Ethanol and Xylitol Co-Production by Clavispora lusitaniae Growing on Saccharified Sugar Cane Bagasse in Anaerobic/Microaerobic Conditions

Abstract

Ethanol and xylitol are valuable bioproducts synthesized by non-conventional yeasts from lignocellulosic sugars. However, their biosynthesis requires distinct cultivation conditions. This study evaluated the production of ethanol and xylitol by Clavispora lusitaniae using saccharified sugarcane bagasse (SSCB) under three aeration conditions: microaerobic (C1), anaerobic (C2), and a combination of anaerobic followed by a microaerobic phase (C3). Ethanol production was maximum under anaerobic conditions (C2), followed by combined anaerobic–microaerobic conditions (C3). Meanwhile, xylitol production was most efficient under microaerobic conditions (C1). Notably, anaerobic conditions were ineffective for xylitol production. Enzyme activities of xylose reductase (XR) and xylitol dehydrogenase (XDH), key enzymes in xylose metabolism, were highest under microaerobic conditions with activities of 2.88 U/mg and 1.72 U/mg, respectively, after 48 h of culture. Gene expression analysis of XYL1 and XYL2 correlated with the corresponding enzyme activities (XR) and (XDH) with increased levels of 32.38 and 7.88 fold, respectively, compared to the control in C1. These findings suggest that C. lusitaniae co-produces ethanol efficiently under anaerobic conditions, while xylitol biosynthesis is optimized under microaerobic conditions when using xylose-rich saccharified lignocellulosic substrates.

1. Introduction

Lignocellulosic biomass (LCB) is a polymeric material derived from vegetal biomass, predominantly produced in the agricultural and forestry sectors. As the term implies, LCB is constituted by three principal components: cellulose, hemicellulose, and lignin [1]. Cellulose is a glucose polymer linked by β-1,4 glycosidic bonds, while hemicellulose is a heteropolymer, typically consisting of a linear chain of xylose also connected by β-1,4 glycosidic linkages, but with additional branching and substituents such as galactose, L-arabinose, acetyl, methyl and others [2]. Lignin is a polymer mainly composed of hydroxycinnamic alcohols such as p-coumaryl, coniferyl and sinapyl [3]. A key example of LCB residue is sugarcane bagasse (SCB), a byproduct of sucrose extraction in sugar mills [4]. SBC is composed of cellulose (47.4%), hemicellulose (17.9%), and lignin (23.2%) [5]. The cellulose can be hydrolyzed into glucose and cellobiose through the action of enzymes like endoglucanases, exoglucanases and β-glucosidases [6]. Similarly, the hemicellulose fraction can be degraded by endo- and exo-xylanases, yielding xylose and xylobiose [7].

The sugars generated during the saccharification of SCB serve as substrates for various yeast species, enabling the production of valuable bioproducts such as ethanol and xylitol. Ethanol is commonly used as an additive in fossil fuels, enhancing their combustion properties. On the other hand, xylitol, a five-carbon polyalcohol, is a bioproduct with the highest added value. Xylitol is used in the food industry as a low-calorie sweetener, providing 40% fewer calories than sucrose. Another use it has is as an anticariogenic in oral hygiene products because it inhibits the growth of dental plaque [8] Ethanol is primarily produced by yeasts of the Saccharomyces genus, which predominantly metabolize hexoses. However, these native yeasts cannot use cellobiose and xylose, which are commonly present in saccharified LCB. In contrast, non-conventional yeasts like Kluyveromyces, Candida and Scheffersomyces, among others, can ferment hexoses and pentoses, with some species also producing xylitol as a byproduct from xylose metabolism. Clavispora lusitaniae has emerged as a promising candidate for co-production due to its ability to efficiently metabolize cellobiose, glucose and xylose and its tolerance to diverse fermentation conditions. The simultaneous production of ethanol and xylitol enables the efficient utilization of LCB, offering a sustainable pathway for biofuel and biochemical production [9,10,11].

Studies have shown that aerobic or microaerobic conditions favor xylitol production, while anaerobic conditions are more conducive to ethanol production. One of the key bottlenecks in the co-production of ethanol and xylitol with non-conventional yeasts is optimizing the aeration conditions required for the efficient accumulation of each metabolite. The production of ethanol from glucose is most efficient when the process is operated under anaerobic conditions. While the production of xylitol from xylose occurs to a greater extent under aerobic or microaerobic conditions [12,13]. Several studies have explored various fermentation strategies for the co-production of ethanol and xylitol from saccharified SCB. These strategies involve two separate fermentation stages. In the first stage, Saccharomyces cerevisiae produces ethanol from glucose. In contrast, in the second stage, xylose-rich syrups are inoculated with unconventional yeasts such as C. tropicalis [14] or C. guilliermondii TISTR 5068 to produce xylitol [15]. Another approach involves the production of xylitol from xylose in the first stage using Pichia guilliermondii RLV-04 (MH588234.1) followed by ethanol production in the second stage using S. cerevisiae [16]. However, to the best of our knowledge, no studies have reported the co-production of ethanol and xylitol by Clavispora lusitaniae from saccharified lignocellulosic biomass (LCB) using a single system that includes an initial anaerobic phase followed by a microaerophilic phase.

This work assessed the effect of aeration on the co-production of ethanol and xylitol from saccharified sugar cane bagasse (SSCB) by C. lusitaniae. Three distinct conditions were evaluated: a microaerobic condition (C1), which favored the highest xylitol titer from xylose; an anaerobic condition (C2), which promoted ethanol production from glucose; and a third condition (C3), which an initial anaerobic phase is followed by a microaerobic phase. Under condition C3, ethanol was produced initially, followed by xylitol, resulting in enhanced production, productivity and yield of both metabolites compared to the individual condition assayed. It is worth mentioning that xylitol accumulation results from an imbalance between the cofactors NADPH and NAD⁺ during microaerobic xylose metabolism through the oxidoreduction pathway (Figure 1), [10,11]. Then, XR and XDH activities were detected in C. lusitaniae when exposed to xylose. The expression levels of the corresponding genes are closely correlated with the observed enzyme activities.

2. Materials and Methods

2.1. Microorganism and Inoculum Preparation

Clavispora lusitaniae CDBB-L-2031 is a non-conventional yeast native to Mexico, isolated from mezcal musts. This yeast has the native characteristic that it assimilates xylose, in addition to glucose and cellobiose, which makes its use in producing metabolites like ethanol and xylitol from saccharified lignocellulosic residues interesting. Other characteristics that make this yeast useful are its ability to tolerate high ethanol concentrations and temperatures and its ability to be osmotolerant [10,11].

This yeast was grown in a 1000 mL Erlenmeyer flask containing 100 mL of YPDX medium with the following composition (g/L): yeast extract (10); bactopeptone (20); glucose (2) and xylose (2). The cell culture was incubated at 30 °C, 200 rpm for 24 h. The broth was centrifuged at 8000 rpm for 15 min, and the resulting cell pellet was resuspended in 25 mL of a 0.8% (w/v) sterile NaCl solution. This suspension was then used as the inoculum for the reactor, which was adjusted to an initial cell concentration of 3.3 g/L.

2.2. Pretreatment and Saccharification of Sugar Cane Bagasse (SCB)

Ground SCB (10%) was alkali-pretreated under optimal conditions of 2% NaOH at 80 °C for 15 min [17,18,19,20] to maximize lignin removal, increase the cellulose content, and minimize energy and NaOH consumption. The same pretreatment protocol is followed with each new batch of SCB to maintain its consistent composition (

Table 1. Composition of sugar cane bagasse.

SCB Treatment	Lignin (%)	Cellulose (%)	Hemicellulose (%)
Raw material	23.27 ± 0.39	47.4 ± 1.54	17.98 ± 1.27
NaOH (2%)	15.37 ± 0.66	65.83 ± 3.64	12.52 ± 1.52

).

The pretreated bagasse was washed with tap water until a neutral pH was achieved. Then, it was dried at room temperature and milled to reduce particle size, facilitating the enzymatic saccharification process [21]. The saccharification was carried out in a bench reactor with an operating volume of 2 L of 25 mM citrate buffer pH 4.8, using 30 g/L of pretreated SCB and 16.66 FPU/g SCB (Celluclast 1.5 L Novozymes, Copenhagen, Denmark) at 50 °C and 500 rpm [5]. The saccharified was concentrated to increase glucose and xylose concentration four times in a rotary evaporator at 65 °C and 180 mbars.

2.3. Batch Reactor Fermentation

The cultures were carried out in bench bioreactors of 0.5 L total volume (Applikon my-Control, The Netherlands), containing 0.4 L of Breus minimum medium (BMM) [22]. The medium contained (g/L): yeast extract (24); (NH₄)₂SO₄ (3.8) and MgSO₄ (0.05). The carbon source was saccharified sugarcane bagasse (SSCB) containing glucose (66.56) and xylose (25.13) g/L. C. lusitaniae was grown under three air conditions: (C1) microaerobic, (C2) anaerobic and (C3) sequential anaerobic–microaerobic phases. Under microaerobic conditions, the reactor was aerated at 0.25 vvm air flow rate, stirred at 200 rpm and kept at 30 °C for 80 h. In the anaerobic condition, O₂ was displaced with N₂ until it reached less than 10% saturation. The bioreactor was stirred at 100 rpm at 30 °C for 80 h. In the sequential phase combination, an initial 24 h anaerobic phase was followed by a 56 h microaerobic phase. The agitation and aeration conditions were identical for each of the abovementioned phases. Samples of 1 mL were taken every 8 h and stored at 4 °C for further analysis. Cell growth was determined by optical density at 660 nm and converted to dry cellular weight using a standard curve.

2.4. Sugars and Metabolites Determination

Residual sugars and metabolites were quantified by HPLC in the supernatant of the centrifuged samples. A Hi-Plex H-300x7.7 column (Agilent, Santa Clara, CA, USA) at 50 °C and a refractive index detector was used with an isocratic method with 5 mM H₂SO₄ as mobile phase at a 0.6 mL/min flow rate. The concentration of each compound was calculated from calibration curves of retention times (min) for xylose (12.4), glucose (11.4), D-arabitol (13.2), xylitol (13.7) and ethanol (24.5).

2.5. Crude-Cell Extract Obtention and Protein Determination

Crude-cell extracts were obtained by harvesting 2 mL of cell suspension and further centrifugation at 8000 rpm at 4 °C for 10 min; the cell pellet was washed twice with sterile distilled water and resuspended in 400 µL of 0.1 M phosphate buffer pH 7.2. Cells were frozen at −20 °C for 30 min in an Eppendorf tube. After thawing, cells were mixed with 0.3 g of glass beads (0.5 mm) and 150 µL of 0.1 M β-mercaptoethanol and disrupted in a vortex at maximum speed for 30 min. The mixture was centrifuged at 10,000 rpm (4 °C, 5 min) and the supernatant was recovered for the XR and XDH activity assays. Protein concentration in the cell-free crude extracts was determined by the Lowry method using bovine serum albumin as a standard [23].

2.6. Xylose Reductase (XR) and Xylitol Dehydrogenase (XDH) Activity Assays

The XR and XDH activities in the cell-free crude extracts were measured according to Cocotle-Ronzon et al. [24]. The reaction mixture for XR contained (in mM): phosphate buffer pH 7.2 (100), NADPH (1) and xylose (100). The reaction mixture XDH contained (mM): of Tris HCl buffer pH 8.5 (50), MgCl₂ (100), NAD⁺ (1.15), and xylitol (40). Crude-cell extract of 100 µL was used for a final volume of 1000 µL in both reactions. The assays were carried out at 30 °C, the oxidation of NADPH and the reduction of NAD⁺ were observed by the change in absorbance at 340 nm for 2 min. The value of 6.22 mL/(µmol × cm) was used as the molar extinction coefficient of coenzymes per minute. One unit of enzyme activity was defined as 1 µmol of cofactor reduced or oxidized per minute. The specific XR and XDH activities were expressed in units per mg of protein (U/mg).

2.7. Expression Levels of XYL1 and XYL2 Genes of C. lusitaniae

To quantify XYL1 and XYL2 gene expression, 1 mL samples were taken at 0, 24, 48, 72 and 80 h and centrifuged at 10,000 rpm. The recovered cell pellet was washed twice with nucleases free water. Total RNA was extracted from the cell pellet using the phenol-chloroform method [25]. The integrity and purity of the extracted total RNA were determined by agarose gel electrophoresis and spectrophotometry on a Nanodrop 2000 (Thermo Scientific, Waltham, MA, USA). RNA samples whose purity ratio (A260/280) was more than 1.8 were taken as a template for cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific™, Vilnius, Lithuania), and the oligo (dT) as a primer. The cDNA was used as a template in RTqPCR, performed in the CFX96 Real-Time System (Bio-Rad, Hercules, CA, USA), consisting of an initial denaturation cycle of 10 min at 95 °C, 40 cycles of 15 s at 95 °C denaturation, 45 s at 58 °C annealing and 30 s at 72 °C extension and finally an extension of 1 min at 72 °C. The primers used for RTqPCR were designed based on the sequences of C. lusitaniae ATCC 42720 (

Table 2. Primers used in this work.

Primer	Sequence (5′3′)	Amplicon Length (pb)	Match Side in the Gene (pb)
Fw-XYL1	CGGTTACAGATTGTTCGACGGT	480	111
Rv-XYL1	TGGTTGTTGCAAGTATGGGTG		591
Fw-XYL2	GGTATCTGTGGTTCCGATATCCA	219	926
Rv-XYL2	CATGTGAGGACACAAGTTGTAGT		707
Fw-ACT1	TCTACAACGAATTGAGAGTTGC	269	245
Rv-ACT1	GACAAGATCTTCATCAAGTAGTC		514

) [10]. Data were normalized using the actin gene as an endogenous control and analyzed according to 2^−ΔΔCt [26].

2.8. Statistical Analyses

Cultures for co-production of ethanol and xylitol were made in duplicate for each condition. Two independent biological replicates were conducted for the enzyme activities and gene expression level assays. The maximum difference between replicates was less than 5% of the mean. Two-way ANOVA was performed using GraphPad Prism software version 8.0.2. p values < 0.05 are adopted as statistically significant.

3. Results and Discussion

3.1. Co-Production of Ethanol and Xylitol Under Different Conditions

3.1.1. Microaerobic Condition (C1)

C. lusitaniae was cultured under microaerobic conditions to assess its ability to co-produce ethanol and xylitol from SSCB. Glucose consumption was complete within 16 h, while xylose was utilized more slowly, possibly due to glucose repression effect, leading to a slight diauxic growth phase observed at 24 h. Xylose was completely consumed at 64 h (Figure 2A) (Table S1). During the first 8 h, C. lusitaniae produced 22.7 g/L of ethanol. However, by 24 h, the ethanol concentration had decreased to 18.06 g/L, at which point the yield and productivity of ethanol were calculated. Due to aeration entrainment, the ethanol concentration decreased throughout the microaerobic process, reaching 7.3 g/L at 80 h (Figure 2B) (Table S2). Xylitol production reached 14.30 g/L by 80 h (Figure 2B), and a minor accumulation of D-arabitol was observed, with a titer of 0.74 g/L (

Table 3. Comparison of kinetic parameters of C. lusitaniae and other yeasts in the coproduction of ethanol and xylitol from SSBC.

Strain	Bioprocess and Substrate	Ethanol (g/L) 24 h	Xylitol (g/L) 80 h	Arabitol (g/L) 80 h	Glucose Consumption (%) 24 h	Xylose Consumption (%) 80 h	Y EtOH/Glu 24 h	Y XOH/Xyl 80 h	Ethanol Productivity (g/L/h) 24 h	Xylitol Productivity (g/L/h) 80 h	Reference
C. lusitaniae (C1)	Batch SSCB	18.1 ± 0.957	14.30 ± 0.334	0.74 ± 0.090	100 ± 0.028	100 ± 0.000	0.28 ± 0.014	0.58 ± 0.003	0.75 ± 0.040	0.17 ± 0.004	This work
C. lusitaniae (C2)	Batch SSCB	31.80 ± 0.910	4.10 ± 0.001	0.81 ± 0.017	100 ± 0.000	27.97 ± 0.078	0.49 ± 0.005	0.51 ± 0.015	1.32 ± 0.038	0.05 ± 0.001	This work
C. lusitaniae (C3)	Batch SSCB	30.90 ± 0.566	11.99 ± 0.002	2.33 ± 0.715	100 ± 0.255	94.74 ± 0.018	0.47 ± 0.009	0.53 ± 0.062	1.28 ± 0.025	0.14 ± 0.001	This work
S. hagerdaliae UFMG-CM-Y303	Batch Hydrolysates of soyabean and oat	9.5 ± 0.9	4.5 ± 0.3	-	-	-	0.38 ± 0.02	0.20 ± 0.01	0.04 ± 0.01	0.02 ± 0.00	[27]
S. cerevisiae S288C and C. tropicalis	SSF SCB	56.1 ± 1.7	24 ± 0.9	-	100 ± 0.9	100 ± 0.8	0.44 ± 0.01	0.50 ± 0.01	0.58 ± 0.03	0.25 ± 0.01	[28]
Z. mobilis C. tropicalis	Fed-batch Glucose and xylose	29.74 ± 0.2	27.14 ± 0.16	-	100 ± 0.01	100 ± 0.4	0.49 ± 0.005	0.54 ± 0.002	2.47 ± 0.01	0.76 ± 0.004	[29]
K. marxianus CICC 1727-5	SSCF Corn cob	14.13 NR	8.26 NR	-	100 NR	100 NR	0.41 NR	0.54 NR	-	-	[30]
S. passalidarum	SSCF Corn cob	9.85 NR	6.17 NR	-	100 NR	100 NR	0.27 NR	0.52 NR	-	-	[30]

Notes: NR is standard deviation no reported. (–) parameter no reported.

).

3.1.2. Anaerobic Condition (C2)

C. lusitaniae was grown under anaerobic conditions to evaluate whether the yield and ethanol production from glucose exceeded those obtained in the C1 condition and to evaluate the potential production of xylitol from xylose. Under these conditions, C. lusitaniae consumed all the available glucose in 24 h. In contrast, xylose consumption in this condition reached only 27.97% after 80 h, 72.03% less than the observed in C1 (Figure 3A) (Table S3). These results indicate that anaerobic conditions do not favor xylose consumption. Regarding the metabolites production, the ethanol titer under anaerobic conditions reached 31.80 g/L at 24 h, which was 40% higher than that obtained under microaerobic conditions. After this time, the concentration remained constant, with no losses observed, likely due to the absence of aeration. The xylitol titer in C2 was only 4.1 g/L after 80 h of culture. This value was 71.26% lower than that observed in C1 (Figure 3B) (Table S4). A slight average D-arabitol accumulation of 0.18 g/L was observed throughout the process.

3.1.3. Sequential Anaerobic/Microaerobic Phases (C3)

Since it was observed that the highest ethanol production occurred under anaerobic conditions (C2), and xylitol was only produced under microaerobic conditions (C1), the co-production of these metabolites was evaluated through two sequential phases: an initial anaerobic phase to facilitate glucose consumption and prevent potential repression, followed by a microaerobic phase to enhance xylose metabolism and xylitol production. During the anaerobic phase, which lasted 24 h, 100% of the glucose was consumed (Figure 4A) (Table S5). Upon initiating the subsequent microaerobic phase by introducing air, xylose consumption began, reaching 94.7% by 80 h.

Ethanol production peaked at 30.90 g/L, corresponding with total glucose consumption. While no significant differences were observed when compared to the C2 condition, a notable difference emerged from C1, which operates under microaerobic conditions. The above confirms that anaerobic conditions enhance ethanol production from glucose in C. lusitaniae. Nevertheless, it should be noted that C. lusitaniae could produce ethanol at low oxygen tensions.

It was observed that ethanol produced in the C1 condition and during the aeration phase in the C3 condition was removed from the culture medium via venting. This loss was substantial, with ethanol titers decreasing to 71.23% and 67.09% in the C3 and C1 conditions, respectively. However, this situation presents two potential advantages. First, removing ethanol from the culture medium reduces its toxicity to the yeast. Second, ethanol can be effectively recovered from the vent stream through pervaporation, a separation process that employs selective polydimethylsiloxane (PDMS) membrane, thereby facilitating the recovery of this metabolite [31,32]. Future research will focus on utilizing this technique to recover ethanol, thereby facilitating the subsequent recovery of xylitol through crystallization.

The onset of xylitol production in C3 began with the consumption of xylose, once aeration was initiated, reaching a maximum titer of 11.99 g/L at 80 h. The aforementioned value was 16.15% lower than that observed in C1, but 71.26% higher than that observed in C2 (Figure 4B, Table S6 and Table 3). The decrease in xylitol production may have been due to the phase change from anaerobic to microaerobic causing a delay in xylose assimilation. As observed, xylose consumption and xylitol production were significantly and adversely affected under anaerobic conditions (C2 and the initial phase of C3). This finding underscores the critical role of oxygen in xylose metabolism by C. lusitaniae.

Candida guilliermondii FTI 20037 produces xylitol from SCB hydrolysates. This yeast was immobilized and grown on porous glass beads, producing 13.1 g/L xylitol at an aeration rate (AR) of 31 mL/min. As the AR increased to 93 mL/min, biomass increased, but xylitol production decreased by 22%. The authors demonstrated that microaerobic conditions favor xylitol accumulation [33].

Dasgupta et al. [34] cultured Kluyveromyces marxianus IIPE453 on SSCB, showing the ability of the yeast to co-produce ethanol and xylitol under microaerobic conditions at 0.025 vvm at 200 rpm. The ethanol yield was 0.45 g_EtOH/g_Glu, while the xylitol yield was 0.315 g_XOH/g_Xyl.

On the other hand, Spathaspora hagerdaliae UFMG-CM-Y303 was grown on SCB hydrolysates at the reactor scale. Under aerobic conditions, xylose was consumed for yeast growth. In contrast, under microaerobic conditions, xylitol production was favored, with a xylitol production of 3.5 g/L, 10-fold higher than the value obtained under aerobic conditions [35]. Da Silveira et al. [36] evaluated xylitol production by Meyerozyma guilliermondii UFV-1 by varying agitation and xylose concentration using response surface (RS). The highest xylitol titer was 51.88 g/L at 150 rpm and 90 g/L xylose, whereas at 50 rpm and 90 g/L xylose, only 2.18 g/L xylitol was obtained. In Spathaspora passalidarum NRRL Y-27907, the effectiveness of various aeration conditions was assessed, finding that microaerobic conditions were optimal for both xylitol production and xylose consumption [37].

Some studies have explored a variety of fermentation strategies for the co-production of ethanol and xylitol from saccharified lignocellulosic biomass, with a particular focus on SCB. These strategies generally involve two separate fermentation stages to optimize the conversion of sugars to both products. In the first anaerobic stage, Saccharomyces cerevisiae, a well-known ethanol-producing yeast, ferments glucose derived from the hydrolysis of the SCB. This stage is highly efficient due to S. cerevisiae’s well-established metabolic pathways and tolerance to ethanol, making it the yeast of choice for ethanol production in industrial processes. In the second stage, xylose-rich syrups obtained from the hydrolysis of hemicellulose are inoculated with unconventional yeasts such as Candida tropicalis [14] or Candida guilliermondii TISTR 5068, which are capable of converting xylose to xylitol [15].

An alternative two-stage strategy involves the use of Pichia guilliermondii RLV-04 (MH588234.1), which ferments xylose to xylitol in the first stage, followed by the production of ethanol from glucose in the second stage, again using S. cerevisiae [16]. While these strategies are effective, they often face challenges related to the coordination of two separate fermentation phases, which can increase the process’s overall complexity, time, and cost.

In contrast, the co-production of ethanol and xylitol in a single fermentation system would greatly simplify the process by eliminating the need for separate fermentation stages. This approach, which could integrate the anaerobic and microaerophilic phases into a single bioreactor and microorganism, would streamline the entire process and offer several potential advantages. A single-reactor system would reduce the need for complex fermenter configurations, simplify the overall process design, and potentially reduce operational costs.

To the best of our knowledge, there are no published studies on the co-production of ethanol and xylitol by C. lusitaniae from saccharified lignocellulosic biomass (LCB) using a unified fermentation system that includes both anaerobic and microaerophilic phases. C. lusitaniae uses xylose as a carbon source and has potential tolerance to both the fermentation environment and ethanol accumulation.

This research could fill a significant gap in the current literature by demonstrating the feasibility of a single-phase fermentation process that simultaneously produces both ethanol and xylitol, thereby simplifying the bioconversion of lignocellulosic biomass. Such an integrated process could offer substantial advantages in terms of efficiency and cost-effectiveness, particularly for large-scale industrial applications. Furthermore, this work may contribute to advancing the sustainability of biofuel and bioproduct production by utilizing waste biomass more efficiently and economically viable.

Future research could focus on optimizing the fermentation conditions, scaling up the process, and evaluating such a co-production system’s economic and environmental benefits.

Another factor that may adversely affect xylose consumption in the microaerobic condition (C1) is the presence of glucose. The consumption of xylose and xylitol production were delayed while glucose remained in the medium; since an increase in the consumption rate of xylose was observed once glucose levels were nearly depleted. Similarly, during the microaerobic phase of the C3 condition, a delay in xylose consumption was noted, likely attributable to residual glucose and the adaptation of cells to the microaerobic environment, resulting in an extended lag phase. Glucose has been shown to inhibit xylose consumption and xylitol production in Candida shehatae TISTR 5843. This was demonstrated by cultivating the organism in YM medium with varying glucose/xylose ratios of 4:0, 3:1, 1:1, 1:3 and 0:4, respectively. These experiments determined that the rate of xylose consumption and xylitol production decreased significantly as glucose concentrations increased in the culture medium. The above suggests that glucose concentration also influences the inhibitory effect on xylose consumption in C. shehatae [38]. Cryptococcus curvatus, an oleaginous yeast, was grown in a 70 g/L xylose/glucose mixture (35 g/L of each sugar) to produce lipids for biofuel. C. curvatus started to consume the xylose when the glucose in the medium was below 3 g/L. The authors indicated that the consumption of xylose was repressed by glucose [39]. In Spathaspora passalidarum NRRL Y-27907, sequential sugar consumption was observed, with xylose consumption commencing after a specific concentration of glucose in the medium was depleted, thereby illustrating the effect of catabolic repression [37].

Regarding D-arabitol accumulation, C3 had a titer of 2.3 g/L at 80 h in the microaerobic phase, a value 65.22 and 69.57% higher than those observed in C1 and C2 conditions, respectively. This production could have affected xylitol yield since xylose was used as a substrate for D-arabitol, reducing xylitol production by 16% compared to C3. The accumulation of D-arabitol could result from the reduction of xylulose to D-arabitol by NAD-dependent D-arabitol dehydrogenase [40] (Figure 1). This observation suggests that future studies on C. lusitaniae should focus on elucidating the expression of genes involved in the synthesis of enzymes responsible for D-arabitol synthesis [41].

Table 3 summarizes the various parameters of C. lusitaniae under the three conditions evaluated and compares them with those of related microorganisms. The results demonstrate that this yeast exhibits relatively high productivity, yield, and efficiency in ethanol and xylitol production, comparable to the performance of other microorganisms cultivated under analogous conditions and employed for this purpose.

3.2. XR and XDH Enzymatic Activities and Expression Levels of XYL1 and XYL2 Genes

To investigate the correlation between xylose consumption and xylitol production under the various experimental conditions tested, the activities of XR and XDH, as well as the expression levels of the XYL1 and XYL2 genes, were quantified, analyzed, and discussed in parallel.

3.2.1. Microaerobic Condition (C1)

When C. lusitaniae was cultivated under microaerobic conditions (C1), the activity of XR enzyme increased by 19 fold at 24 h and by 20 fold at 48 h compared to the 0 h (Figure 5) (Table S7). The XR activity at 24 h correlated with the complete glucose consumption and the initiation of xylose consumption. Maximum XR activity of 2.88 U/mg was observed at 48 h, coinciding with increased xylose consumption and xylitol accumulation. Subsequently, XR activity declined to 2.34 U/mg at 80 h. On the other hand, XDH activity increased by 7.8 fold from 0 to 24 h, whereas there was a 2.4-fold increase from 24 to 48 h, which corresponds to the observed increase in xylose consumption (Table 3). The activity of XDH, however, remained unchanged from 48 to 80 h, which was associated with the continued accumulation of xylitol in the culture medium (Figure 5).

Regarding the XYL1 and XYL2 genes, a significant increase in XYL1 gene expression levels was observed over time, reaching 32.8-fold the initial level at 72 h. This rise in XYL1 expression (Figure 6 and Table S8) correlated with enhanced XR activity and increased xylitol production under the C1 condition. The xylose consumption rate enhanced between 48 and 64 h, aligning with high XR activity and elevated XYL1 expression.

In contrast, the XYL2 gene exhibited a different expression profile than XYL1, with lower expression levels that peaked at 24 h and were maintained throughout the experimental period (Figure 6). This pattern coincided with the peaks of XDH activity observed at various time points. Notably, XYL2 expression decreased slightly at 80 h, while XDH activity remained unchanging. These findings support the hypothesis that xylitol accumulation in C. lusitaniae results from decreased XYL2 gene expression and reduced XDH activity.

3.2.2. Anaerobic Condition (C2)

The XR and XDH activities of C. lusitaniae grown under anaerobic conditions (C2) were significantly lower than those of the C1 condition. The maximum activities recorded for XR and XDH were 0.52 U/mg and 0.10 U/mg, respectively, and were measured up to 80 h (Figure 7 and Table S9). These values were 4.5- and 16.9-fold lower than the maximum XR and XDH activities observed in the C1 condition. Regarding the XYL1 gene, the expression levels increased compared to the initial measurement, reaching a maximum of 12.35 fold at 80 h (Figure 8). Nevertheless, this value represented approximately 50% of the maximum expression observed in the C1 condition. The reduction in XYL1 expression is associated with a decline in xylose consumption and XR activity under anaerobic conditions. In contrast, XYL2 expression was only detectable at 0 and 24 h, exhibiting a sevenfold reduction in expression compared to the same time points in C1 (Figure 8) (Table S10). The reduced expression levels of XYL1 and XYL2 and the diminished activities of the corresponding enzymes are likely responsible for inadequate xylose consumption and restricted xylitol accumulation under anaerobic conditions. The aforementioned findings indicate that xylose consumption is more effective in the presence of oxygen, whereas xylitol accumulation is favored under microaerobic conditions.

3.2.3. Sequential Anaerobic/Microaerobic Phases (C3)

In sequential anaerobic/microaerobic conditions (C3), both XR and XDH activities were slightly lower compared to those observed in C1 condition (Figure 5). XR activity increased throughout the process, becoming particularly pronounced once glucose was depleted from the medium and the transition to the microaerobic phase occurred. This increase coincided with the onset of xylose consumption. The highest peak of XR activity was recorded at 80 h, reaching 2.03 U/mg, which was slightly lower than the activity observed at the same time point in C1 (Figure 9). In contrast, XDH activity increased to a lesser extent, reaching 0.66 U/mg at 72 h, which coincided with the highest accumulation of xylitol in the culture medium (Figure 9 and Table S11).

In the sequential anaerobic/microaerobic conditions (C3), XYL1 expression exhibited a 4.89-fold increase at 24 h compared to the level at 0 h, coinciding with complete glucose consumption and the onset of aeration. However, this expression was approximately 30% lower than that observed under aerobic conditions (C1) (Figure 6). The delay in XYL1 expression in C3 can be attributed to the transition in aeration conditions and the presence of glucose in the medium. The residual glucose in the medium was 21.1 g/L at 16 h, exhibiting a complete consumption at the 24 h, while in C1 the complete consumption of glucose was at 16 h. Nonetheless, XYL1 expression continued to rise, reaching a maximum value of 29.28 at 72 h (Figure 10), which is very close to the peak observed in the C1 condition. Notably, the increase in XYL1 gene expression levels paralleled the rise in XR activity during these times. In contrast, XYL2 expression was observed to be approximately twofold lower at 24, 48, and 72 h than in C1, and no XYL2 expression was detected at 80 h (Figure 10 and Table S12).

In C. lusitaniae, a consistent pattern of xylose consumption and xylitol accumulation was observed across the three conditions tested, reflecting the activities of XR and XDH. XR activity and gene expression may be regulated by glucose since after total glucose consumption at 16 h in C1 and at 24 h in C3, XYL1 expression and XR activity increased compared to 0 h, as well as the acceleration of xylose consumption. In C2, after complete glucose consumption at 24 h, there were no significant differences in the increase of XR activity nor in xylose consumption. However, XYL1 expression increased by 48% from 24 to 48 h but did not reach the levels observed in C1 and C3 (microaerobic phase).

The results regarding the activity of XR and XDH enzymes and the expression of the XYL1 gene confirm that glucose in the culture medium significantly influences both xylose consumption and xylitol production.

To our knowledge, there are no published studies on regulating XR and XDH gene expression and corresponding enzyme activity in Clavispora lusitaniae. Future research will aim to elucidate this species’ regulatory mechanisms governing xylose metabolism. However, the regulation of enzymes involved in the oxidative-reductive pathway of xylose assimilation has been documented in other non-conventional yeasts, highlighting the need for further investigation in C. lusitaniae.

In Candida guilliermondii, the impact of varying glucose:xylose ratios in sugarcane bagasse hydrolysate on the activities of XR and XDH was evaluated. An increased glucose:xylose ratio led to a lag phase in xylose consumption at a ratio of 1:2.5 likely due to catabolic repression of xylose utilization by glucose. Furthermore, the activities of XR and XDH decreased as the glucose:xylose ratio increased [42]. In Candida tropicalis DSM 7524, XR and XDH activities were evaluated under aerobic conditions with xylose, glucose, fructose, lactose, maltose, and sucrose as carbon sources. The study revealed that XR and XDH activities were enhanced in the presence of xylose. In contrast, when glucose or fructose served as the carbon source, the yeast did not exhibit XR and XDH activity [43]. The presence of glucose in Spathaspora passalidarum NRRLY 27907 cultures delayed or inhibited xylose consumption, indicating repression of xylose metabolism by this hexose. This effect occurred independently of oxygen levels. Likewise, the corresponding genes’ low expression could have resulted from glucose interference with xylose transport or the reported mechanism of glucose repression [44].

Regarding xylitol production, it has been reported that overexpression of the XYL1 gene, in conjunction with low XDH activity and reduced or absent expression of the XYL2 gene in Debaryomyces hansenii, promotes xylitol accumulation and enhances its yield [45]. For instance, in Meyerozyma guilliermondii, the overexpression of XYL1 and deletion of the XYL2 gene significantly increased xylitol production. However, this mutant strain could not grow on xylose as the sole carbon source. The culture medium was, therefore, supplemented with glucose, which was used as a carbon source for initial yeast growth, optimizing xylitol production [46]. Kim et al. [47] explored the introduction of Scheffersomyces stipitis-derived XYL1, XYL2, and XYL3 genes into a recombinant S. cerevisiae strain (YSX3) to improve ethanol production from xylose. Despite this genetic modification, the expression levels of XYL2 were insufficient, resulting in inadequate XDH activity and subsequent accumulation of xylitol in the culture medium.

Then, in addition to glucose regulation, it was observed that aeration also influenced XR activity and XYL1 expression. The expression levels of the XYL1 and XYL2 genes in C. lusitaniae were significantly higher under microaerobic conditions (C1) and during the microaerobic phase of C3, compared to the anaerobic condition (C2), with expression levels in C2 being approximately 50% lower.

The availability of oxygen is a crucial factor in the metabolism of D-xylose in certain non-conventional yeast. Reduced aeration has been shown to enhance the rate of xylitol production. According to several studies, the accumulation of xylitol is primarily driven by an NADPH/NAD+ imbalance caused by limited oxygen availability, which results in a reduced cellular respiratory rate. Under oxygen-limiting conditions, the metabolic pathway shifts toward xylitol production. The decreased respiration leads to elevated intracellular NADH levels, which act as inhibitors of xylitol dehydrogenase, a crucial regulatory mechanism that redirects the flux of xylose toward xylitol accumulation [48,49].

For instance, Pichia guilliermondii favored xylitol production under conditions of very low volumetric oxygen transfer coefficient (k_La) of 0.075 h⁻¹ [50]. The expression of the XYL1 and XYL2 genes in Hansenula polymorpha grown on xylose was found to be favored by aeration conditions. Specifically, the expression of the XYL1 gene increased by 7.73 and 6.45 fold, respectively, under aerobic and microaerobic conditions compared to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (TDH3) expression. In contrast, the XYL2 gene exhibited a 3.41- and 1.87-fold increase in expression under the aforementioned conditions compared to the level of expression of TDH3. The above results suggest that both genes are important in aerobic xylose metabolism and xylitol accumulation [51]. During the bioconversion of xylose to xylitol in non-detoxified oil palm empty fruit bunch hydrolysate by Candida tropicalis, the highest xylose consumption (95.5%) and maximum xylitol production (5.46 g/L) were observed at 30% dissolved oxygen and 50 rpm. The maximum xylose reductase (XR) activity was achieved under the same dissolved oxygen and agitation rate conditions. As mentioned, dissolved oxygen is a critical factor influencing xylitol production, as it directly affects XR activity in C. tropicalis and subsequently impacts xylitol production. Oxygen availability also influences XR’s preference for NADH or NADPH, thereby modulating the activity of xylitol dehydrogenase (XDH) and contributing to the redox imbalance in the xylose assimilation pathway [52].

Studies on the impact of oxygen concentration on the xylose assimilation pathway and cofactor imbalance in S. passalidarum NRRL Y-27907^T revealed that XR activity was higher under microaerobic conditions than under anaerobiosis, regardless of coenzyme usage. At highest k_La (45 h⁻¹), XR preferentially utilized NADH, whereas under aerobic conditions, NADPH was preferred. Under fully aerated conditions, xylitol dehydrogenase activity was low due to XR’s preference for NADPH, leading to an accumulation of NADP⁺ and a reduction in NAD⁺ availability [37].

The xylose reductase of S. passalidarum NRRL Y-27907^T preferentially utilizes NADH under aerobic conditions and NADPH under microaerobic conditions. Transcriptomic analysis revealed two paralogous XYL1 genes, each activated under distinct aeration conditions. The XYL1.1 gene is expressed in the presence of oxygen, encoding an XR that favors NADPH. In contrast, XYL1.2 is upregulated under low-oxygen conditions, encoding an XR with a preference for NADH [12,53].

In Clavispora lusitanaie, only one gene, XYL1, encoding an NADPH-dependent XR, has been detected, resulting in a cofactor imbalance that limits the NAD⁺ pool for XDH activity [10].

4. Conclusions

Clavispora lusitaniae is a non-conventional yeast with significant potential in lignocellulosic biorefineries co-producing ethanol and xylitol from saccharified sugarcane bagasse (SSCB). When cultivated in SSCB, the yeast achieves its highest ethanol titer of 31.8 g/L under anaerobic conditions, compared to 18.1 g/L under microaerobic conditions. In contrast, the highest xylitol titer of 14.3 g/L is attained under microaerobic conditions, a value 3.5-fold greater than that observed under anaerobic conditions. These results emphasize the critical role of aeration conditions in optimizing xylose metabolism and balancing the co-production of ethanol and xylitol from SSCB.

A strategy involving an initial anaerobic phase followed by a microaerophilic phase promotes the co-production of ethanol and xylitol by C. lusitaniae, as the titers of both metabolites under this two-phase approach are like those obtained under pure anaerobic (C2) and microaerobic (C1) conditions, respectively. Furthermore, the higher accumulation of xylitol in C. lusitaniae is attributed to increased xylose reductase activity (XR) relative to xylitol dehydrogenase activity (XDH) under microaerophilic conditions, which is consistent with the higher expression of the XYL1 gene compared to XYL2.

These findings underscore the potential of C. lusitaniae for efficient co-production of biofuels and biochemicals from lignocellulosic feedstocks, providing valuable insights into optimizing aeration conditions for enhanced metabolic flux toward both ethanol and xylitol production.