Design of 5′-UTR to Enhance Keratinase Activity in Bacillus subtilis

Abstract

Keratinase is an important industrial enzyme, but its application performance is limited by its low activity. A rational design of 5′-UTRs that increases translation efficiency is an important approach to enhance protein expression. Herein, we optimized the 5′-UTR of the recombinant keratinase KerZ1 expression element to enhance its secretory activity in Bacillus subtilis WB600 through Spacer design, RBS screening, and sequence simplification. First, the A/U content in Spacer was increased by the site-directed saturation mutation of G/C bases, and the activity of keratinase secreted by mutant strain B. subtilis WB600-SP was 7.94 times higher than that of KerZ1. Subsequently, the keratinase activity secreted by the mutant strain B. subtilis WB600-SP-R was further increased to 13.45 times that of KerZ1 based on the prediction of RBS translation efficiency and the multi-site saturation mutation screening. Finally, the keratinase activity secreted by the mutant strain B. subtilis WB600-SP-R-D reached 204.44 KU mL⁻¹ by reducing the length of the 5′ end of the 5′-UTR, which was 19.70 times that of KerZ1. In a 5 L fermenter, the keratinase activity secreted by B. subtilis WB600-SP-R-D after 25 h fermentation was 797.05 KU mL⁻¹, which indicated its high production intensity. Overall, the strategy of this study and the obtained keratinase mutants will provide a good reference for the expression regulation of keratinase and other industrial enzymes.

1. Introduction

Keratin is an insoluble protein waste widely distributed in the epidermis and its appendages of animals, such as hair, feathers, nails, claws, carapace, horns and beaks [1,2,3]. Due to the richness of cysteine and glycine, and the cross-linked disulfide bonds formed between cysteine residues, keratin has a dense structure and low solubility in water [1]. The current chemical and physical methods for extracting keratin inevitably involve processes such as high temperature, microwave, and strong acid or alkali, which will not only cause product damage but also huge energy consumption and environmental burden [4].

Keratinase is a hydrolase with the ability to specifically degrade keratin and is considered to be an important biological enzyme that can improve existing processes in many industries such as tanning, cosmetics, detergents and feed [5,6,7,8,9,10]. Keratinases are mainly secreted by bacteria, fungi and actinomycetes found in soil, water or various sources rich in keratin substances [11,12,13]. The native keratinase gene has been extensively recombinantly expressed in conventional engineered strains [14,15]. Compared with the higher misfolding rate of Escherichia coli and the long-term fermentation of Pichia, Bacillus subtilis has the advantages of a short cycle and strong secretion capacity [16,17,18,19,20]. Strategies such as promoter optimization, signal peptide screening and pro-peptide engineering have all been used to regulate the expression of keratinase in B. subtilis [15,17,18]. However, the lower activity and expression capacity remain challenges for keratinase toward application.

The 5′-untranslated region (5′-UTR) of prokaryotic mRNAs contains the initiation codon, the Shine–Dalgarno (SD) sequence and the translational enhancer sequence, which play an important role in mRNA stability and translation initiation [21,22,23]. Since translation initiation is the rate-limiting step in gene expression, 5′-UTRs are often engineered to regulate protein expression levels in various biotechnological applications, including biosensor development, metabolic engineering and gene circuits [24,25,26,27]. Salis et al. established the “RBS calculator” to aid in the design of RBS sequences, which can increase the target translation initiation rate by 100,000-fold in E. coli [28]. Josh et al. constructed a random 5′-UTR library and trained a convolutional neural network on activity data obtained from the library in high-throughput parallel growth experiments to accurately predict Saccharomyces cerevisiae 5′-UTR elements with potentially high expression capacity [29]. In addition, although it is difficult to form a complete system, the modification of other structures of the mRNA 5′-UTR beyond the ribosome binding site is still widely reported. Xiao et al. developed a portable 5’-UTR sequence for enhancing the protein export of the industrial strain Bacillus licheniformis DW2. The optimized SD sequence is presented in single-stranded form on the hairpin loop for better ribosome recognition and recruitment. By optimizing the free energy of folding, this 5′-element can effectively enhance the expression of eGFP by about 50-fold [30].

In a previous study, we have successfully expressed the recombinant keratinase KerZ1 in B. subtilis WB600 with the P43 promoter [18]. Herein, we will optimize the 5′-UTR of the recombinant keratinase KerZ1 expression element to enhance its activity in B. subtilis WB600 by Spacer design, RBS screening and sequence simplification. This study will be a paradigm for enhancing protein expression by designing 5′-UTRs in B. subtilis.

2. Materials and Methods

2.1. Gene, Plasmids and Strains

In previous studies, we have expressed the keratinase gene from Bacillus licheniformis in B. subtilis WB600 to obtain the recombinant keratinase KerZ1 [18]. Strains, plasmids and primers used in this study are listed in

Table 1. List of strains, plasmids and primers used in this study.

Name	Sequence (5′-3′)
Strains
JM109	Escherichia coli
WB600	Bacillus subtilis 168 derivate, missing nprE aprE epr bpr mpr nprB
WB600-Ker	Bacillus subtilis WB600 contains plasmid pP43NMK-Ker
Plasmids
pP43NMK	Ampr, Kmr, E. coli–B. subtilis shuttle vector
pP43NMK-Ker	pP43NMK derivate with B. licheniformis Ker gene under the control of the promoter P43
Primers
Spacer
Spacer-3N-F	TTATAGGTAAGAGAGGAATNTANANATGATGAGGAAAAAGAGTTTTTGGCTTGG
Spacer-3N-R	ATTCCTCTCTTACCTATAATGGTACCGCTAT
RBS
RBS-6N-F	TAGCGGTACCATTATAGGNNNNNNAGGAATGTATAGATGATGAGGAAAAAGAGTTTTTG
RBS-6N-R	CCTATAATGGTACCGCTATCACTTTATATTTTACATAATCG
5′ end
Sim1-F	TAAAATATAAAGTGATAGCGTACCATTATAGGTATTGGAGGAATGTACAC
Sim2-F	TAAAATATAAAGTGATAGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim3-F	TAAAATATAAAGTGATAGTACCATTATAGGTATTGGAGGAATGTACAC
Sim4-F	ATTATGTAAAATATAAAGTATAGTACCATTATAGGTATTGGAGGAATGTACAC
Sim5-F	ATTATGTAAAATATAAATATAGTACCATTATAGGTATTGGAGGAATGTACAC
Sim6-F	ATGTAAAATATAAAGTGATGCGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim7-F	ATGTAAAATATAAAGTGAGCGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim1C-F	TAAAATATAAAGTGATAGCGTAACATTATAGGTATTGGAGGAATGTACAC
Sim2C-F	TAAAATATAAAGTGATAGGTAACATTATAGGTATTGGAGGAATGTACAC
Sim3C-F	TAAAATATAAAGTGATAGTAACATTATAGGTATTGGAGGAATGTACAC
Sim4C-F	ATTATGTAAAATATAAAGTATAGTAACATTATAGGTATTGGAGGAATGTACAC
Sim6C-F	ATGTAAAATATAAAGTGATGCGGTAACATTATAGGTATTGGAGGAATGTACAC
Sim7C-F	ATGTAAAATATAAAGTGAGCGGTAACATTATAGGTATTGGAGGAATGTACAC
Sim8-F	ATGTAAAATATAAAGTGGCGGTACCATTATAGGTATTGGAGGA
Sim9-F	GATTATGTAAAATATAAAGGGCGGTACCATTATAGGTATTGGAGGA
Sim10-F	ATTATGTAAAATATAAACGCGGTACCATTATAGGTATTGGAGGA
Sim11-F	ATTATGTAAAATATAAAGTACCATTATAGGTATTGGAGGAATGTACAC
Sim123-R	TATCACTTTATATTTTACATAATCGCGCGCTTTTTTTC
Sim4591011-R	TTTATATTTTACATAATCGCGCGCTTTTTTTCACG
Sim678-R	CACTTTATATTTTACATAATCGCGCGCTTTTTTTC

. All plasmids were derived from the backbone vector pP43NMK-Ker. E. coli JM109 was used for plasmid cloning and enrichment. All mutants achieved secretory expression in B. subtilis WB600. In site-directed saturation mutagenesis, the entire plasmid was amplified using mutant primers containing the degenerate base N using plasmid pP43NMK-ker as a template. Subsequently, the circularization of all linearized plasmids was done using Gibson assembly. All plasmids were chemically transformed into competent cells of E. coli JM109 and B. subtilis WB600.

2.2. Medium and Culture Conditions

Escherichia coli JM109 was cultured in Luria–Bertani medium (yeast powder 5, peptone 10, sodium chloride 10) g L⁻¹ supplemented with 100 μg mL⁻¹ ampicillin at 37 °C for 12 h. B. subtilis WB600 cells carrying recombinant plasmids were cultured in fermentation medium (glucose 30 g L⁻¹, yeast extract 5.72 g L⁻¹, soybean meal 40 g L⁻¹, Na₂HPO₄·12H₂O 3 g L⁻¹, KH₂PO₄ 1.5 g L⁻¹, MgSO₄·7H₂O 0.3 g L⁻¹) supplemented with 50 μg mL⁻¹ kanamycin at 37 °C for 24 h. For site-directed saturation mutagenesis, 96-well plates were used for the culturing and screening of recombinant strains. Transformants of B. subtilis WB600 were picked into 96-well plates containing 1 mL of fermentation medium and cultured with shaking at 37 °C for 24 h.

2.3. Keratinase Activity

A reaction system containing 150 μL of 50 mM Gly/NaOH buffer (pH 9.0), 100 μL of 2.5% soluble keratin (CAS RN: 69430-36-0) and 50 μL of appropriately diluted enzyme was incubated at 60 °C for 20 min. Then, 200 μL of 0.5 mol L⁻¹ trichloroacetic acid (TCA) was added to stop the reaction, and the system was centrifuged at 12000× g for 2 min. 200 μL of the supernatant was added to 1 mL of 4% Na₂CO₃, followed by 200 μL of Folin–Ciocalteu reagent, and the chromogenic system was mixed and incubated at 50 °C for 10 min. Keratinase activity was calculated from absorbance at 660 nm and a tyrosine standard curve. All experiments were repeated three times, and the control group was mixed with trichloroacetic acid before adding the enzyme solution.

2.4. Analysis of 5′-UTR Secondary Structure

The translation initiation efficiency after the mutation of the RBS sequence in the Bacillus subtilis recombinant keratinase KerZ1 expression system was predicted using RBS Calculator v2.0 (https://salislab.net/software/forward, accessed on 4 March 2022) [28]. The 5′-UTR sequence of the keratinase expression element was uploaded to the online server mfold (http://www.unafold.org/mfold/applications/rna-folding-form.php, accessed on 20 June 2022) for secondary structure prediction and Gibbs free energy calculation [31].

2.5. Fermentation Performance Validation in Fermenter

Culture validation was performed using a 5 L fermenter (T&J Bio-engineering Co., Ltd., Shanghai, China) containing 3.0 L fermentation medium. The initial fermentation temperature was set to 37 °C, and the pH of the system was maintained at 7 by automatically pumping in ammonia. During fermentation, the aeration rate was set at 0.5 vvm and the dissolved oxygen (DO) was maintained at 20−30% by correlating the DO with the stirring speed. Glucose with a concentration of 720 g L⁻¹ was replenished in two stages at 40 mL h⁻¹ and 30 mL h⁻¹.

3. Results and Discussion

3.1. Replacement of Spacer Sequence C/G to A/T

The Spacer sequence is located between the RBS and the target gene. Studies have shown that the activation of translation by A/U-rich Spacer sequences is independent of SD sequences, initiation codons and prior cistron translation [32]. A/U-rich sequences may improve translation efficiency by enhancing interaction with ribosomal protein S1 [33]. To improve the translation efficiency of keratinase, we performed saturation mutations on the C/G bases in the Spacer sequence of the 5′-UTR element of keratinase KerZ1 (Figure 1a).

High-throughput screening was performed for the Spacer sequence by measuring the keratinase activity secreted by the mutant strains. After preliminary screening, eight Spacer sequence mutant strains with improved keratinase activity in 96-well plate fermentation were obtained, namely 1-A1, 1-E1, 1-E2, 1-H4, 2-A10, 2-F12, 3-B8 and 3-F3. Subsequently, rescreening was performed at the shake flask level. The activity assay showed that the keratinase activity secreted by the mutant strains obtained after preliminary screening was significantly higher than that of the original strain (KerZ1, 10380 U mL⁻¹). Among them, the keratinase activities secreted by strains 1-H4 and 3-B8 were significantly higher than others, reaching 59,845 and 82,435 U mL⁻¹, which were 5.76 and 7.94 times that of KerZ1, respectively (Figure 1b).

Sequencing showed that the C/G bases in the Spacer sequence of the screened strains were multi-mutated to A/T bases, and the corresponding mRNA bases were A/U bases (

Table 2. Spacer base mutants and their corresponding keratinase activities.

Strains	Spacer (5′-3′)	Activity (U mL−1)
KerZ1	AATGTACAC	10,380
1-A1 1-E1 1-E2 1-H4 2-A10 2-F12 3-B8 3-F3	AATTTACAT AATTTACAT AATTTACAC AATTTATAA AATTTACAT AATTTACAA AATGTATAG AATTTACAT	35,935 43,800 23,745 59,845 41,915 33,615 82,435 36,565

). Similar results were shown in a study by Ilya A. et al.; A/U-rich enhancers derived from highly expressed phoP genes increased monocistronic mRNA expression nearly five-fold [32]. However, in the mutant strain 3-B8 with the highest keratinase activity, the −3 site of the Spacer sequence was mutated from C to T, and the −1 site was mutated from C to G, which was not a complete A/U substitution. Perhaps the presence of G bases in the Spacer sequence may also improve the expression efficiency of the protein, which remains to be verified in the future. Finally, we named 3-B8 as B. subtilis WB600-SP and carried out the next transformation on this basis.

3.2. Screening of Ribosome Binding Sites (RBS)

RBS sequence is the core of 5 ‘UTR, usually composed of 4–9 nucleotides and rich in a and G bases [34]. In prokaryotes, the RBS sequence also has the SD sequence, which can complementarily pair with the 3′ end of ribosomal 16S rRNA to facilitate ribosome binding to mRNA [35]. The easier the ribosome binds to RBS, the more stable the complex formed and the higher the translation initiation efficiency. To screen for RBS sequences with higher translation initiation efficiency, we performed saturation mutations on the original RBS sequences (Figure 2a). Based on the original RBS sequence (GTAAGAGAGG) of plasmid p43NMK, the 6-base group gradually moved closer to the translation initiation site (NNNNNNGAGG, GNNNNNNAGG until GTAANNNNNN) to predict the effect of RBS sequence mutation on the translation initiation rate [28]. The results show that the generation of mutations closer to the translation initiation site has less effect on the translation initiation rate. Positions 2–7 of RBS have the highest possible translation initiation efficiency when predicted for mutations (Figure 2b). Therefore, primers were designed to perform saturation mutation on positions 2–6 of RBS, that is, the −13 to −18 region of the total sequence, to obtain a strain with enhanced keratinase secreting activity.

The theoretical number of transformants were selected three times for screening to achieve 95% coverage. The primary screening in the 96-well plate showed that the keratinase activity secreted by nine strains was higher than that of the control strain B. subtilis WB600-SP, namely 1-B10, 1-E12, 2-A7, 2-D12, 2-G12, 3-A10, 3-B9, 3-C8, 3-F11. After re-screening in the shake flask, only the keratinase activities secreted by 2-G12 and 3-B9 were significantly higher than those of the control, reaching 139,650 and 99,860 U mL⁻¹, which were 13.45 and 9.62 times that of the original strain (KerZ1, 10380 U mL⁻¹), respectively (Figure 2c). Although the translation initiation efficiency prediction results were different from the actual expression, the translation initiation efficiency of the 2-G11 and 3-B9 strains with increased activity in the shake flask was significantly higher than that of the original strain (

Table 3. RBS base mutants and their corresponding keratinase activities.

Strains	RBS (5′-3′)	Activity (U mL−1)	Translation Initiation Rate (au)
SP	GTAAGAGAGG	82,435	72.08
1-B10 1-E12 2-A7 2-D12 2-G12 3-A10 3-B8 3-C8 3-F11	GCTGCACAGG GCTTGCGAGG GGGAAGTAGG GATGGTAAGG GTATTGGAGG GAAAGACAGG GGACGGAAGG GTGTTGCAGG GGGGGCTAGG	7695 25,350 45,740 7510 139,650 11,060 99,860 30,395 15,710	11.63 26.81 362.40 37.82 85.58 23.71 127.08 29.45 121.96

), which indicates that it is effective to screen RBS sequences based on the prediction of translation initiation efficiency. We named 2-G12 as B. subtilis WB600-SP-R.

3.3. Simplification of the 5′ End Sequence

There is a 9 bp single chain sequence at the 5′-end of the 5′-UTR stem-loop structure, which has no additional function other than carrying the initiation site for transcription. Studies have shown that the simplification of the single-stranded sequence is helpful to weaken the influence of the downstream expressed gene sequence on the 5′-UTR region and enhance the protein expression [30]. In addition, simplifying the single-chain sequence can adjust the proportion of each base in the 5′-UTR region [36]. To this end, we used the 5′-UTR region of KerZ1 as a template to adjust the base ratio and prevent additional stem-loop structures by deleting a/T or C/G bases one by one. At the same time, for the change of stem ring structure caused by the introduction of mutation, a base mutation was introduced to maintain the original stem ring structure, as shown in

Table 4. Mutant sequences for simplified design of the 5′-UTR region.

Mutants	5′-UTR Sequence (5′-3′)
2-G12	GTGATAGCGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim1	GTGATAGC--GTACCATTATAGGTATTGGAGGAATGTACAC
Sim1C	GTGATAGC--GTAACATTATAGGTATTGGAGGAATGTACAC
Sim2	GTGATAG----GTACCATTATAGGTATTGGAGGAATGTACAC
Sim2C	GTGATAG----GTAACATTATAGGTATTGGAGGAATGTACAC
Sim3	GTGATA------GTACCATTATAGGTATTGGAGGAATGTACAC
Sim3C	GTGATA------GTAACATTATAGGTATTGGAGGAATGTACAC
Sim4	GT--ATA------GTACCATTATAGGTATTGGAGGAATGTACAC
Sim4C	GT--ATA------GTAACATTATAGGTATTGGAGGAATGTACAC
Sim5	--T--ATA------GTACCATTATAGGTATTGGAGGAATGTACAC
Sim6	GTGAT--GCGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim6C	GTGAT--GCGGTAACATTATAGGTATTGGAGGAATGTACAC
Sim7	GTGA----GCGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim7C	GTGA----GCGGTAACATTATAGGTATTGGAGGAATGTACAC
Sim8	GTG------GCGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim9	G--G------GCGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim10	------------GCGGTACCATTATAGGTATTGGAGGAATGTACAC
Sim11	------------------GTACCATTATAGGTATTGGAGGAATGTACAC

Note: -- is the deleted base; the underlined base is the modified base to maintain the stem-loop structure.

.

A keratinase activity test showed that the activity of mutant Sim3C reached 204.44 KU mL⁻¹ (Figure 3a), which was 19.70 times that of keratinase KerZ1 (10,380 U mL⁻¹), and was named B. subtilis WB600-SP-R-D. SDS-PAGE was used to verify the keratinases secreted by the optimal mutant strains obtained under different strategies (Figure 3d). The results showed that the expression of keratinase increased gradually. In addition, we also obtained several mutants with increased keratinase activity to varying degrees. Using mfold to predict the secondary structure of mRNA, we found that 5′ deletions altered the mRNA secondary structure (Figure 3b,c). The SD sequence is located on the stem-loop to form a single chain, which is more conducive to its recognition and to the recruitment of ribosomes. In addition, the Gibbs free energy of Sim3C (−1.60) was lower than that of 2-G12 (−7.70), indicating that Sim3C mRNA is more easily bound to ribosomes and has a higher translation initiation rate.

3.4. Fermentation Performance of B. subtilis WB600-SP-R-D

Exploring the enzyme-producing properties of mutant strains in larger systems is not only the basis for the development of industrial strains but also the verification of production strength. To this end, we fermented the mutant strain B. subtilis WB600-SP-R-D in a 5 L fermenter to test its ability and strength to secrete keratinase. Previous studies have shown that excess glucose causes recombinant Bacillus subtilis to produce large amounts of lactic acid as a by-product, which inhibits bacterial growth [37]. While it is possible to automatically pump ammonia to adjust the pH of the environment, this reduces the ability of cells to produce keratinase [15,38]. Therefore, 720 g L⁻¹ of glucose was continuously fed for 10–22 h to keep the glucose concentration at 1–30 g L⁻¹ during fermentation. The feeding was stopped after the 22nd hour, so that the glucose was almost exhausted at the end of the fermentation, which was more conducive to the subsequent separation of keratinase. After 27 h of fermentation, the mutant strain B. subtilis WB600-SP-R-D reached the peak activity of 797.05 KU mL⁻¹ at 25th hour of fermentation, which was 76.79 times that of the original strain (Figure 4). Therefore, the mutant B. subtilis WB600-SP-R-D after 5′-UTR optimization showed excellent and stable enzyme production ability.

4. Conclusions

Keratinase is a promising keratin treatment, but the low activity is still the resistance to use. In this study, we obtained several mutant strains with increased keratinase secretion through the modification of 5′-UTR. A/U base substitution in Spacer region, RBS sequence optimization and the deletion of a single-stranded sequence at the 5′ end made the keratinase activity secreted by mutant B. subtilis WB600-SP-R-D reach 204.44 KU mL⁻¹, which was 19.70 times that of keratinase KerZ1 (10,380 U mL⁻¹). In addition, B. subtilis WB600-SP-R-D had the highest activity in the 5 L fermenter at 797.05 KU mL⁻¹, showing excellent enzyme production capacity and stability. In conclusion, the rational design of 5′-UTR can significantly improve the expression activity of keratinase in B. subtilis, which will be a typical example of the regulation of recombinant protein expression.