.; Solymosi, N. Antimicrobial resistance genes in raw milk for human consumption. Sci. Rep. 2020, 10, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Vinayamohan, P.G.; Pellissery, A.J.; Venkitanarayanan, K. Role of horizontal gene transfer in the dissemination of antimicrobial resistance in food animal production. Curr. Opin. Food Sci. 2022, 47. [Google Scholar] [CrossRef]
- Dimitriu, T. Evolution of horizontal transmission in antimicrobial resistance plasmids. Microbiology 2022, 168, 001214. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Thomsen, L.E.; Olsen, J.E. Antimicrobial-induced horizontal transfer of antimicrobial resistance genes in bacteria: A mini-review. J. Antimicrob. Chemother. 2021, 77, 556–567. [Google Scholar] [CrossRef]
- Jian, Z.; Zeng, L.; Xu, T.; Sun, S.; Yan, S.; Yang, L.; Huang, Y.; Jia, J.; Dou, T. Antibiotic resistance genes in bacteria: Occurrence, spread, and control. J. Basic Microbiol. 2021, 61, 1049–1070. [Google Scholar] [CrossRef]
- Michaelis, C.; Grohmann, E. Horizontal Gene Transfer of Antibiotic Resistance Genes in Biofilms. Antibiotics 2023, 12, 328. [Google Scholar] [CrossRef] [PubMed]
- Samtiya, M.; Matthews, K.R.; Dhewa, T.; Puniya, A.K. Antimicrobial Resistance in the Food Chain: Trends, Mechanisms, Pathways, and Possible Regulation Strategies. Foods 2022, 11, 2966. [Google Scholar] [CrossRef]
- Paloheimo, M.; Haarmann, T.; Mäkinen, S.; Vehmaanperä, J. Production of Industrial Enzymes in Trichoderma Reesei. In Gene Expression Systems in Fungi: Advancements and Applications; Schmoll, M., Dattenböck, C., Eds.; Fungal Biology; Springer International Publishing: Cham, Switzerland, 2016; pp. 23–57. ISBN 978-3-319-27949-7. [Google Scholar]
- Fischer, A.J.; Maiyuran, S.; Yaver, D.S. Industrial Relevance of Trichoderma Reesei as an Enzyme Producer. In Trichoderma Reesei; Mach-Aigner, A.R., Martzy, R., Eds.; Methods in Molecular Biology; Springer: New York, NY, USA, 2021; Volume 2234, pp. 23–43. ISBN 978-1-07-161047-3. [Google Scholar]
- Marchesi, U.; Mazzara, M.; Broll, H.; Giacomo, M.D.; Grohmann, L.; Herau, V.; Holst-Jensen, A.; Hougs, L.; Hübert, P.; Laurensse, E.; et al. European Network of GMO Laboratories (ENGL)—Definition of Minimum Perfor-mance Requirements for Analytical Methods of GMO Testing. JRC Rep. 2015, JRC95544. [Google Scholar] [CrossRef]
- Saroj, D.B.; Dengeti, S.N.; Aher, S.; Gupta, A.K. A rapid, one step molecular identification of Trichoderma citrinoviride and Trichoderma reesei. World J. Microbiol. Biotechnol. 2015, 31, 995–999. [Google Scholar] [CrossRef]
- Lücking, R.; Aime, M.C.; Robbertse, B.; Miller, A.N.; Ariyawansa, H.A.; Aoki, T.; Cardinali, G.; Crous, P.W.; Druzhinina, I.S.; Geiser, D.M.; et al. Unambiguous identification of fungi: Where do we stand and how accurate and precise is fungal DNA barcoding? IMA Fungus 2020, 11, 1–32. [Google Scholar] [CrossRef]
- Hinterdobler, W.; Li, G.; Spiegel, K.; Basyouni-Khamis, S.; Gorfer, M.; Schmoll, M. Trichoderma reesei Isolated From Austrian Soil With High Potential for Biotechnological Application. Front. Microbiol. 2021, 12. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef] [PubMed]
- Vanneste, K.; Garlant, L.; Broeders, S.; Van Gucht, S.; Roosens, N.H. Application of whole genome data for in silico evaluation of primers and probes routinely employed for the detection of viral species by RT-qPCR using dengue virus as a case study. BMC Bioinform. 2018, 19, 312. [Google Scholar] [CrossRef] [PubMed]
- Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef]
- Grohmann, L.; Broll, H.; Dagand, E.; Hildebrandt, S.; Hübert, P.; Kiesecker, H.; Lieske, K.; Mäde, D.; Mankertz, J.; Reiting, R.; et al. Guidelines for the Validation of Qualitative Real-Time PCR Methods by Means of a Collabora-tive Study. Tech. Rep. 2016, BVL1. [Google Scholar]
- Uhlig, S.; Frost, K.; Colson, B.; Simon, K.; Mäde, D.; Reiting, R.; Gowik, P.; Grohmann, L. Validation of qualitative PCR methods on the basis of mathematical-statistical modelling of the probability of detection. Accredit. Qual. Assur. 2015, 20, 75–83. [Google Scholar] [CrossRef]
- Wehling, P.; A LaBudde, R.; Brunelle, S.L.; Nelson, M.T. Probability of Detection (POD) as a Statistical Model for the Validation of Qualitative Methods. J. AOAC Int. 2011, 94, 335–347. [Google Scholar] [CrossRef] [PubMed]
- Deckers, M.; De Loose, M.; Papazova, N.; Deforce, D.; Fraiture, M.-A.; Roosens, N.H. First monitoring for unauthorized genetically modified bacteria in food enzymes from the food market. Food Control. 2021, 135, 108665. [Google Scholar] [CrossRef]
- D’aes, J.; Fraiture, M.A.; Bogaerts, B.; De Keersmaecker, S.C.J.; Roosens, N.H.C.; Vanneste, K. Characterization of Genetically Modified Microorganisms Using Short- and Long-Read Whole-Genome Sequencing Reveals Con-taminations of Related Origin in Multiple Commercial Food Enzyme Products. Foods 2021, 10, 2637. [Google Scholar] [CrossRef] [PubMed]
- D’aes, J.; Fraiture, M.-A.; Bogaerts, B.; De Keersmaecker, S.C.J.; Roosens, N.H.C.J.; Vanneste, K. Metagenomic Characterization of Multiple Genetically Modified Bacillus Contaminations in Commercial Microbial Fermentation Products. Life 2022, 12, 1971. [Google Scholar] [CrossRef]
- Paracchini, V.; Petrillo, M.; Reiting, R.; Angers-Loustau, A.; Wahler, D.; Stolz, A.; Schönig, B.; Matthies, A.; Bendiek, J.; Meinel, D.M.; et al. Molecular characterization of an unauthorized genetically modified Bacillus subtilis production strain identified in a vitamin B 2 feed additive. Food Chem. 2017, 230, 681–689. [Google Scholar] [CrossRef]
- Zhang, R.; Yang, T.; Zhang, Q.; Liu, D.; Elhadidy, M.; Ding, T. Whole-genome sequencing: A perspective on sensing bacterial risk for food safety. Curr. Opin. Food Sci. 2022, 47. [Google Scholar] [CrossRef]
- Hadi, J.; Rapp, D.; Dhawan, S.; Gupta, S.K.; Gupta, T.B.; Brightwell, G. Molecular detection and characterization of foodborne bacteria: Recent progresses and remaining challenges. Compr. Rev. Food Sci. Food Saf. 2023, 22, 2433–2464. [Google Scholar] [CrossRef]
- Salem-Bango, Z.; Price, T.K.; Chan, J.L.; Chandrasekaran, S.; Garner, O.B.; Yang, S. Fungal Whole-Genome Sequencing for Species Identification: From Test Development to Clinical Utilization. J. Fungi 2023, 9, 183. [Google Scholar] [CrossRef]
- Jagadeesan, B.; Gerner-Smidt, P.; Allard, M.W.; Leuillet, S.; Winkler, A.; Xiao, Y.; Chaffron, S.; Van Der Vossen, J.; Tang, S.; Katase, M.; et al. The use of next generation sequencing for improving food safety: Translation into practice. Food Microbiol. 2018, 79, 96–115. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Ren, M.; Zhang, P.; Jiang, D.; Yao, X.; Luo, Y.; Yang, Z.; Wang, Y. Application of Nanopore Sequencing in the Detection of Foodborne Microorganisms. Nanomaterials 2022, 12, 1534. [Google Scholar] [CrossRef] [PubMed]
- Kobus, R.; Abuín, J.M.; Müller, A.; Hellmann, S.L.; Pichel, J.C.; Pena, T.F.; Hildebrandt, A.; Hankeln, T.; Schmidt, B. A big data approach to metagenomics for all-food-sequencing. BMC Bioinform. 2020, 21, 1–15. [Google Scholar] [CrossRef]
- Banerjee, G.; Agarwal, S.; Marshall, A.; Jones, D.H.; Sulaiman, I.M.; Sur, S.; Banerjee, P. Application of advanced genomic tools in food safety rapid diagnostics: Challenges and opportunities. Curr. Opin. Food Sci. 2022, 47, 100886. [Google Scholar] [CrossRef]
- Imanian, B.; Donaghy, J.; Jackson, T.; Gummalla, S.; Ganesan, B.; Baker, R.C.; Henderson, M.; Butler, E.K.; Hong, Y.; Ring, B.; et al. The power, potential, benefits, and challenges of implementing high-throughput sequencing in food safety systems. NPJ Sci. Food 2022, 6, 1–6. [Google Scholar] [CrossRef]
- Billington, C.; Kingsbury, J.M.; Rivas, L. Metagenomics Approaches for Improving Food Safety: A Review. J. Food Prot. 2022, 85, 448–464. [Google Scholar] [CrossRef] [PubMed]
- Akaçin, I.; Ersoy, Ş.; Doluca, O.; Güngörmüşler, M. Comparing the significance of the utilization of next generation and third generation sequencing technologies in microbial metagenomics. Microbiol. Res. 2022, 264, 127154. [Google Scholar] [CrossRef]
- Debode, F.; Hulin, J.; Charloteaux, B.; Coppieters, W.; Hanikenne, M.; Karim, L.; Berben, G. Detection and identification of transgenic events by next generation sequencing combined with enrichment technologies. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef]
- Volpicella, M.; Leoni, C.; Costanza, A.; Fanizza, I.; Placido, A.; Ceci, L.R. Genome Walking by Next Generation Sequencing Approaches. Biology 2012, 1, 495–507. [Google Scholar] [CrossRef]
- Hess, J.; Kohl, T.; Kotrová, M.; Rönsch, K.; Paprotka, T.; Mohr, V.; Hutzenlaub, T.; Brüggemann, M.; Zengerle, R.; Niemann, S.; et al. Library preparation for next generation sequencing: A review of automation strategies. Biotechnol. Adv. 2020, 41, 107537. [Google Scholar] [CrossRef]
- Pei, X.M.; Yeung, M.H.Y.; Wong, A.N.N.; Tsang, H.F.; Yu, A.C.S.; Yim, A.K.Y.; Wong, S.C.C. Targeted Sequencing Approach and Its Clinical Applications for the Molecular Diagnosis of Human Diseases. Cells 2023, 12, 493. [Google Scholar] [CrossRef] [PubMed]
- Satam, H.; Joshi, K.; Mangrolia, U.; Waghoo, S.; Zaidi, G.; Rawool, S.; Thakare, R.P.; Banday, S.; Mishra, A.K.; Das, G.; et al. Next-Generation Sequencing Technology: Current Trends and Advancements. Biology 2023, 12, 997. [Google Scholar] [CrossRef] [PubMed]
- Singh, R.R. Target Enrichment Approaches for Next-Generation Sequencing Applications in Oncology. Diagnostics 2022, 12, 1539. [Google Scholar] [CrossRef] [PubMed]
| Targeted T. reesei Sequence | |||
|---|---|---|---|
| agtcacccaacgtcatcaacgcagcagttttcaatcagcgatgctaaccatattccctcgaacaggaagccgccgaactcggcaagggttccttcaagtacgcgtgggttcttgacaagctcaaggccga | |||
| Oligonucleotides | Annealing Temperature | Expected Amplicon Sizes | |
| Names | Sequences | ||
| TR-F | AGTCACCCAACGTCATCA | 60 °C | 130 bp |
| TR-P | FAM-ATATTCCCTCGAACAGGAAGCCGC-TAMRA | ||
| TR-R | TCGGCCTTGAGCTTGT | ||
| Kingdom | Genus | Species | Strain Number | Real-Time PCR TR Method |
|---|---|---|---|---|
| Fungi | Aspergillus | acidus | IHEM 26,285 | - |
| Aspergillus | aculeatus | IHEM 5796 | - | |
| Aspergillus | brasiliensis | IHEM 3766 | - | |
| Aspergillus | costaricaensis | IHEM 21,971 | - | |
| Aspergillus | fijiensis | IHEM 22,812 | - | |
| Aspergillus | flavus | IHEM 932 | - | |
| Aspergillus | flavus | IHEM 2465 | - | |
| Aspergillus | flavus | IHEM 5785 | - | |
| Aspergillus | heteromorphus | IHEM 5801 | - | |
| Aspergillus | ibericus | IHEM 23498 | - | |
| Aspergillus | melleus | IHEM 25956 | - | |
| Aspergillus | neoniger | IHEM 2463 | - | |
| Aspergillus | neoniger | IHEM 21592 | - | |
| Aspergillus | niger | IHEM 25485 | - | |
| Aspergillus | niger | IHEM 5296 | - | |
| Aspergillus | niger | IHEM 3415 | - | |
| Aspergillus | niger | IHEM 5622 | - | |
| Aspergillus | niger | IHEM 5788 | - | |
| Aspergillus | niger | IHEM 5844 | - | |
| Aspergillus | niger | IHEM 2312 | - | |
| Aspergillus | oryzae | IHEM 25836 | - | |
| Aspergillus | oryzae | IHEM 27253 | - | |
| Aspergillus | oryzae | IHEM 4381 | - | |
| Aspergillus | oryzae | IHEM 4382 | - | |
| Aspergillus | oryzae | IHEM 5782 | - | |
| Aspergillus | oryzae | IHEM 5789 | - | |
| Aspergillus | piperis | IHEM 5316 | - | |
| Aspergillus | tubingensis | IHEM 1941 | - | |
| Aspergillus | tubingensis | IHEM 6184 | - | |
| Aspergillus | tubingensis | IHEM 5615 | - | |
| Aspergillus | vadensis | IHEM 26351 | - | |
| Aspergillus | welwitschiae | IHEM 2864 | - | |
| Aspergillus | welwitschiae | IHEM 2969 | - | |
| Candida | cylindracea | MUCL 41387 | - | |
| Candida | rugosa | IHEM 1894 | - | |
| Chaetomium | gracile | MUCL 53569 | - | |
| Cryphonectria | parasitica | MUCL 7956 | - | |
| Disporotrichum | dimorphosporum | MUCL 19341 | - | |
| Fusarium | venenatum | MUCL 55417 | - | |
| Hansenula | polymorpha | MUCL 27761 | - | |
| Humicola | insolens | MUCL 15010 | - | |
| Kluyveromyces | lactis | IHEM 2051 | - | |
| Leptographium | procerum | MUCL 8094 | - | |
| Mucor | javanicus | IHEM 5212 | - | |
| Penicillium | camemberti | IHEM 6648 | - | |
| Penicillium | chrysogenum | IHEM 3414 | - | |
| Penicillium | citrinium | IHEM 26159 | - | |
| Penicillium | decumbens | IHEM 5935 | - | |
| Penicillium | funiculosum | MUCL 14091 | - | |
| Penicillium | multicolour | CBS 501.73 | - | |
| Penicillium | roqueforti | IHEM 20176 | - | |
| Pichia | pastori | MUCL 27793 | - | |
| Rhizomucor | miehei | IHEM 26897 | - | |
| Rhizopus | niveus | ATCC 200757 | - | |
| Rhizopus | oryzae | IHEM 26078 | - | |
| Saccharomyces | cerevisiae | IHEM 25104 | - | |
| Sporobolomyces | singularis | MUCL 27849 | - | |
| Talaromyces | cellulolyticus/pinophilus | IHEM 16004 | - | |
| Talaromyces | emersonii | DSMZ 2432 | - | |
| Trametes | hirsute | MUCL 30869 | - | |
| Trichoderma | atroviride | IHEM 745 | - | |
| Trichoderma | citrinoviride | IHEM 25858 | - | |
| Trichoderma | harzianum | IHEM 5435 | - | |
| Trichoderma | longibrachiatum | IHEM 935 | - | |
| Trichoderma | reesei | IHEM 5264 | + (Cq: 20.0) | |
| Trichoderma | reesei | IHEM 5476 | + (Cq: 20.4) | |
| Trichoderma | reesei | IHEM 5648 | + (Cq: 20.7) | |
| Trichoderma | reesei | IHEM 5652 | + (Cq: 22.7) | |
| Trichoderma | reesei | IHEM 4122 | + (Cq: 19.1) | |
| Trichoderma | viride | IHEM 4146 | - | |
| Bacteria | Arthrobacter | ramosus | LMG 17309 | - |
| Bacillus | amyloliquefaciens | LMG 12331 | - | |
| Bacillus | brevis | LMG 7123 | - | |
| Bacillus | cereus | ATCC 14579 | - | |
| Bacillus | circulans | LMG 6926T | - | |
| Bacillus | coagulans | LMG 6326 | - | |
| Bacillus | firmus | LMG 7125 | - | |
| Bacillus | flexus | LMG 11155 | - | |
| Bacillus | lentus | TIAC 101 | - | |
| Bacillus | licheniformis | LMG 7558 | - | |
| Bacillus | megaterium | LMG 7127 | - | |
| Bacillus | pumilus | DSMZ 1794 | - | |
| Bacillus | smithii | LMG 6327 | - | |
| Bacillus | subtilis | LMG 7135T | - | |
| Bacillus | subtilis | GMM RASFF2014.1249 | - | |
| Bacillus | velezensis | LMG 12384 | - | |
| Bacillus | velezensis | GMM RASFF2019.3332 | - | |
| Cellulosimicrobium | cellulans | LMG 16121 | - | |
| Corynebacterium | glutamicum | LMG 3652 | - | |
| Enterococcus | faecium | LMG 9430 | - | |
| Escherichia | coli | LMG 2092T | - | |
| Geobacillus | caldoproteolyticus | DSMZ 15730 | - | |
| Geobacillus | pallidus | LMG 11159T | - | |
| Geobacillus | stearothermophilus | LMG 6939T | - | |
| Klebsiella | pneumonia | LMG 3113T | - | |
| Lactobacillus | casei | LMG 6904 | - | |
| Lactobacillus | fermentum | LMG 6902 | - | |
| Lactobacillus | plantarum | LMG 9208 | - | |
| Lactobacillus | rhamnosus | LMG 18030 | - | |
| Lactococcus | lactis | LMG 6890T | - | |
| Leuconostoc | citreum | LMG 9824 | - | |
| Microbacterium | imperiale | LMG 20190 | - | |
| Paenibacillus | alginolyticus | LMG 18723 | - | |
| Paenibacillus | macerans | LMG 6324 | - | |
| Protaminobacter | rubrum | CBS 574.77 | - | |
| Pseudomonas | amyloderamosa | ATCC 21262 | - | |
| Pseudomonas | fluorescens | LMG 1794T | - | |
| Pullulanibacillus | naganoensis | LMG 12887 | - | |
| Streptomyces | aureofaciens | LMG 5968 | - | |
| Streptomyces | mobaraensis | DSMZ 40847 | - | |
| Streptomyces | murinus | LMG 10475 | - | |
| Streptomyces | netropsis | LMG 5977 | - | |
| Streptomyces | rubiginosus | LMG 20268 | - | |
| Streptomyces | violaceoruber | LMG 7183 | - | |
| Streptoverticillium | mobaraense | CBS 199.75 | - | |
| Plantae | Oryzae | sativa | / | - |
| Animalia | Homo | sapiens | / | - |
| Estimated Target Copy Number | |||||||
|---|---|---|---|---|---|---|---|
| 50 | 20 | 10 | 5 | 1 | 0.1 | 0 | |
| Real-Time PCR TR Method | + | + | + | + | + | - | - |
| (12/12) | (12/12) | (12/12) | (9/12) | (5/12) | (0/12) | (0/12) | |
| (Cq: 34.6) | (Cq: 36.0) | (Cq: 36.9) | (Cq: 38.2) | (Cq: 39.9) | |||
| Samples | Labeled Microbial Production Sources | Forms | Applications | Brands | Real-Time PCR Methods | ||
|---|---|---|---|---|---|---|---|
| BSG | TR | ||||||
| 1 | Alpha-amylase, protease, cellulase, xylanase, beta-glucanase—RASFF2019.3332 | Aspergillus sp., Bacillus sp., Trichoderma sp. | Solid | Distillery, brewing | A | +’ (Cq: 20.6) | + (Cq: 24.0) |
| 2 | Beta-glucanase | Trichoderma sp. | Solid | Unknown | B | + (Cq: 36.7) | + (Cq: 28.1) |
| 3 | Neutral protease—RASFF2019.3332 | Bacillus sp. | Solid | Baking, distillery, brewing | A | +’ (Cq: 19.5) | + (Cq: 30.2) |
| 4 | Alpha-amylase—RASFF2020.2582 | Unknown | Solid | Distillery, brewing | C | +’ (Cq: 31.2) | + (Cq: 32.9) |
| 5 | Alpha-amylase | Bacillus sp. | Liquid | Unknown | B | +’ (Cq: 22.9) | + (Cq: 33.5) |
| 6 | Alpha-amylase—RASFF2020.2846 | Bacteria | Liquid | Distillery, brewing | D | +’ (Cq: 19.8) | + (Cq: 35.4) |
| 7 | Alpha-amylase—RASFF2020.2579 | Bacteria | Solid | Distillery, brewing | E | +’ (Cq: 22.6) | - * |
| 8 | Alpha-amylase—RASFF2020.2577 | Unknown | Solid | Distillery | F | +’ (Cq: 19.4) | - * |
| 9 | Alpha-amylase—RASFF2020.2577 | Unknown | Solid | Distillery | G | +’ (Cq: 19.5) | - * |
| 10 | Alpha-amylase | Unknown | Liquid | Distillery, brewing | H | -’ | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fraiture, M.-A.; Gobbo, A.; Papazova, N.; Roosens, N.H.C. Development of a Taxon-Specific Real-Time Polymerase Chain Reaction Method to Detect Trichoderma reesei Contaminations in Fermentation Products. Fermentation 2023, 9, 926. https://doi.org/10.3390/fermentation9110926
Fraiture M-A, Gobbo A, Papazova N, Roosens NHC. Development of a Taxon-Specific Real-Time Polymerase Chain Reaction Method to Detect Trichoderma reesei Contaminations in Fermentation Products. Fermentation. 2023; 9(11):926. https://doi.org/10.3390/fermentation9110926
Chicago/Turabian StyleFraiture, Marie-Alice, Andrea Gobbo, Nina Papazova, and Nancy H. C. Roosens. 2023. "Development of a Taxon-Specific Real-Time Polymerase Chain Reaction Method to Detect Trichoderma reesei Contaminations in Fermentation Products" Fermentation 9, no. 11: 926. https://doi.org/10.3390/fermentation9110926
APA StyleFraiture, M.-A., Gobbo, A., Papazova, N., & Roosens, N. H. C. (2023). Development of a Taxon-Specific Real-Time Polymerase Chain Reaction Method to Detect Trichoderma reesei Contaminations in Fermentation Products. Fermentation, 9(11), 926. https://doi.org/10.3390/fermentation9110926

