Next Article in Journal
Nutritional Enhancement of Plant-Based Fermented Foods: Microbial Innovations for a Sustainable Future
Previous Article in Journal
Ethanol and Xylitol Co-Production by Clavispora lusitaniae Growing on Saccharified Sugar Cane Bagasse in Anaerobic/Microaerobic Conditions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fermentation
Volume 11
Issue 6
10.3390/fermentation11060345
fermentation-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

CRISPRa-Mediated Triple-Gene Activation of ARO10, ARO80, and ADH2 for Enhancing 2-Phenylethanol Biosynthesis via the Ehrlich Pathway in Saccharomyces cerevisiae

by
Zijing Zhu
,
Shuaihu Fang
,
Pingping Huang
,
Dianqiang Luo
and
Xiaobao Qi
*
College of Food Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
*
Author to whom correspondence should be addressed.
Fermentation 2025, 11(6), 345; https://doi.org/10.3390/fermentation11060345
Submission received: 5 May 2025 / Revised: 4 June 2025 / Accepted: 11 June 2025 / Published: 12 June 2025
(This article belongs to the Section Microbial Metabolism, Physiology & Genetics)
Browse Figures
Versions Notes

Abstract

2-phenylethanol (2-PE), a rose-like fragrance compound, is widely used in the food industry. Conventional chemical synthesis of 2-PE faces significant challenges due to environmental concerns and consumer preferences; thus, using Saccharomyces cerevisiae (S. cerevisiae) for 2-PE biosynthesis has become a preferable option. This study aimed to develop a CRISPR activation (CRISPRa)-mediated S. cerevisiae engineered strain for efficient 2-PE biosynthesis by activating Ehrlich pathway key genes ARO10, ARO80, and ADH2. Three guide sequences (GSs) were designed for each gene ARO10, ARO80, and ADH2, and nine single-gene CRISPRa strains were constructed. Gene expression levels, 2-PE concentrations, and cell density were quantified using quantitative real-time PCR (qPCR), high-performance liquid chromatography (HPLC), and OD600 measurement, respectively. The optimal GSs of ARO10, ARO80, and ADH2 were selected based on 2-PE concentrations of corresponding strains. The triple-gene CRISPRa strain INVScI-ARO10-ARO80-ADH2 achieved a 214.04 mg/L 2-PE titer after 48 h, representing a 77.62% increase over the control with no significant effect on cell growth. These findings demonstrate that CRISPRa-mediated multi-gene activation constitutes a robust strategy for engineering high-performance 2-PE production systems in S. cerevisiae.

1. Introduction

2-phenylethanol (2-PE), a key aroma compound in fermented food, is extensively employed as a food additive owing to its characteristic floral fragrance [1], antimicrobial efficacy [2], and preservative properties [3]. The CAGR (compound annual growth rate) of the global 2-PE market is sustainably increasing, with projections exceeding USD 350 million by 2027 [4]. Conventional 2-PE production methods, including flower extraction and chemical synthesis, face significant challenges such as low yields [5], high costs [6], environmental impacts [7], and consumer preferences [8]. In contrast, 2-PE biosynthesis in Saccharomyces cerevisiae (S. cerevisiae) has emerged as an optimal solution, attributed to its complete metabolic pathway, robust fermentation capabilities, and safe product output [1,7]. The primary 2-PE biosynthetic pathways in S. cerevisiae include the shikimate pathway and the Ehrlich pathway (Figure 1).
2-PE synthesis through the shikimate pathway requires complex enzymatic steps, multiple branching pathways, and inhibitory feedback mechanisms [9]. On the other hand, only three core catalytic steps convert L-Phe to 2-PE through ARO8/ARO9-mediated transamination, ARO10-driven decarboxylation, and ADH-family facilitated reduction in the Ehrlich pathway [10]. The transcription activation of ARO9 and ARO10 is regulated by ARO80, an aromatic amino acid-responsive transcription factor [11]. Consequently, the Ehrlich pathway in S. cerevisiae demonstrates superior biosynthesis efficiency and simpler regulation for 2-PE biosynthesis. Previous engineering strategies have enhanced 2-PE production by overexpressing key genes ARO8, ARO9, ARO10, ARO80, and ADH1/2/5/6/7 [12,13,14,15,16,17,18] and knocking out important branching genes ALD2 and ALD3 [13,14,19]. ADH2 was selected due to its proven efficacy in multi-gene co-activation for 2-PE synthesis and its role in glucose repression (unpublished data). Implementing promoter replacement and gene overexpression typically requires time-consuming experimental procedures, which may negatively impact host cell growth and cause plasmid instability [20]. To overcome the above difficulties, Clustered Regularly Interspaced Short Palindromic Repeats activation (CRISPRa) can easily enhance multi-gene expression by precisely targeting their promoter regions at the same time [21].
Given the limited research on 2-PE biosynthesis in S. cerevisiae using CRISPRa, this study employed CRISPRa to activate key genes ARO10, ARO80, and ADH2 in the Ehrlich pathway to enhance 2-PE production. Nine specific guide sequences (GSs) targeting the promoter regions of these genes were designed, and corresponding single-gene activation strains were constructed using the CRISPRa system. The engineered strains were characterized by measuring 2-PE concentrations using high-performance liquid chromatography (HPLC), gene expression levels using quantitative real-time PCR (qPCR), and growth status via OD600 measurements. The most efficient GSs for ARO10, ARO80, and ADH2 were selected to construct the triple-gene activation strain INVScI-ARO10-ARO80-ADH2 to maximize 2-PE biosynthesis. This study provides an effective strategy for engineering yeast strains to improve 2-PE yields, laying a foundation for scalable 2-PE production in S. cerevisiae.

2. Materials and Methods

2.1. Plasmids, Strains, Primers, and GS Oligonucleotides

All of the plasmids and strains are listed in Table 1 and Table 2. The primers and oligonucleotides were synthesized by Tsingke (Wuhan, China) and are listed in Tables S1 and S2.

2.2. Media and Cultivation Conditions

  • Media for cultivation
Escherichia coli DH5α was cultured and selected in LB (Luria–Bertani) medium (HOPEBIO, Qingdao, China), containing 10 g/L tryptone, 5 g/L yeast extract, and 10 g/L NaCl, and supplemented with 100 mg/L ampicillin or 20 g/L agar as required.
S. cerevisiae was cultured in YPDA (Yeast Extract Peptone Dextrose Adenine) medium (HOPEBIO, Qingdao, China), containing 20 g/L glucose, 20 g/L tryptone, 10 g/L yeast extract, and 0.03 g/L adenine sulfate, and supplemented with 20 g/L agar as required.
  • Media for selection
SD-URA with Agar (WEIDI, Shanghai, China): 6.7 g/L Yeast Nitrogen Base (YNB), 0.78 g/L DO supplementUra, 20 g/L agar, and 20 g/L glucose.
SD-URA-TRP with Agar (WEIDI, Shanghai, China): 6.7 g/L YNB, 0.72 g/L DO supplement-Trp/-Ura, 20 g/L agar, and 20 g/L glucose.
  • Media for fermentation
A total of 20 g/L glucose, 4 g/L yeast extract, 6.7 g/L L-phenylalanine (L-Phe), 3 g/L KH2PO4, and 0.5 g/L MgSO4·7H2O, in a 1 mL concentrated trace element solution. The pH was adjusted to 6 with KOH.
Concentrated trace element solution: 0.05 g/L CuSO4·5H2O, 2 g/L FeSO4·7H2O, 0.2 g/L MnCl2·4H2O, 2 g/L CaCl2·2H2O, and 0.5 g/L ZnCl2 in 2 mol/L HCl were dissolved in 2 mol/L HCl and diluted to 1 L with deionized water.
  • Cultivation conditions
Escherichia coli strains were cultured and screened in LB medium or LB–ampicillin medium in a shaker or incubator at 37 °C, 180 rpm, for 12–16 h.
Yeast strains were cultured and screened in YPDA medium, fermentation medium, and SD-URA or SD-URA-TRP medium in a shaker or incubator at 30 °C, 180 rpm, for 24–72 h.

2.3. Reagents and Instruments

Reagents: The restriction endonucleases BclI, SmiI, MluI, and KpnI were purchased from Thermo Fisher Scientific (Waltham, MA, USA). T4 DNA ligase, Fast Plasmid Miniprep Kit, Gel Mini Purification Kit, EX-Yeast Transformation Kit, and Yeast Total RNA Kit were all obtained from ZOMANBIO (Beijing, China).
Instruments: PCR amplification was performed using the MG48+ thermal cycler (LongGene, Hangzhou, China), and qPCR was performed with the Quant Studio 3 qPCR system (Applied Biosystems, Thermo Fisher Scientific, USA). HPLC analysis of 2-PE was performed using the e2695 HPLC system (Waters, Milford, MA, USA). OD600 measurements were carried out with the UV-1800 UV-Vis spectrophotometer (Shanghai Precision Instrument, Shanghai, China).

2.4. GS Design for ARO10/ARO80/ADH2

The ARO10 [NC_001136.10], ARO80 [NC_001136.10], and ADH2 [NC_001145.3] sequences were retrieved from the NCBI database (https://www.ncbi.nlm.nih.gov/) (accessed on 15 June 2024). To investigate the relationship between the gene activation efficiency of different GSs and the 2-PE concentrations, three specific GSs were designed for each of ADH2, ARO10, and ARO80 using CRISPOR (http://crispor.tefor.net/) (accessed on 15 June 2024) and Benchling CRISPR (https://benchling.com/crispr/) (accessed on 15 June 2024). From the designed sequences, GSs with high specificity, high predicted efficacy, and low off-target effects were selected. The locations and sequences of GSs are presented in Figure 2 and Table 3.

2.5. Construction of ARO10, ARO80, and ADH2 Single-Gene Activation Series Engineered Strains

The GSs were annealed to form double-stranded fragments [22] and cloned into the p426-gRNA-BclⅠ-SmiⅠ vector [23] using restriction enzymes BclⅠ, SmiⅠ, and T4 DNA ligase. The resulting plasmids p426-gRNA.ARO10, p426-gRNA.ARO80, and p426-gRNA.ADH2 were transformed into Escherichia coli DH5α, selected on LB-ampicillin plates, and verified by PCR and DNA sequencing. Subsequently, the p426-gRNA.ARO10, p426-gRNA.ARO80, and p426-gRNA.ADH2 plasmids were co-transformed into yeast cells along with pAG414GPD-dCas9-VPR using the PEG/LiAc method [24]. Positive transformants were selected on SD-URA-TRP plates, and the successful construction of the INVScI-ARO10/ARO80/ADH2 series engineered strains was confirmed by PCR and DNA sequencing. The construction schematic diagram of single-gene activation series engineered strains is shown in Figure 3.

2.6. Optimal GS Screening of ARO10, ARO80, and ADH2

To screen the most efficient GS for each gene, 2-PE concentrations of INVScI-ARO10/ARO80/ADH2 series engineered strains were determined by HPLC. The corresponding GSs of the strains with the highest 2-PE yields were selected as the optimal GSs.

2.7. Construction of INVScI-ARO10-ARO80-ADH2 Engineered Strain

To construct the triple-gRNA plasmid p426-gRNA.ARO10-ARO80-ADH2, the plasmid p426-gRNA.ADH2 was digested with restriction enzymes MluⅠ and KpnⅠ to obtain a 6179 bp vector backbone. The gRNA expression cassettes of ARO80 and ARO10 were amplified from p426-gRNA.ARO80 and p426-gRNA.ARO10 using primers containing MluⅠ and KpnⅠ recognition sites. The two gRNA expression cassettes were fused by overlap extension PCR (OE-PCR), and the fusion fragment was then digested with MluⅠ and KpnⅠ and cloned into the vector backbone. The successful construction of p426-gRNA.ARO10-ARO80-ADH2 was confirmed by PCR and DNA sequencing. Finally, the plasmid was co-transformed into yeast cells along with the dCas9-VPR plasmid, and the engineered strain INVScI-ARO10-ARO80-ADH2 was further validated by PCR and DNA sequencing. The schematic diagram of plasmid p426-gRNA.ARO10.ARO80.ADH2 construction and triple-gRNA cassette is displayed in Figure 4.

2.8. Analytical Methods

2.8.1. Quantitative Real-Time PCR (qPCR) for Gene Expression Analysis

To investigate the gene expression levels of ARO9, ARO10, ARO80, and ADH2, engineered strains at the mid-log phase (12 h) were collected, and total RNA was extracted. Subsequently, 1 µg of RNA was reversely transcribed into cDNA, and the relative expression levels of ARO10, ARO80, and ADH2 were quantified using qPCR. The housekeeping gene ACT1 in S. cerevisiae was used as a reference gene, and relative gene expression levels were calculated using the 2−ΔΔCt method [25]. The starting strain served as the baseline control with its gene expression level normalized to 1.0.

2.8.2. High-Performance Liquid Chromatography (HPLC) for 2-PE Quantification

To determine 2-PE production in the engineered strain, the HPLC assay followed our lab-established method with minor modifications [23]. Fermentation samples were taken at 6 h, 12 h, 24 h, and 48 h, respectively. The solutions were filtered through a 0.22 μm filter, and the elution time was 16 min. The retention time, peak height, and peak area were automatically recorded by using HPLC software Empower 3. The standard curve was plotted using 2-PE standard solutions with concentrations ranging from 25 mg/L to 250 mg/L, and the peak areas versus concentrations showed a strong linear relationship (R2 = 0.9998). The 2-PE concentrations in the sample were calculated by the measured peak area using the standard curve equation.

2.8.3. Cell Density (OD600) Measurement

A fresh and well-grown single colony of S. cerevisiae (about 2 mm in diameter) in YPDA plates was inoculated into 3 mL of the fermentation medium for overnight incubation at 30 °C as seed solution. Subsequently, the seed solution was transferred to a fresh fermentation medium with an initial OD600 of 0.1–0.2. The cultures were incubated in a shaking incubator at 30 °C, 180 rpm, and OD600 values were measured at 6 h, 12 h, 24 h, and 48 h after the start of fermentation.

2.9. Statistical Analysis

All experiments were independently conducted in triplicate. The results are presented as the mean ± standard deviation (SD). Statistical analyses were performed using GraphPad Prism® (version 9.5, GraphPad Software Inc., San Diego, CA, USA), employing either One-way ANOVA or Two-way ANOVA. The significance levels in the analyses are denoted as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.

3. Results

3.1. Construction, 2-PE Concentrations, Gene Expression Levels, and Growth Analysis of Single-Gene Activation Engineered Strains

The PCR (Figure S1) and sequencing results of specific GSs (Figure S2) confirm the successful construction of INVScI-ADH2, INVScI-ARO10, and INVScI-ARO80 series of single-gene activation strains. To screen for the single-gene activation strain with the highest 2-PE production for each target gene, the 2-PE yields of the nine strains were determined by HPLC. The results show that seven of the nine strains exhibited a significant 2-PE increase (Figure 5). Among them, INVScI-ARO10-1 achieved the highest 2-PE concentration of 156.88 mg/L, representing a 30.19% increase over the control (Figure 5A). In the INVScI-ARO80 series strains (Figure 5B), INVScI-ARO80-1 produced 150.54 mg/L of 2-PE, a 24.92% increase. For the INVScI-ADH2 series strains (Figure 5C), only INVScI-ADH2-3 significantly increased 2-PE production by 14.72%, reaching 138.24 mg/L.
To explore the correlation between growth and 2-PE synthesis in high-yield strains, 2-PE concentrations and OD600 values of INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 were determined at 6 h, 12 h, 24 h, and 48 h of fermentation (Figure 6). At 6 h and 12 h of fermentation, the 2-PE concentrations of all three strains had no significant differences compared to the control. By 24 h, INVScI-ARO10-1 and INVScI-ARO80-1 started to reveal notable increases in 2-PE concentrations. Finally, the 2-PE concentrations of INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 reached 156.88 mg/L (a 30.19% increase), 150.54 mg/L (a 24.92% increase), and 138.24 mg/L (a 14.72% increase) compared to the control, respectively. Figure 6B displays that, except for INVScI-ARO10-1, which exhibited a notable 14.5% higher OD600 value than the control at 12 h, OD600 values of both INVScI-ARO80-1 and INVScI-ADH2-3 had no significant differences from the control throughout fermentation. These results indicate that the activation of ARO80 and ADH2 had little effect on strain growth, while ARO10 activation promoted the growth of INVScI-ARO10-1 during the logarithmic phase. The asynchronous relationship of 2-PE production and strain growth suggests that the high 2-PE concentrations of these strains primarily arise from metabolic pathway reconstruction rather than biomass accumulation.
To investigate the effects of GS design on gene activation efficiency and 2-PE production, three sets of GSs targeting different sites upstream of the transcription start site (TSS) and DNA strands within the promoter regions of the ARO10, ARO80, and ADH2 genes were designed. The target positions are shown in Figure 2. The mRNA expression levels of target genes in the nine engineered strains are presented in Figure 7.
Figure 7 shows that, except for INVScI-ADH2-1, all single-gene activation strains have significantly higher target gene expression than the control, and that the activation efficiency of the three genes is ranked in descending order as ARO10, ARO80, and ADH2. Among the GSs targeting ARO80 (Figure 7B) and ADH2 (Figure 7C), significant differences in activation efficiency are observed, while GSs targeting ARO10 show no significant differences (Figure 7A), which might be due to the proximity of ARO10 GSs. The highest relative expression levels and corresponding GSs of these genes are 3.55-fold for ARO10 (gRNA.ARO10-1, PAM +337 bp), 2.34-fold for ARO80 (gRNA.ARO80-1, PAM +187 bp), and 2.01-fold for ADH2 (gRNA.ADH2-3, PAM -334 bp). Their corresponding strains INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 exhibit 30.19%, 24.92%, and 14.72% increases in 2-PE yields over the control, respectively (Figure 5). These results confirm that GS design affects the activation efficiency of target genes, and the expression levels of these genes are positively correlated with the 2-PE yields, which suggests the crucial role of GS design in CRISPRa system optimization and 2-PE production.

3.2. Construction, 2-PE Concentration Measurement, Gene Expression Level Assay, and Growth Analysis of Triple-Gene Activation Engineered Strain INVScI-ARO10-ARO80-ADH2

To simultaneously enhance the expression of three key genes in the Ehrlich pathway, the most efficient GSs from plasmids p426-gRNA.ARO10-1, p426-gRNA.ARO80-1, and p426-gRNA.ADH2-3 were cloned into the triple-gRNA expression vector p426-gRNA.ARO10-ARO80-ADH2. The PCR electrophoretic results in Figure S3 confirm the successful construction of the triple-gene activation engineered strain INVScI-ARO10-ARO80-ADH2. To investigate the relationship between 2-PE synthesis capacity and the growth of INVScI-ARO10-ARO80-ADH2, the 2-PE concentration and OD600 values of the strain were determined at 6 h, 12 h, 24 h, and 48 h of fermentation.
As shown in Figure 8A, 2-PE production in INVScI-ARO10-ARO80-ADH2 did not differ notably from the control at the early stage of fermentation. As fermentation progressed, the 2-PE concentration of the strain was significantly higher than that of the control at 12 h. At 24 h of fermentation, the synthesis rate of 2-PE reached the maximum, and the concentration of 2-PE was 69.16% considerably higher than that of the control. Finally, after 48 h of fermentation, the 2-PE concentration of INVScI-ARO10-ARO80-ADH2 was markedly increased by 77.62%, reaching 214.04 mg/L, which was substantially higher than that of all of the single-gene activation engineered strains. During the fermentation process, the OD600 values of the strain exhibited a typical microbial growth pattern: a slow increase in the lag phase, a rapid rise in the logarithmic phase, and stabilization in the stationary phase (Figure 8B). The OD600 values of INVScI-ARO10-ARO80-ADH2 were not notably different from the control at 6 h and 48 h of fermentation but were 22.9% and 7.11% significantly higher than those of the control at 12 h and 24 h, respectively. These results indicate that CRISPRa-mediated triple-gene activation increased biomass in the mid-fermentation stage. Ultimately, INVScI-ARO10-ARO80-ADH2 greatly enhanced 2-PE production without imposing a metabolic burden on cell growth.
To explore the correlation between the triple-gene co-activation efficiency and 2-PE yield increase in INVScI-ARO10-ARO80-ADH2, qPCR was used to detect mRNA expression levels of ARO10, ARO80, and ADH2. Figure 9 reveals different effects of triple-gene activation on single-gene expression. The expression levels of ARO10 and ARO80 were significantly raised to 4.36 and 2.88 times those of the control and exhibited notable increases of 22.82% and 23.08% compared to INVScI-ARO10-1 and INVScI-ARO80-1, respectively. However, the relative expression level of ADH2 was 1.77-fold and decreased by 11.94% compared to INVScI-ADH2-3.

4. Discussion

As an important tool for gene expression activation, the CRISPRa system activates gene expression by fusing dCas9 with transcriptional activators and binding to the promoter of the target gene under the guidance of sgRNA [26]. Unlike traditional methods, CRISPRa directly activates gene expression without requiring exogenous vector construction or risking insertion mutation [27]. As reported, the efficiency of CRISPR-dCas9 can be enhanced by sgRNA high-throughput screening or sequence optimization [28,29,30] and adjustment of activation domain intensity or quantity [31,32]. In addition, CRISPR-dCas9 system-based multi-gene transcription regulation can be achieved using multiple gRNAs or scRNAs targeting different genes [29,33]. Using this advantage, the gene expression of various key enzymes in metabolic pathways can be regulated to improve the yield of the target product [23,30,34,35]. In the present study, we employed the triple-gene CRISPRa system targeting Ehrlich pathway key genes ARO10, ARO80, and ADH2, improving 2-PE production successfully, which provides a reference for the biosynthesis of similar products.
The efficiency of the CRISPRa system is essential for robust transcriptional activation of the target gene. The efficiency of CRISPRa-mediated transcriptional activation hinges on sgRNA design [36,37,38], chromatin spatial constraints [39], sgRNA secondary structure [40,41], off-target effects [42], etc. Among these, sgRNA design plays a crucial role, involving the length [43], specificity [44], and GC content [45] of GS, the specificity of protospacer adjacent motif (PAM) [46], etc. Our findings indicate that CRISPRa activation efficiency is related to the targeting position of sgRNA. Except for gRNA.ADH2-1 (PAM +568 bp) and gRNA.ADH2-2 (PAM +555 bp), all other effective GSs are within the conventionally effective CRISPRa region for S. cerevisiae (50–400 bp upstream of TSS), and the reduced efficiency beyond this range likely relates to steric hindrance and the density of regulatory elements [28]. Notably, gRNA.ADH2-2 exhibits long-range activation beyond this region, possibly due to the effect of potent activation domain VPR [47] and the responsiveness of distal regulatory elements to CRISPRa [48]. These effects may be mediated through the following mechanisms: dCas9-VPR boosts gene expression by bidirectional transcription [49]; enhancers in open regions of chromatin form spatial proximity to the TSS through cyclization mechanisms [50]; dynamic changes in the 3D chromatin structure facilitate functional contact of regulatory elements with promoters, and ultimately work with dCas9-VPR to promote efficient activation of distal targets [51]. Furthermore, we observed that within the same target gene, the gene activation efficiency of different sgRNAs showed a positive correlation with the proximity of their target sites to the TSS, except gRNA.ARO80-3. However, among the sgRNAs targeting ARO80, the gRNA.ARO80-3 (PAM +51 bp) closest to the TSS showed the lowest activation efficiency, which may be due to dCas9-VPR inhibiting RNA polymerase binding to the target gene [28]. Meanwhile, no DNA strand targeting preference was observed, consistent with prior findings [21,52,53]. In short, a highly efficient CRISPRa system requires designing optimal sgRNAs within the 50–400 bp upstream region of the TSS and using receptor-specific dCas9 fused with potent activation domains like VPR. Future research should prioritize developing S. cerevisiae-specific sgRNA design tools for CRISPRa and apply strategies like optimizing sgRNA length or targeting position [36,43], integrating sgRNAs with RNA aptamers [33,43], and diversifying transcriptional domains [33] and dCas9 proteins [54] for precise and multi-modal gene regulation.
In single-gene activation strains, gene expression levels correlated positively with the 2-PE yields, and there were differences in gene activation efficiency, cell growth, and 2-PE production which were related to the functional characteristics of each gene and metabolic regulation mechanisms. INVScI-ARO10-1 achieved the highest gene activation efficiency and 2-PE yield increase, exhibiting a significant biomass advantage during the logarithmic phase of fermentation. This phenomenon may arise from two key factors: the relatively simple promoter structure of ARO10 may facilitate efficient sgRNA binding and recruitment of dCas9-VPR [11]; as the rate-limiting enzyme gene in the Ehrlich pathway [55], the activation of ARO10 directly overcame the bottleneck in 2-PE biosynthesis, benefiting both cell growth and 2-PE production. The 2-PE yield and gene activation efficiency of INVScI-ARO80-1 were lower compared to INVScI-ARO10-1, which may be due to the indirect nitrogen metabolism regulatory mechanism and the complex promoter structure of the transcription factor gene ARO80 [56]. INVScI-ADH2-3 exhibited the lowest 2-PE yield, gene activation efficiency, and biomass among the three high-yield strains, stemming from the inhibitory effect of glucose repression on ADH2 expression [57] and the complexity of the ADH2 promoter [58]. The growth of INVScI-ARO80-1 and INVScI-ADH2-3 showed no significant difference from the control, likely because they did not directly promote the core reaction of 2-PE metabolism. These analyses highlight the limitations of single-gene activation, providing inspiration for multi-gene co-activation in 2-PE biosynthesis.
Compared with single-gene activation, the triple-gene co-activation strain INVScI-ARO10-ARO80-ADH2 exhibited enhanced 2-PE synthesis and higher expression levels of ARO10 and ARO80, which may be associated with the efficient selection of sgRNA, the self-reinforcing positive feedback regulation between ARO10 and ARO80, and the synergistic effect of the triple-gene co-activation. First, the selection of optimal sgRNA in the single-gene activation system laid the foundation for the stronger transcriptional activation in the triple-CRISPRa system and the higher 2-PE yields in INVScI-ARO10-ARO80-ADH2. Second, ARO80, induced by aromatic amino acids [11] or tryptophol [59], activated the expression of ARO9 and ARO10 [56] and promoted the production of 2-PE and the by-product tryptophol, which in turn activated ARO80, forming a positive feedback [13]. Finally, in contrast to single-gene activation, which acts on a single step of the metabolic pathway, the triple-gene co-activation strategy promoted all steps of the Ehrlich pathway by targeting the rate-limiting enzyme gene ARO10, the transcriptional activator gene ARO80, and alcohol dehydrogenase gene ADH2, and synergistically enhanced 2-PE synthesis efficiency. Therefore, the slight decrease (not significant, p > 0.05) in ADH2 expression in INVScI-ARO10-ARO80-ADH2 compared to that in INVSC1-ADH2-3 had a minor influence on overall 2-PE productivity.
To sum up, the triple-gene activation system in this study simultaneously enhanced the transamination, decarboxylation, and dehydrogenation steps of the Ehrlich pathway through synergistic mechanisms of positive feedback regulation of ARO10 and ARO80 and the optimization of the metabolic pathway. It provided sufficient metabolic flux for the pathway, avoiding the accumulation of intermediates and the metabolic burden on the cells, and systematically and significantly improved 2-PE synthesis efficiency. This efficient strategy that balances cell growth and 2-PE synthesis provides a reference for the biosynthesis of similar compounds.
2-PE biosynthesis has progressed substantially and S. cerevisiae has become one of the most commonly used hosts for 2-PE biosynthesis owing to its clear genetic background [60], well-defined 2-PE synthesis pathways [10], and high fermentation robustness [61]. 2-PE biosynthesis methods primarily involve introducing exogenous-related genes [62], overexpressing endogenous key genes [63], and inhibiting or knocking out competing pathway genes [23,64]. Previous studies have shown that while single key gene regulation has achieved moderate improvements in 2-PE production, simultaneous regulation of multiple genes in the 2-PE biosynthesis pathway of S. cerevisiae can lead to more substantial yield increases [13,23,63,65]. For example, the JHY305 strain co-activated ARO9, ARO10, and ARO80 to produce approximately 300 mg/L 2-PE within 48 h [13]; the YDP121 strain upregulated ADH1 and ARO10, accumulating 48 mg/L 2-PE after 48 h [65]; and tri-CRISPRi-mediated downregulation of branch genes (ALD3, TYR1, AAT2) increased 2-PE by less than 40% after 24 h [23]. In this study, the tri-CRISPRa system co-activated ARO10, ARO80, and ADH2 in the strain INVScI-ARO10-ARO80-ADH2, enhancing 2-PE yield by 77.62% to 214.04 mg/L. Compared to these studies, the lower 2-PE yield of INVScI-ARO10-ARO80-ADH2 versus JHY305 is likely attributed to its use of high-copy overexpression plasmids and strong promoters. Conversely, the higher 2-PE synthetic efficiency of INVScI-ARO10-ARO80-ADH2 compared to YDP121 and INVScI-TYR1.AAT2.ALD3 is probably linked to two factors: the use of L-Phe as a nitrogen source in the fermentation medium, and the synergistic activation of the Ehrlich pathway via triple-gene co-activation.
Although the S. cerevisiae INVScI strain may have lower 2-PE productivity than high-yield wild-type strains, it was chosen as the starting strain due to its ease of cloning and screening. The engineered strain INVScI-ARO10-ARO80-ADH2 has the potential for both industrial-scale fermentation food production and efficient synthesis of 2-PE. In the future, screening or engineering high-yielding starting strains, optimizing fermentation conditions [66], utilizing agricultural or industrial waste [67], improving the 2-PE tolerance of strains [68], and reducing product inhibition [69] will be crucial means for further improving 2-PE production.
In summary, we have successfully developed the CRISPRa-mediated triple-gene activation strain INVScI-ARO10-ARO80-ADH2 to enhance 2-PE biosynthesis. By simultaneously activating ARO10, ARO80, and ADH2, the engineered strain exhibits significant advantages over single-gene activation strains, achieving a 77.62% increase in 2-PE concentration, reaching 214.04 mg/L.

5. Conclusions

In this study, nine GSs targeting ADH2, ARO10, and ARO80 were designed and the three most effective GSs were identified by measuring 2-PE concentrations of the corresponding strains. Their sgRNA expression cassettes were cloned into the plasmid p426-gRNA.ARO10-ARO80-ADH2, which was further transformed into the S. cerevisiae INVScI strain. Ultimately, we successfully developed the CRISPRa-mediated triple-gene activation strain INVScI-ARO10-ARO80-ADH2. The engineered strain produced 214.04 mg/L 2-PE after 48 h, representing a 77.62% increase over the starting strain. This study presents an efficient and practical CRISPRa-based approach for enhancing 2-PE biosynthesis in S. cerevisiae.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fermentation11060345/s1: Figure S1: PCR electrophoretic results of single-gene CRISPRa series strains; Figure S2: The sequencing results of specific GSs of single-gene CRISPRa series strains; Figure S3: PCR electrophoretic results of INVScI-ARO10-ARO80-ADH2 construction; Table S1: The primers used in this study; Table S2: The oligonucleotides used in this study.

Author Contributions

Conceptualization, Z.Z., S.F., and X.Q.; methodology, Z.Z. and S.F.; visualization, P.H. and D.L.; investigation, Z.Z.; resources, X.Q.; writing—original draft preparation, Z.Z.; writing—review and editing, Z.Z., S.F., P.H., D.L., and X.Q.; funding acquisition, X.Q. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by China central university fundamental research funds under grant number project 2662016PY102.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Material. Further inquiries can be directed to the corresponding author.

Acknowledgments

We acknowledge the support from the Key Laboratory of environment Correlative Dietology, Ministry of Education (Huazhong Agricultural University).

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
2-PE2-Phenylethanol
3DThree dimensional
ANOVAAnalysis of variance
CAGRCompound annual growth rate
CRISPRaClustered regularly interspaced short palindromic repeats activation
GSGuide sequence
HPLCHigh-performance liquid chromatography
ODOptical density
OE PCROverlap extension polymerase chain reaction
PAMProtospacer adjacent motif
PCRPolymerase chain reaction
qPCRQuantitative real-time polymerase chain reaction
TSSTranscription start site
WTWild type

References

  1. Hua, D.; Xu, P. Recent advances in biotechnological production of 2-phenylethanol. Biotechnol. Adv. 2011, 29, 654–660. [Google Scholar] [CrossRef] [PubMed]
  2. Majdabadi, N.; Falahati, M.; Heidarie-Kohan, F.; Farahyar, S.; Rahimi-Moghaddam, P.; Ashrafi-Khozani, M.; Razavi, T.; Mohammadnejad, S. Effect of 2-phenylethanol as antifungal agent and common antifungals (amphotericin B, fluconazole, and itraconazole) on Candida species isolated from chronic and recurrent cases of candidal vulvovaginitis. Assay. Drug Dev. Technol. 2018, 16, 141–149. [Google Scholar] [CrossRef]
  3. Martinez-Avila, O.; Sanchez, A.; Font, X.; Barrena, R. Bioprocesses for 2-phenylethanol and 2-phenylethyl acetate production: Current state and perspectives. Appl. Microbiol. Biotechnol. 2018, 102, 9991–10004. [Google Scholar] [CrossRef]
  4. 2-Phenylethanol Market to Hit $350 Million by 2027, Says Global Market Insights Inc. Available online: https://www.globenewswire.com/en/news-release/2021/06/03/2241082/0/en/2-Phenylethanol-Market-to-hit-350-million-by-2027-SaysGlobal-Market-Insights-Inc.htm (accessed on 6 March 2021).
  5. Bernardino, A.R.S.; Torres, C.A.V.; Crespo, J.G.; Reis, M.A.M. Biotechnological 2-phenylethanol production: Recent developments. Molecules 2024, 29, 5761. [Google Scholar] [CrossRef]
  6. Qian, X.J.; Yan, W.; Zhang, W.M.; Dong, W.L.; Ma, J.F.; Ochsenreither, K.; Jiang, M.; Xin, F.X. Current status and perspectives of 2-phenylethanol production through biological processes. Crit. Rev. Biotechnol. 2019, 39, 235–248. [Google Scholar] [CrossRef] [PubMed]
  7. Mitri, S.; Koubaa, M.; Maroun, R.G.; Rossignol, T.; Nicaud, J.-M.; Louka, N. Bioproduction of 2-phenylethanol through yeast fermentation on synthetic media and on agro-industrial waste and by-products: A review. Foods 2022, 11, 109. [Google Scholar] [CrossRef]
  8. Chen, A.; Qu, T.; Smith, J.R.; Li, J.; Du, G.; Chen, J. Osmotic tolerance in Saccharomyces cerevisiae: Implications for food and bioethanol industries. Food Biosci. 2024, 60, 104451. [Google Scholar] [CrossRef]
  9. Braus, G.H. Aromatic amino acid biosynthesis in the yeast Saccharomyces cerevisiae: A model system for the regulation of a eukaryotic biosynthetic pathway. Microbiol. Rev. 1991, 55, 349–370. [Google Scholar] [CrossRef] [PubMed]
  10. Etschmann, M.M.; Bluemke, W.; Sell, D.; Schrader, J. Biotechnological production of 2-phenylethanol. Appl. Microbiol. Biotechnol. 2002, 59, 1–8. [Google Scholar] [CrossRef]
  11. Iraqui, I.; Vissers, S.; André, B.; Urrestarazu, A. Transcriptional induction by aromatic amino acids in Saccharomyces cerevisiae. Mol. Cell Biol. 1999, 19, 3360–3371. [Google Scholar] [CrossRef]
  12. Wang, Z.; Bai, X.; Guo, X.; He, X. Regulation of crucial enzymes and transcription factors on 2-phenylethanol biosynthesis via Ehrlich pathway in Saccharomyces cerevisiae. J. Ind. Microbiol. Biotechnol. 2017, 44, 129–139. [Google Scholar] [CrossRef] [PubMed]
  13. Kim, B.; Cho, B.R.; Hahn, J.S. Metabolic engineering of Saccharomyces cerevisiae for the production of 2-phenylethanol via Ehrlich pathway. Biotechnol. Bioeng. 2014, 111, 115–124. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, Y.; Zhang, Z.; Lu, X.; Zong, H.; Zhuge, B. Genetic engineering of an industrial yeast Candida glycerinogenes for efficient production of 2-phenylethanol. Appl. Microbiol. Biotechnol. 2020, 104, 10481–10491. [Google Scholar] [CrossRef] [PubMed]
  15. Gu, Y.; Ma, J.; Zhu, Y.; Xu, P. Refactoring Ehrlich pathway for high-yield 2-phenylethanol production in Yarrowia lipolytica. ACS Synth. Biol. 2020, 9, 623–633. [Google Scholar] [CrossRef]
  16. Kim, T.Y.; Lee, S.W.; Oh, M.K. Biosynthesis of 2-phenylethanol from glucose with genetically engineered Kluyveromyces marxianus. Enzym. Microb. Technol. 2014, 61–62, 44–47. [Google Scholar] [CrossRef]
  17. Noda, S.; Mori, Y.; Ogawa, Y.; Fujiwara, R.; Dainin, M.; Shirai, T.; Kondo, A. Metabolic and enzymatic engineering approach for the production of 2-phenylethanol in engineered Escherichia coli. Bioresour. Technol. 2024, 406, 130927. [Google Scholar] [CrossRef]
  18. Kong, S.; Pan, H.; Liu, X.; Li, X.; Guo, D. De novo biosynthesis of 2-phenylethanol in engineered Pichia pastoris. Enzym. Microb. Technol. 2020, 133, 109459. [Google Scholar] [CrossRef]
  19. Xu, Z.; Lin, L.; Chen, Z.; Wang, K.; Sun, J.; Zhu, T. The same genetic regulation strategy produces inconsistent effects in different Saccharomyces cerevisiae strains for 2-phenylethanol production. Appl. Microbiol. Biotechnol. 2022, 106, 4041–4052. [Google Scholar] [CrossRef]
  20. Li, M.; Wang, J.; Geng, Y.; Li, Y.; Wang, Q.; Liang, Q.; Qi, Q. A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli. Microb. Cell Factories 2012, 11, 19. [Google Scholar] [CrossRef]
  21. Gilbert, L.A.; Horlbeck, M.A.; Adamson, B.; Villalta, J.E.; Chen, Y.; Whitehead, E.H.; Guimaraes, C.; Panning, B.; Ploegh, H.L. Genome-scale CRISPR-mediated control of gene repression and activation. Cell 2014, 159, 647. [Google Scholar] [CrossRef]
  22. Laughery, M.F.; Hunter, T.; Brown, A. New vectors for simple and streamlined CRISPR–Cas9 genome editing in Saccharomyces cerevisiae. Yeast 2015, 32, 711–720. [Google Scholar] [CrossRef] [PubMed]
  23. Fang, S.; Fan, X.; Li, J.; Zhu, Z.; Huang, P.; Qi, X. Triple-CRISPRi-mediated down-regulation of the shikimate pathway branch genes for enhancing 2-PE biosynthesis in Saccharomyces cerevisiae. Eur. Food Res. Technol. 2024, 250, 1881–1890. [Google Scholar] [CrossRef]
  24. Gietz, R.D.; Woods, R.A. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol. 2002, 350, 87–96. [Google Scholar] [CrossRef]
  25. Livak, K.; Schmittgen, T. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  26. Gilbert, L.A.; Larson, M.H.; Morsut, L.; Liu, Z.; Brar, G.A.; Torres, S.E.; Stern-Ginossar, N.; Brandman, O.; Whitehead, E.H.; Doudna, J.A.; et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell 2013, 154, 442–451. [Google Scholar] [CrossRef]
  27. Mali, P.; Yang, L.; Esvelt, K.M.; Aach, J.; Guell, M.; DiCarlo, J.E.; Norville, J.E.; Church, G.M. RNA-guided human genome engineering via Cas9. Science 2013, 339, 823. [Google Scholar] [CrossRef]
  28. Deaner, M.; Mejia, J.; Alper, H.S. Enabling graded and large-scale multiplex of desired genes using a dual-mode dCas9 activator in Saccharomyces cerevisiae. ACS Synth. Biol. 2017, 6, 1931–1943. [Google Scholar] [CrossRef] [PubMed]
  29. Jensen, E.D.; Ferreira, R.; Jakociunas, T.; Arsovska, D.; Zhang, J.; Ding, L.; Smith, J.D.; David, F.; Nielsen, J.; Jensen, M.K.; et al. Transcriptional reprogramming in yeast using dCas9 and combinatorial gRNA strategies. Microb. Cell Fact. 2017, 16, 46. [Google Scholar] [CrossRef]
  30. Ferreira, R.; Skrekas, C.; Hedin, A.; Sánchez, B.J.; Siewers, V.; Nielsen, J.; David, F. Model-assisted fine-tuning of central carbon metabolism in yeast through dCas9-based regulation. ACS Synth. Biol. 2019, 8, 2457–2463. [Google Scholar] [CrossRef]
  31. Chavez, A.; Scheiman, J.; Vora, S.; Pruitt, B.W.; Tuttle, M.; Iyer, E.P.R.; Lin, S.; Kiani, S.; Guzman, C.D.; Wiegand, D.J.; et al. Highly efficient Cas9-mediated transcriptional programming. Nat. Methods 2015, 12, 326–328. [Google Scholar] [CrossRef]
  32. Lian, J.Z.; Carl, S.; Cao, M.F. Multi-functional genome-wide CRISPR system for high throughput genotype–phenotype mapping. Nat. Commun. 2019, 10, 5794. [Google Scholar] [CrossRef] [PubMed]
  33. Zalatan, J.G.; Lee, M.E.; Almeida, R.; Gilbert, L.A.; Whitehead, E.H.; La Russa, M.; Tsai, J.C.; Weissman, J.S.; Dueber, J.E.; Qi, L.S.; et al. Engineering complex synthetic transcriptional programs with CRISPR RNA scaffolds. Cell 2015, 160, 339–350. [Google Scholar] [CrossRef] [PubMed]
  34. Ni, J.; Zhang, G.; Qin, L.; Li, J.; Li, C. Simultaneously down-regulation of multiplex branch pathways using CRISPRi and fermentation optimization for enhancing β-amyrin production in Saccharomyces cerevisiae. Synth. Syst. Biotechnol. 2019, 4, 79–85. [Google Scholar] [CrossRef]
  35. Löbs, A.-K.; Schwartz, C.; Thorwall, S.; Wheeldon, I. Highly multiplexed CRISPRi repression of respiratory functions enhances mitochondrial localized ethyl acetate biosynthesis in Kluyveromyces marxianus. ACS Synth. Biol. 2018, 7, 2647–2655. [Google Scholar] [CrossRef]
  36. Qi, L.S.; Larson, M.H.; Gilbert, L.A.; Doudna, J.A.; Weissman, J.S.; Arkin, A.P.; Lim, W.A. Repurposing CRISPR as an RNA-Guided platform for sequence-specific control of gene expression. Cell 2013, 152, 1173–1183. [Google Scholar] [CrossRef]
  37. Graf, R.; Li, X.; Chu, V.; Rajewsky, K. sgRNA sequence motifs blocking efficient CRISPR/Cas9-Mediated gene editing. Cell Rep. 2019, 26, 1098–1103. [Google Scholar] [CrossRef]
  38. Fontana, J.; Dong, C.; Kiattisewee, C.; Chavali, V.P.; Tickman, B.I.; Carothers, J.M.; Zalatan, J.G. Effective CRISPRa-mediated control of gene expression in bacteria must overcome strict target site requirements. Nat. Commun. 2020, 11, 1618. [Google Scholar] [CrossRef] [PubMed]
  39. Jensen, K.; Fløe, L.; Petersen, T.; Huang, J.; Xu, F.; Bolund, L.; Luo, Y.; Lin, L. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency. FEBS Lett. 2017, 591, 1892–1901. [Google Scholar] [CrossRef]
  40. Thyme, S.B.; Akhmetova, L.; Montague, T.G.; Valen, E.; Schier, A.F. Internal guide RNA interactions interfere with Cas9-mediated cleavage. Nat. Commun. 2016, 7, 11750. [Google Scholar] [CrossRef]
  41. Xu, J.; Lian, W.; Jia, Y.; Li, L.; Huang, Z. Optimized guide RNA structure for genome editing via Cas9. Oncotarget 2017, 8, 94166–94171. [Google Scholar] [CrossRef]
  42. Zhang, X.-H.; Tee, L.; Wang, X.; Huang, Q.; Yang, S. Off-target Effects in CRISPR/Cas9-mediated Genome Engineering. Nucleic Acids 2015, 4, e264. [Google Scholar] [CrossRef] [PubMed]
  43. Kiani, S.; Chavez, A.; Tuttle, M.; Hal, R.N.; Chari, R.; Ter-Ovanesyan, D.; Qian, J.; Pruitt, B.W.; Beal, J.; Vora, S.; et al. Cas9 gRNA engineering for genome editing, activation and repression. Nat. Methods 2015, 12, 1051–1054. [Google Scholar] [CrossRef] [PubMed]
  44. Cong, L.; Ran, F.A.; Cox, D.; Lin, S.; Barretto, R.; Habib, N.; Hsu, P.D.; Wu, X.; Jiang, W.; Marraffini, L.A.; et al. Multiplex genome engineering using CRISPR/Cas systems. Science 2013, 339, 819–823. [Google Scholar] [CrossRef] [PubMed]
  45. La Russa, M.F.; Qi, L.S. The new state of the art: Cas9 for gene activation and repression. Mol. Cell Biol. 2015, 35, 3800–3809. [Google Scholar] [CrossRef]
  46. Yang, Y.; Liu, G.; Chen, X.; Liu, M.; Zhan, C.; Liu, X.; Bai, Z. High efficiency CRISPR/Cas9 genome editing system with an eliminable episomal sgRNA plasmid in Pichia pastoris. Enzyme Microb. Technol. 2020, 138, 109556. [Google Scholar] [CrossRef]
  47. Fu, Y.; Yang, X.; Li, S.; Ma, C.; An, Y.; Cheng, T.; Liang, Y.; Sun, S.; Cheng, T.; Zhao, Y.; et al. Dynamic properties of transcriptional condensates modulate CRISPRa-mediated gene activation. Nat. Commun. 2025, 16, 1640. [Google Scholar] [CrossRef]
  48. Chardon, F.M.; McDiarmid, T.A.; Page, N.F.; Daza, R.M.; Martin, B.K.; Domcke, S.; Regalado, S.G.; Lalanne, J.-B.; Calderon, D.; Li, X.; et al. Multiplex, single-cell CRISPRa screening for cell type specific regulatory elements. Nat. Commun. 2024, 15, 8209. [Google Scholar] [CrossRef]
  49. Chen, Z.; Ye, Z.; Soccio, R.E.; Nakadai, T.; Hankey, W.; Zhao, Y.; Huang, F.; Yuan, F.; Wang, H.; Cui, Z.; et al. Phosphorylated MED1 links transcription recycling and cancer growth. Nucleic Acids Res. 2022, 50, 4450–4463. [Google Scholar] [CrossRef]
  50. Rubtsov, M.A.; Polikanov, Y.S.; Bondarenko, V.A.; Wang, Y.-H.; Studitsky, V.M. Chromatin structure can strongly facilitate enhancer action over a distance. Proc. Natl. Acad. Sci. USA. 2006, 103, 17690–17695. [Google Scholar] [CrossRef]
  51. Liu, C.; Wang, C.; Wang, G.; Becker, C.; Zaidem, M.; Weigel, D. Genome-wide analysis of chromatin packing in Arabidopsis thaliana at single-gene resolution. Genome Res. 2016, 26, 1057–1068. [Google Scholar] [CrossRef]
  52. Farzadfard, F.; Perli, S.D.; Lu, T.K. Tunable and multifunctional eukaryotic transcription factors based on CRISPR/Cas. ACS Synth. Biol. 2013, 2, 604–613. [Google Scholar] [CrossRef]
  53. Smith, J.D.; Suresh, S.; Schlecht, U.; Wu, M.; Wagih, O.; Peltz, G.; Davis, R.W.; Steinmetz, L.M.; Parts, L.; St. Onge, R.P. Quantitative CRISPR interference screens in yeast identify chemical-genetic interactions and new rules for guide RNA design. Genome Biol. 2016, 17, 45. [Google Scholar] [CrossRef] [PubMed]
  54. Chen, Y.C.; Zhang, J.Z.; Si, T. Development and applications of CRISPR/dCas9-based gene transcriptional regulation tool in Saccharomyces cerevisiae. Biotechnol. Bull. 2020, 36, 1–12. [Google Scholar] [CrossRef]
  55. Romagnoli, G.; Knijnenburg, T.A.; Liti, G. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose. Yeast 2015, 32, 29–45. [Google Scholar] [CrossRef] [PubMed]
  56. Lee, K.; Hahn, J.S. Interplay of Aro80 and GATA activators in regulation of genes for catabolism of aromatic amino acids in Saccharomyces cerevisiae. Mol. Microbiol. 2013, 88, 1120–1134. [Google Scholar] [CrossRef]
  57. He, Q.; Yang, Y.; Yang, S.; Donohoe, B.S.; Van Wychen, S.; Zhang, M.; Himmel, M.E.; Knoshaug, E.P. Oleaginicity of the yeast strain Saccharomyces cerevisiae D5A. Biotechnol. Biofuels 2018, 11, 258. [Google Scholar] [CrossRef] [PubMed]
  58. Verdone, L.; Camilloni, G.; Mauro, E.D.; Caserta, M. Chromatin Remodeling during Saccharomyces cerevisiae ADH2 Gene activation. Mol. Cell Biol. 1996, 16, 1978–1988. [Google Scholar] [CrossRef]
  59. Ghosh, S.; Kebaara, B.W.; Atkin, A.L.; Nickerson, K.W. Regulation of Aromatic Alcohol Production in Candida albicans. Appl. Environ. Microbiol. 2008, 74, 7211–7218. [Google Scholar] [CrossRef]
  60. Kavšček, M.; Stražar, M.; Curk, T.; Natter, K.; Petrovič, U. Yeast as a cell factory: Current state and perspectives. Microb. Cell Fact. 2015, 14, 94. [Google Scholar] [CrossRef]
  61. Chen, B.; Lee, H.L.; Heng, Y.C.; Chua, N.; Teo, W.S.; Choi, W.J.; Leong, S.S.J.; Foo, J.L.; Chang, M.W. Synthetic biology toolkits and applications in Saccharomyces cerevisiae. Biotechnol. Adv. 2018, 36, 1870–1881. [Google Scholar] [CrossRef]
  62. Zhu, L.; Wang, J.; Xu, S.; Shi, G. Improved aromatic alcohol production by strengthening the shikimate pathway in Saccharomyces cerevisiae. Process Biochem. 2021, 103, 18–30. [Google Scholar] [CrossRef]
  63. Wang, Z.; Jiang, M.; Guo, X.-N.; Liu, Z.; He, X. Reconstruction of metabolic module with improved promoter strength increases the productivity of 2-phenylethanol in Saccharomyces cerevisiae. Microb. Cell Fact. 2018, 17, 60. [Google Scholar] [CrossRef] [PubMed]
  64. Zhan, Y.; Shi, J.; Xiao, Y.; Zhou, F.; Wang, H.; Xu, H.; Li, Z.; Yang, S.; Cai, D.; Chen, S. Multilevel metabolic engineering of Bacillus licheniformis for de novo biosynthesis of 2-phenylethanol. Metab. Eng. 2022, 70, 43–54. [Google Scholar] [CrossRef]
  65. Shen, L.; Nishimura, Y.Y.; Matsuda, F. Overexpressing enzymes of the Ehrlich pathway and deleting genes of the competing pathway in Saccharomyces cerevisiae for increasing 2-phenylethanol production from glucose. J. Biosci. Bioeng. 2016, 122, 34–39. [Google Scholar] [CrossRef]
  66. Cui, Z.; Yang, X.; Shen, Q.; Wang, K.; Zhu, T. Optimisation of biotransformation conditions for production of 2-phenylethanol by a Saccharomyces cerevisiae CWY132 mutant. Nat. Prod. Res. 2011, 25, 754–759. [Google Scholar] [CrossRef]
  67. Martínez-Avila, O.; Muñoz-Torrero, P.; Sánchez, A.; Font, X.; Barrena, R. Valorization of agro-industrial wastes by producing 2-phenylethanol via solid-state fermentation: Influence of substrate selection on the process. Waste Manag. 2021, 121, 403–411. [Google Scholar] [CrossRef] [PubMed]
  68. Xia, H.; Kang, Y.; Ma, Z.; Hu, C.; Yang, Q.; Zhang, X.; Yang, S.; Dai, J.; Chen, X. Evolutionary and reverse engineering in Saccharomyces cerevisiae reveals a Pdr1p mutation-dependent mechanism for 2-phenylethanol tolerance. Microb. Cell Fact. 2022, 21, 269. [Google Scholar] [CrossRef]
  69. Chreptowicz, K.; Mierzejewska, J. Enhanced bioproduction of 2-phenylethanol in a biphasic system with rapeseed oil. New Biotechnol. 2018, 42, 56–61. [Google Scholar] [CrossRef]
Fermentation 11 00345 g001
Figure 1. Biosynthetic pathways of 2-PE in S. cerevisiae. Pathway: EMP, Embden–Meyerhof–Parnas pathway; PPP, Pentose Phosphate pathway. Compound: G6P, glucose 6-phosphate; PEP, phosphoenolpyruvate; E4P, erythrose-4-phosphate; SHIK, shikimic acid; CHO, chorismic acid; PREP, prephenate; PPY, phenylpyruvate; L-Phe, L-phenylalanine; PAC, phenylacetaldehyde; PAA, phenyl acetate; 2-PE, 2-phenylethanol. Genes: PHA2, prephenate dehydratase gene; ARO8/ARO9, phenylalanine transaminase gene; ARO10, phenylpyruvate decarboxylase gene; THI3, branched-chain-2-oxoacid decarboxylase gene; PDC, indolepyruvate decarboxylase gene; ARO80, encodes transcription factor ARO80; ALD2/ALD3, aldehyde dehydrogenase gene; ADH1-7, alcohol dehydrogenase gene.
Figure 1. Biosynthetic pathways of 2-PE in S. cerevisiae. Pathway: EMP, Embden–Meyerhof–Parnas pathway; PPP, Pentose Phosphate pathway. Compound: G6P, glucose 6-phosphate; PEP, phosphoenolpyruvate; E4P, erythrose-4-phosphate; SHIK, shikimic acid; CHO, chorismic acid; PREP, prephenate; PPY, phenylpyruvate; L-Phe, L-phenylalanine; PAC, phenylacetaldehyde; PAA, phenyl acetate; 2-PE, 2-phenylethanol. Genes: PHA2, prephenate dehydratase gene; ARO8/ARO9, phenylalanine transaminase gene; ARO10, phenylpyruvate decarboxylase gene; THI3, branched-chain-2-oxoacid decarboxylase gene; PDC, indolepyruvate decarboxylase gene; ARO80, encodes transcription factor ARO80; ALD2/ALD3, aldehyde dehydrogenase gene; ADH1-7, alcohol dehydrogenase gene.
Fermentation 11 00345 g001
Fermentation 11 00345 g002
Figure 2. The target sites of GSs targeting ARO10, ARO80, and ADH2. TATA box, a key promoter element for transcription initiation; TSS, transcription start site. Different arrows represent the target positions corresponding to different guidance sequences. The plus sign (+) indicates that the protospacer adjacent motif (PAM) sequence and sgRNA target sequence are in the same DNA strand. The negative sign (−) indicates that the PAM sequence is on the complementary chain of the sgRNA targeting sequence.
Figure 2. The target sites of GSs targeting ARO10, ARO80, and ADH2. TATA box, a key promoter element for transcription initiation; TSS, transcription start site. Different arrows represent the target positions corresponding to different guidance sequences. The plus sign (+) indicates that the protospacer adjacent motif (PAM) sequence and sgRNA target sequence are in the same DNA strand. The negative sign (−) indicates that the PAM sequence is on the complementary chain of the sgRNA targeting sequence.
Fermentation 11 00345 g002
Fermentation 11 00345 g003
Figure 3. The construction schematic diagram of CRISPRa single-gene activation engineered strains of S. cerevisiae.
Figure 3. The construction schematic diagram of CRISPRa single-gene activation engineered strains of S. cerevisiae.
Fermentation 11 00345 g003
Fermentation 11 00345 g004
Figure 4. The schematic diagram of the construction of the plasmid p426-gRNA.ARO10.ARO80.ADH2 and the triple-gRNA cassette.
Figure 4. The schematic diagram of the construction of the plasmid p426-gRNA.ARO10.ARO80.ADH2 and the triple-gRNA cassette.
Fermentation 11 00345 g004
Fermentation 11 00345 g005
Figure 5. 2-PE concentrations of single-gene activation series engineered strains INVScI-ARO10, INVScI-ARO80, and INVScI-ADH2. (A) 2-PE concentrations of INVScI-ARO10 series strains; (B) 2-PE concentrations of INVScI-ARO80 series strains; (C) 2-PE concentrations of INVScI-ADH2 series strains. The results of the significance analyses are denoted as * p < 0.05, ** p < 0.01, and **** p < 0.0001.
Figure 5. 2-PE concentrations of single-gene activation series engineered strains INVScI-ARO10, INVScI-ARO80, and INVScI-ADH2. (A) 2-PE concentrations of INVScI-ARO10 series strains; (B) 2-PE concentrations of INVScI-ARO80 series strains; (C) 2-PE concentrations of INVScI-ADH2 series strains. The results of the significance analyses are denoted as * p < 0.05, ** p < 0.01, and **** p < 0.0001.
Fermentation 11 00345 g005
Fermentation 11 00345 g006
Figure 6. The 2-PE concentrations and growth of INVScI-WT, INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 strains. (A) The 2-PE concentrations of INVScI-WT, INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 strains. (B) The growth of INVScI-WT, INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 strains. The results of the significance analyses are denoted as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Figure 6. The 2-PE concentrations and growth of INVScI-WT, INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 strains. (A) The 2-PE concentrations of INVScI-WT, INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 strains. (B) The growth of INVScI-WT, INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3 strains. The results of the significance analyses are denoted as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Fermentation 11 00345 g006
Fermentation 11 00345 g007
Figure 7. The relative expression levels of target genes of CRISPRa single-gene activation engineered strains. (A) The relative expression levels of ARO10 in INVScI-ARO10 series strains. (B) The relative expression levels of ARO80 in INVScI-ARO80 series strains. (C) The relative expression levels of ADH2 in INVScI-ADH2 series strains. The results of the significance analyses are denoted as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Figure 7. The relative expression levels of target genes of CRISPRa single-gene activation engineered strains. (A) The relative expression levels of ARO10 in INVScI-ARO10 series strains. (B) The relative expression levels of ARO80 in INVScI-ARO80 series strains. (C) The relative expression levels of ADH2 in INVScI-ADH2 series strains. The results of the significance analyses are denoted as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Fermentation 11 00345 g007
Fermentation 11 00345 g008
Figure 8. 2-PE concentrations and the growth of engineered strain INVScI-ARO10-ARO80-ADH2. (A) 2-PE concentrations of the engineered strain INVScI-ARO10-ARO80-ADH2. (B) The growth of the engineered strain INVScI-ARO10-ARO80-ADH2. The results of the significance analyses are denoted as * p < 0.05, and **** p < 0.0001.
Figure 8. 2-PE concentrations and the growth of engineered strain INVScI-ARO10-ARO80-ADH2. (A) 2-PE concentrations of the engineered strain INVScI-ARO10-ARO80-ADH2. (B) The growth of the engineered strain INVScI-ARO10-ARO80-ADH2. The results of the significance analyses are denoted as * p < 0.05, and **** p < 0.0001.
Fermentation 11 00345 g008
Fermentation 11 00345 g009
Figure 9. The relative expression levels of ADH2, ARO10, and ARO80 in single-gene activation strains (INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3) and INVScI-ARO10-ARO80-ADH2. The results of the significance analyses are denoted as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Figure 9. The relative expression levels of ADH2, ARO10, and ARO80 in single-gene activation strains (INVScI-ARO10-1, INVScI-ARO80-1, and INVScI-ADH2-3) and INVScI-ARO10-ARO80-ADH2. The results of the significance analyses are denoted as * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.
Fermentation 11 00345 g009
Table 1. The plasmids used in this study.
Table 1. The plasmids used in this study.
Plasmid NameDescriptionSource
p426-gRNA-BclⅠ-SmiⅠoptimization of p426-SNR52p-gRNA.CAN1.Y-SUP4tLab stock
pAG414GPD-dCas9-VPRpAG414 series plasmid with GPD promoter driving expression of dCas9-VPR; carrying TRP1 markerAdd gene
P426-gRNA.ARO10-1p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ARO10-1This study
P426-gRNA.ARO10-2p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ARO10-2This study
P426-gRNA.ARO10-3p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ARO10-3This study
P426-gRNA.ARO80-1p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ARO80-1This study
P426-gRNA.ARO80-2p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ARO80-2This study
P426-gRNA.ARO80-3p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ARO80-3This study
P426-gRNA.ADH2-1p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ADH2-1This study
P426-gRNA.ADH2-2p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ADH2-2This study
P426-gRNA.ADH2-3p426-gRNA-BclⅠ-SmiⅠ,expressing gRNA.ADH2-3This study
p426-gRNA.ARO10-ARO80-ADH2p426-gRNA-BclⅠ-SmiⅠ,integrating gRNA cassettes of ARO10, ARO80 and ADH2This study
Table 2. The strains used in this study.
Table 2. The strains used in this study.
Strain NameDescriptionSource
S.cerevisiae INVScⅠMATa his3Δ1 leu2 TRP1-289 ura3-52/MATα his3Δ1 leu2 TRP1-289 ura3-52ZOMANBIO, Beijing, China
E. coli DH5αΦ80 lacZΔM15 ΔlacU169 recA1 endA1 hsdR17 supE44 thi-1 gyrA relA1ZOMANBIO, Beijing, China
INVScⅠ-ARO10-1INVScⅠ, p426-gRNA.ARO10-1This study
INVScⅠ-ARO10-2INVScⅠ, p426-gRNA.ARO10-2This study
INVScⅠ-ARO10-3INVScⅠ, p426-gRNA.ARO10-3This study
INVScⅠ-ARO80-1INVScⅠ, p426-gRNA.ARO80-1This study
INVScⅠ-ARO80-2INVScⅠ, p426-gRNA.ARO80-2This study
INVScⅠ-ARO80-3INVScⅠ, p426-gRNA.ARO80-3This study
INVScⅠ-ADH2-1INVScⅠ, p426-gRNA.ADH2-1This study
INVScⅠ-ADH2-2INVScⅠ, p426-gRNA.ADH2-2This study
INVScI-ADH2-3INVScⅠ, p426-gRNA.ADH2-3This study
INVScⅠ-ARO10-ARO80-ADH2INVScⅠ, p426-gRNA.ARO10-ARO80-ADH2This study
Table 3. The GSs designed in this study.
Table 3. The GSs designed in this study.
GSs NameSequence (5′-3′)PAM
gRNA.ARO10-1CCTACCGGGAGGGATAACCG+337
gRNA.ARO10-2AGTGTCGGTTACCTACCGGG+347
gRNA.ARO10-3CTCCAAAGTGTCGGTTACCT−379
gRNA.ARO80-1TCCTTCTTAGTAATACATGA+187
gRNA.ARO80-2TGATACCCATTAATACACAT+268
gRNA.ARO80-3ATAATATCAAGTTAGTCGT+51
gRNA.ADH2-1AACTGATAGTTTGATCAAAG+568
gRNA.ADH2-2ATCAAAGGGGCAAAACGTAG+555
gRNA.ADH2-3GATCAGTCTCGTGAAGTGGA−334
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhu, Z.; Fang, S.; Huang, P.; Luo, D.; Qi, X. CRISPRa-Mediated Triple-Gene Activation of ARO10, ARO80, and ADH2 for Enhancing 2-Phenylethanol Biosynthesis via the Ehrlich Pathway in Saccharomyces cerevisiae. Fermentation 2025, 11, 345. https://doi.org/10.3390/fermentation11060345

AMA Style

Zhu Z, Fang S, Huang P, Luo D, Qi X. CRISPRa-Mediated Triple-Gene Activation of ARO10, ARO80, and ADH2 for Enhancing 2-Phenylethanol Biosynthesis via the Ehrlich Pathway in Saccharomyces cerevisiae. Fermentation. 2025; 11(6):345. https://doi.org/10.3390/fermentation11060345

Chicago/Turabian Style

Zhu, Zijing, Shuaihu Fang, Pingping Huang, Dianqiang Luo, and Xiaobao Qi. 2025. "CRISPRa-Mediated Triple-Gene Activation of ARO10, ARO80, and ADH2 for Enhancing 2-Phenylethanol Biosynthesis via the Ehrlich Pathway in Saccharomyces cerevisiae" Fermentation 11, no. 6: 345. https://doi.org/10.3390/fermentation11060345

APA Style

Zhu, Z., Fang, S., Huang, P., Luo, D., & Qi, X. (2025). CRISPRa-Mediated Triple-Gene Activation of ARO10, ARO80, and ADH2 for Enhancing 2-Phenylethanol Biosynthesis via the Ehrlich Pathway in Saccharomyces cerevisiae. Fermentation, 11(6), 345. https://doi.org/10.3390/fermentation11060345

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop