Next Article in Journal
Two-Step Optimization for Improving Prodigiosin Production Using a Fermentation Medium for Serratia marcescens and an Extraction Process
Next Article in Special Issue
Enhanced Succinic Acid Production and Electronic Utilization Efficiency by Actinobacillus succinogenes 130Z in an ORP-Controlled Microbial Electrolysis Cell System
Previous Article in Journal
Using Omics Techniques to Analyze the Effects of Gene Mutations and Culture Conditions on the Synthesis of β-Carotene in Pantoea dispersa
Previous Article in Special Issue
Bioprocess Intensification of a Continuous-Flow Enzymatic Bioreactor via Productivity Dynamic Optimization under Modeling Uncertainty
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fermentation
Volume 10
Issue 2
10.3390/fermentation10020084
fermentation-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Study of the Extracellular Holocellulolytic Activity of Fusarium solani and Aspergillus sp. in Corn Stover

by
Mariana Alvarez-Navarrete
1,
Katia L. Alonso-Hurtado
2,
Alberto Flores-García
2,
Josué Altamirano-Hernández
2,
Mauro M. Martínez-Pacheco
2,* and
Crisanto Velázquez-Becerra
3
1
Tecnológico Nacional de México, Instituto Tecnológico de Morelia, Morelia 58120, Michoacán, Mexico
2
Instituto de Investigaciones Químico Biológicas, Universidad Michoacana de San Nicolás de Hidalgo, Morelia 58040, Michoacán, Mexico
3
Facultad de Ingeniería en Tecnología de la Madera, Universidad Michoacana de San Nicolás de Hidalgo, Morelia 58120, Michoacán, Mexico
*
Author to whom correspondence should be addressed.
Fermentation 2024, 10(2), 84; https://doi.org/10.3390/fermentation10020084
Submission received: 4 January 2024 / Revised: 21 January 2024 / Accepted: 25 January 2024 / Published: 30 January 2024
(This article belongs to the Special Issue Fermentation Processes: Modeling, Optimization and Control)
Browse Figures
Review Reports Versions Notes

Abstract

:
Fungal holocellulases are interesting for their possible applications in the bioconversion of corn crop residues into molecules with technological significance. Holocellulase (xylanases and cellulases) production from Fusarium solani and Aspergillus sp. with corn stover as a carbon source was compared using a Box–Wilson design. The fungal holocellulase production was different in both fungi. For F. solani, the maximum endoxylanase and β-xylosidase activities were 14.15 U/mg and 0.75 U/mg at 84 h of fermentation on 350 g/L corn stover, while Aspergillus sp. was 5.90 U/mg and 0.03 U/mg, respectively, at 156 h and 1000 g/L corn stover. The production of holocellulases in both fungi was reduced with increasing carbon sources. The nitrogen source induced the holocellulases in Aspergillus sp., but not in F. solani. Interestingly, when verifying the optimal culture conditions, the production of endoxylanases by F. solani was higher when compared to the predicted value. With regard to the endoxylanase and β-xylosidase activities of Aspergillus sp., these were close to the predicted values. Based on the optimization model, F. solani and Aspergillus sp. produce an interesting holocellulolytic activity in a growth medium with corn stover as the only carbon source. The fermentation time and the amount of corn stover required to obtain maximum holocellulase production are possible advantages for Fusarium solani and Aspergillus sp., respectively.

1. Introduction

Agricultural and agroindustrial activities give rise to a significant amount of solid waste that generates pollution. The amount of corn stubble and cob generated in Mexico is 17.5 million tons of corn stubble per year [1]. Both materials are mainly made up of lignocellulosic biomass, where cellulose (45%) and hemicellulose (35%) are present in greater quantities [2,3]. Holocellulose is the sum of the cellulose and hemicellulose fractions. Hemicellulose is mainly composed of xylan (28–35% dry basis), which can be used to obtain microbial xylanases on a large scale. Xylanases are produced by bacteria, fungi, and actinomycetes [4,5]. Filamentous fungi are especially interesting since they secrete these enzymes into the medium and their level of activity is notable compared to yeasts and bacteria [6]. Aspergillus and Trichoderma species are widely used for the commercial production of xylanases [7,8]. The enzyme preparations obtained from these fungal species are very specific for certain applications. Xylanases have various industrial uses, such as in livestock, food, paper and cellulose pulp, textiles, and the manufacturing of chemical products such as xylitol and ethanol [9], as well as in the exploitation of lignocellulosic materials from agricultural, agro-industrial, and municipal waste to obtain molecules with important technological value [10], such as in the production of biofuels [11].
The cost of enzymes accounts for 50% of the total cost of the hydrolysis processes of lignocellulosic materials, so research efforts have been directed to reducing the cost of the production of enzymes. The exploration of organisms with new enzymes, the genetic improvement of organisms used in industry and enzyme engineering, and the study of factors related to enzyme production are the strategies to achieve this objective [12,13].
Regarding the first strategy, a large number of fungal species still exist without being studied in the great microbial diversity of our planet. Fusarium solani is a candidate for the production of extracellular xylanases. There have been few reports on the efficient production of xylanases and exploratory studies about its xylanolytic activity [14] and optimization of enzyme production [15,16]. In a previous study, Fusarium solani was isolated from bean crops, identified, and selected from a group of one hundred and three fungal isolates for its notable ability to produce extracellular xylanases [17]. Based on the third strategy to reduce the cost of enzymes, corn stover is a potentially profitable source for the fermentative production of fungal xylanases. Several factors have been studied to determine their effect on the production of holocellulases in filamentous fungi, such as the type and concentration of carbon source and nitrogen source, pH, temperature, and time of incubation. In relation to the concentration of the carbon source, studies have been carried out using lignocellulosic residues with different moisture levels to evaluate the production of xylanases. Due to its high demonstrated xylanolytic activity, F. solani is a fungus with biotechnological potential for the production of these enzymes with wide industrial application. An organism considered as a standard in the production of industrial xylanases, as well as other metabolites, such as Aspergillus sp., for a comparative study of enzymatic production can be used as a reference to determine the potential of F. solani in the production of extracellular holocellulases; this species has not been exploited as extensively in the industrial sector as the species of the genus Aspergillus. The aim of this work was to compare the holocellulolytic activity of Aspergillus sp. and Fusarium solani in corn stover as a carbon source under different growing conditions.

2. Materials and Methods

2.1. Biological Material

Fusarium solani (accession number KP137441, GenBank (NCBI)) was isolated from horticultural field crops (22°35′00″ N, 102°15′00″ W) [17]. The Aspergillus sp. strain was isolated from a bean field crop (23°29′0″ N, 103°53′0″ W). It was previously selected for its ability to produce extracellular holocellulases and was identified using molecular tools in the Laboratory of Cellular Physiology at the Institute of Chemical Biological Research of the Universidad Michoacana de San Nicolás de Hidalgo. The fungi isolates were inoculated in a PDA medium for their maintenance and propagation.

2.2. Fungus Molecular Identification

Genomic DNA extraction was carried out using the modified method of Lin [18]. The oligonucleotide pair internal transcribed spacers (ITS5 and ITS4), which were specific to the selected fungal isolates, were used in the PCR assays. Forward primer (ITS5): GGAAGTAAAAGTCGTAACAAGG and reverse primer (ITS4): TCCTCCGCTTATTGATATGC. The reaction mixture was prepared in a total volume of 25 µL, with a final concentration of 2 mM MgCl2, 200 mM Tris-HCl, pH 8.4, 500 mM KCl, and 0.2 mM each dNTP. For each reaction, 0.04 U/µL Taq 5U polymerase (Invitrogen, Carlsbad, CA, USA), 0.2 µM each primer, and 1 µL fungal template DNA were used. The reaction was performed in a Techne C-512 PCR system thermal cycler (Barloworld Scientific, Staffordshire, UK) using the following PCR conditions: denaturation at 95 °C for 8 min; 35 cycles of denaturation at 95 °C for 15 s, annealing at 50 °C for 20 s, and extension at 72 °C for 1 min; final extension at 72 °C for 5 min; and cooling at 4 °C until recovery of the samples [19]. Amplification products were visualized on 1.0% agarose gel (w/v) stained with ethidium bromide in a Transiluminator 3UVTM model LMS-20E UVP and analyzed using the program Quantity One 4.2.1, see Supplementary Material (SM) (Bio-Rad, Hercules, CA, USA). After amplification, the products were directly sequenced using a sequencer 3730xI (Applied Biosystems, Foster City, CA, USA). All sequencing products were edited and analyzed using the software BioEdit 7.1.3.0. Then, the sequences were used as a query to search for similarities using the BLAST network services on the NCBI database.

2.3. Experimental Design

Different culture conditions were studied to optimize fungal xylanase production via fermentation. Five factors were studied: fermentation time, and concentrations of carbon source, yeast extract, ammonium sulfate, and urea. The concentrations of the carbon source were stablished in such a way that the moisture or water availability in the culture medium was different in each experiment. Solid, semi-solid, and liquid culture media were generated (Table 1). Washed, dried, and milled corn stover was used as a carbon source (CS). A Box–Wilson (BW) rotatable composite experimental design was used as a fractional factorial design 2k−1 with sixteen factorial experiments, ten axial experiments, and one central experiment. Twenty-seven different experiments were generated and replicated three times (Table 1). The BW design has the advantage of reducing runs compared with other experimental designs and can estimate the curvature effects of factors, i.e., when it is suspected that the effect of the factors on the dependent variable is nonlinear [20]. The experiments were randomized to avoid biased results in the application of the design. In Table 2, the decoded levels of each factor are shown. Response variables measured were the activities of endo-β-1,4-xylanase, exo-β-1,4-xylosidase, and endocellulase (collectively referred to as holocellulases or holocellulolytic activity).

2.4. Inoculum Preparation

Separately, spore suspensions of Aspergillus sp. and F. solani were obtained from PDA plates previously seeded with both fungi. After the addition of sterile deionized water, the surface of the solid culture media was gently scraped, and the spores were extracted using a micropipette. The spore suspension was deposited in glass test tubes. The spore suspension was centrifuged at 3500 rpm for 10 min. The supernatant was discarded, and the spores were resuspended in sterilized deionized water. This procedure was repeated four times. The spore concentration was quantified by account in a Neubauer chamber. Fermentation flasks from the experimental design were inoculated with 1 × 106 fungal spores/mL.

2.5. Xylanase Production by Fermentation

Based on the experiments listed in Table 1, the required amounts of CS and the three nitrogen sources were combined. A trace element and vitamin dissolution was added (100 µL per milliliter of culture medium) (MEM Vitamin solution 1000×, Sigma Cell Culture), composed per liter of deionized water as follows: 2.0 g KH2PO4, 0.3 g MgSO4·7H2O; 0.3 g CaCl2, 5.0 mg FeSO4·7H2O, 1.56 mg MnSO4·H2O, 2.0 mg CoCl2, 1.4 mg ZnSO4·7H2O. Culture media were autoclaved at 121 °C for 15 min. Twenty-seven different fermentation flasks, with their respective replicates (n = 3), were inoculated with 1 × 106 fungal spores/mL of F. solani. The above procedure was repeated with Aspergillus sp. The inoculated flasks were incubated for the stated time in the BW design at 150 rpm and at room temperature.

2.6. Extraction of Holocellulolytic Enzyme

The flasks were removed from incubation, and then 10 mL of 50 mM sodium citrate buffer at pH 5.0 was added to wash the solids. The supernatant was filtered from the solids through filter paper and centrifugated at 10,000 rpm for 4 min, and was used to quantify the holocellulolytic activity and extracellular protein.

2.7. Holocellulolytic Enzyme Assays

2.7.1. Endo-β-1,4-Xylanase, Endocellulase, and β-1,4-Xylosidase Activities Assays

Endo-β-1,4-xylanase, endocellulase, and β-1,4-xylosidase activities were measured using the modified methods of Bailey [21], Ghose [22], and Kristufek [23], respectively. The substrates were 1% (w/v) CMC, 1% (w/v) birchwood xylan, and 10 mM PNPX (Sigma Naucalpan Estado de México), respectively. The reducing sugars were quantified using the method of Miller by adding 1 mL of DNS reagent [24]. One unit (U) of enzyme activity is defined as the amount of enzyme that releases 1 μmol of reducing sugars per minute under assay conditions. Each assay was performed in duplicate.

2.7.2. Extracellular Protein Quantification

The extracellular protein was quantified using the method of Lowry [25] with BSA as standard. Each assay was performed in duplicate.

2.8. Optimization of Fermentation Conditions for Xylanase Production

A general second-order model was adjusted to the experimental results of the BW design to estimate the effects of the factors on the response variables. The main effects as well as the interactions and quadratic effects were included in the model used, which is shown by Equation (1).
y n = β 0 + ∑ i = 1 k β i x i + ∑ i = 1 k β i i x i 2 + ∑ j k ∑ i = 1 k β i k x i x j + ε i
where yn is any of the response variables, xi and xj are the k = 5 factors, and the β coefficients are the regression parameters.
The parameters of Equation (1) were obtained using multiple linear regression using the least squares method and the significance of the effects was evaluated at α = 0.5. To find the optimal conditions for holocellulase production, the desirability profile method was used as described by Derringer and Suich [26].
For each response, a desirability function was assigned a number between 0 and 1 to the possible response values, with 0 representing a completely undesirable value of response and 1 representing a completely desirable or ideal response value. Depending on whether a particular response is to be maximized, minimized, or assigned a target value, different desirability functions can be used. The 0 and 1 values of desirability were assigned to the minimum and maximum endoxylanase and β-xylosidase activities obtained from the BW design experiments, respectively. Conversely, for endocellulase activity, 0 and 1 values were assigned to maximum and minimum enzymatic activity, respectively. One of the objetives of this study was to achieve maximum endoxylanase and β-xylanase activities with minimal endocellulase activity.

3. Results

3.1. Holocellulolytic Activity of F. solani and Aspergillus sp. in BW Experiments

The endoxylanase activity from Aspergillus sp. was higher than that of F. solani (Figure 1a) in most experiments, but the maximum endoxylanase activity was observed in experiment 2 (350 g/L, 3.0 g/L, 1.0 g/L, and 95 g/L of CS, yeast extract, ammonium sulfate, and urea) with F. solani in contrast with Aspergillus sp., whose maximum activity was achieved in experiment 11 (1000 g/L, 3 g/L, 2 g/L, and 35 g/L, CS, ammonium sulfate, yeast extract, and urea, respectively) (Table 3). Regarding β-xylosidase activity, F. solani showed more activity than Aspergillus sp. in thirteen of twenty-seven experiments (Figure 1b). The maximum β-xylosidase activity was achieved with F. solani in experiment 2 (0.75 U/mg), which represented more than double the maximum activity achieved by Aspergillus sp. in experiment 22 (0.28 U/mg) (Table 3). F. solani showed slightly higher cellulolytic activity than Aspergillus sp. in most of the experiments performed (Figure 1c). Aspergillus sp. exhibited the maximum cellulase activity in experiment 20, whereas F. solani had the highest activity in experiment 2 (Table 3).

3.2. Predicted and Experimental Data

The holocellulolytic activity results were statistically analyzed to evaluate whether second-order polynomial models predict holocellulase production in both fungi. Based on the statistical analysis of the data, the residual plots were obtained (Figure 2). The ANOVA for the quadratic models is shown in Table 4 and Table 5. The R2 coefficient values indicated that the fit was acceptable for endoxylanases and endocellulases with F. solani, but not for β-xylosidases with F. solani (Table 4). As for Aspergillus sp., the adjustment was lower for the three enzymatic activities (Table 5). According to the F test, the models were predictive in all cases, since the calculated values of F were greater than the tabulated values. The small p-values also indicated the significance of the models, since these were less than the value of α = 0.05.

3.3. Effect of Factors on Holocellulase Production

The identification of the nutritional factors that affect the fungal production of the holocellulolytic activity was carried out using an ANOVA. Figure 3 shows that the individual nutritional factors, interactions, and quadratic values had an effect on the production of holocellulases by F. solani, while the holocellulolytic activity production in Aspergillus sp. was influenced by a smaller number of nutritional factors.
The production of holocellulases in F. solani decreased with increasing CS concentration because of the lower moisture content of the culture media. Aspergillus sp. behaved in a similar way, since the increase in CS concentration caused a lower production of β-xylosidases and endocellulases, but did not affect endoxylanase production.
The nitrogen source, yeast extract, and ammonium sulfate had no effect on holocellulase production by F. solani, but urea did. In Aspergillus sp., the increase in the concentration of yeast extract favored the production of holocellulases. In particular, the production of β-xylosidases depended on an adequate supply of the three nitrogen sources assayed, since it was affected positively by these. The fermentation time was not a factor that affected holocellulase production in Aspergillus sp., whereas in F. solani, an increase in the culture time caused lower holocellulolytic activity.

3.4. Optimization of Holocellulase Production

The goodness degree of the fermentation process for the production of holocellulolytic enzymes, which is represented by the desirability function, was investigated to optimize the fermentation conditions. The minimum and maximum values of the holocellulolytic activities were obtained from the results of the BW design. The minimum and maximum limits for optimization were set and transformed to encoded desirability values, 0 and 1, respectively, to explore the best holocellulase production conditions.
The optimization was carried out jointly based on the desirability values specified for the three enzymatic activities. For both fungi, the combination of the best conditions was obtained, which maximizes the endoxylanase and β-xylosidase activities while minimizing the endocellulase activity (Table 6). The maximum production of holocellulases by F. solani was achieved after 48 h of fermentation, with an initial concentration of 25 g/L, 1.0 g/L, 2.5 g/L, and 0.7 g/L of CS, yeast extract, ammonium sulfate, and urea, respectively. The optimal conditions were similar for Aspergillus sp., although its demand for a nitrogen source was greater, with yeast extract and urea values of 9.0 g/L and 1.3 g/L, respectively. Furthermore, the fermentation time was four times longer (192 h) and its holocellulase production lower than for F. solani.

3.5. Verification of Optimal Conditions to Produce of Holocellulases

Based on the optimal conditions found for the production of holocellulases by F. solani and Aspergillus sp., the activity values predicted by the model were verified through fermentation experiments based on the optimal combination of the nutritional factors studied. Table 7 shows the holocellulolytic activity predicted by the model and that obtained experimentally from the optimal values of the factors. The production of endoxylanases by F. solani was higher when compared to the predicted activity values. The β-xylosidase activity was close to the predicted value, while cellulolytic activity was not detected under these optimal conditions. Regarding Aspergillus sp., the endoxylanase and β-xylosidase activities were lower, but close to the predicted values, and the observed cellulolytic activity exceeded the predicted value.

4. Discussion

Filamentous fungi are suitable for developing bioconversion processes through solid-state fermentation (SSF) due to their ability to grow on low-water-content substrates [27]. Although filamentous fungi adapt easily to environments with reduced humidity, in this study, critical humidity levels restricted the production of holocellulases by both fungi, since the increase in the concentration of CS causes a reduction in the amount of water available. In the case of Aspergillus sp., the effect was smaller than in F. solani. It was observed that the levels of enzymatic activity was influenced by the culture conditions and the nature of the fungus [28,29,30,31]. The maximum holocellulolytic activity of F. solani was present in semi-solid culture, while for in Aspergillus sp., it was observed in solid culture.
Aspergillus sp. are distinguished by their significant xylanolytic activity. Various reports exist on the production of xylanases in liquid culture from A. awamori [32], A. oryzae NRRL 3485, A. phoenicis ATCC 13157, A. foetidus ATCC 14916 [33], A. niger [34], and Aspergillus sp. [35], although studies on Aspergillus sp. for xylanase production in solid culture are more numerous [36,37,38,39,40,41,42].
Aspergillus sp. is recognized as a filamentous fungus that produces large amounts of extracellular xylanases. However, in this work, the maximum holocellulolytic activity was achieved by F. solani. Interestingly, in all semi-solid culture media, the endoxylanase activity of F. solani was superior to that of Aspergillus sp.
F. solani is a phytopathogenic fungus that causes wilt diseases in a wide variety of plants such as pumpkin, pea, soybean, bean, potato, alfalfa, blueberry, peanut, and tomato crops [28,43]. F. solani was previously isolated from bean crops. The hemicellulose content of bean straw is 14.5% [44]. The great xylanolytic activity exhibited by this fungus could be related to its virulence and the significant hemicellulose content of this crop.
In contrast, in this work, the maximum endoxylanase activity was obtained in a semi-solid culture media (experiment 2). Martínez-Pacheco et al. [5] optimized the production of xylanases with low cellulases in Fusarium solani by means of a solid-state fermentation with beechwood xylan as a model carbon source. They found that the major production of endoxylases (12 U/mg) and β-xylosidases (0.53 U/mg) was observed in solid and liquid cultures, respectively. However, for larger-scale production, the use of this carbon source would not be economically profitable. In contrast, Moctezuma-Zárate et al. [45] obtained maximum xylanolytic activity (47.5 ng xylose/min·mg protein) from F. solani through a fermentation liquid medium supplemented with xylan (Sigma) as inductor.
Moisture content, which is inversely proportional to the carbon source concentration, was an important variable for the production of holocellulases by F. solani because it showed lower activity in culture media with low moisture (high concentration of carbon source). Bakri et al. [46] observed the same effect of moisture level: the xylanase production by F. solani on wheat bran was optimum (1593 U/g substrate) using an intermediate level of moisture (75%), with respect to the values explored, since a lower moisture ratio leads to the reduced solubility of the nutrients of the solid substrate, lower degree of swelling, and higher water tension.
In terms of the concentration and type of nitrogen source, yeast extract and ammonium sulfate had no effect on holocellulase production by F. solani, but urea did on xylanase production. Urea caused the maximum production of xylanase by F. solani in a fermentation liquid medium supplemented with xylan (Sigma).
In this work, the increase in the concentration of yeast extract favored the production of holocellulases by Aspergillus sp. In particular, the production of β-xylosidases depended on the adequate supply of the three nitrogen sources studied. This factor demonstrates that microorganisms, specifically filamentous fungi, have very specific nutrient requirements. In particular, the source of nitrogen required may be different from one fungus to another. Ellatif et al. [47] concluded that malt extract was the most suitable nitrogen source for producing xylanase by Trichoderma harzianum kj831197.1, as it offered the maximal enzyme activity. The optimal conditions for xylanase production by T. harzianum included the addition of ammonium sulphate [48].
F. solani produced more holocellulases in a short time, and as it increased, its holocellulolytic activity was reduced compared to Aspergillus sp., which required a long incubation time to increase its enzymatic activity. The production of primary metabolites by microorganisms, as enzymes, is highly influenced by their growth, which is determined by the availability of the nutrients in the substrates. Therefore, the time of fermentation could be affected by moisture content, which determines this availability. This means that there is a close relationship between the fermentation time and the moisture content of the culture medium. The optimal conditions for holocellulose production vary widely from one fungal isolate to another, especially the time of peak xylanase activity: F. solani on xylan (Sigma), 13 days [49]; Fusarium graminearum on wheat bran, 6.4 days [50]; Fusarium sp. XPF5 on xylan, 4 days [51]; Fusarium solani on beechwood xylan, 5 days [5]; T. harzianum on wheat bran, 6 days [48]; Aspergillus fumigatus SD5A (SmF), 7 days, and A. fumigatus L1. (SSF), 5 days, both grown on corn cob [52].
Aspergillus sp. exhibited a greater capacity to adapt to different culture conditions due to its significant level of holocellulolytic activity and its abundant growth in the different experiments. In addition to its great xylanolytic activity, Aspergillus sp. is recognized as a good producer of commercial cellulases [53], though, interestingly, F. solani showed the highest holocellulolytic activity in one part of the experiments carried out. Specifically, like Aspergillus sp., this indicates its adaptability to a wide variety of culture conditions, making this fungus a potential source of cellulases. F. solani showed greater sensitivity to various culture conditions since it was more demanding in its nutritional requirements compared to Aspergillus sp., and was able to grow on corn stover as the only carbon source and exhibit holocellulolytic activity. Some species of the genus Fusarium stand out for their great ability to adapt to extreme environmental conditions. This is the case for Fusarium sp. XPF-5, which is considered a thermo-alkaliphile, making it a potential candidate for large-scale xylanase production and use in biotechnological processes [50].
Various studies have shown that filamentous fungi grow better on solid substrates and the production of extracellular enzymes increases. However, fermentation in liquid culture has the advantage of providing homogeneous media, with fewer pH and temperature gradients and with greater availability of nutrients and oxygen. The best theoretical conditions for the production of holocellulases by both fungi were liquid cultures. The maximum predicted values for endoxylanase and β-xylosidase activities with F. solani were higher than those observed before optimization. As for Aspergillus sp., these predicted values were lower after optimization, since the objective was to reduce cellulolytic activity.
Interestingly, after experimentally verifying the optimal conditions, the endoxylanase activity of F. solani was higher than the values predicted by the model. The predicted values are the result of an idealization of the fermentation process for the production of holocellulases, based on the conditions explored, so the response is not always close or equal to the predicted value. On the other hand, although it was observed that cellulolytic activity was closely related to xylanolytic activity in both fungi, in the case of F. solani, it was possible to reduce it without affecting xylanolytic activity. SSF presents several advantages in comparison with submerged fermentation (SmF), such as fewer energy requirements and higher productivity, although several operational aspects must be considered, since there remains no effective technical solution (e.g., aeration and gradients of concentration), so only a few compounds are industrially implemented.

5. Conclusions

The present study reveals that F. solani is a fungal isolate with high potential for use in the industrial production of enzymes due its high holocellulolytic activity compared with Aspergillus sp. The maximum holocellulolytic activity of F. solani was obtained in semi-solid media, whereas with the wild strain of Aspergillus sp., this was achieved in a solid medium, which is related to their high adaptability in a wide variety of culture conditions. For years, Aspergillus sp. has been industrially exploited for enzyme production, but these findings make F. solani a potential source of holocellulases. Based on the optimization model, F. solani and Aspergillus sp. produce interesting holocellulolytic activity in a growth medium with corn stover as the only carbon source. This is a potential alternative means of valorizing agricultural waste such as corn stover through the fermentation and holocellulase production of Fusarium solani. The fermentation time and the amount of corn stover required to obtain maximum holocellulase is a possible advantage for Fusarium solani and Aspergillus sp., respectively.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fermentation10020084/s1.

Author Contributions

Conceptualization, M.A.-N. and K.L.A.-H.; methodology, M.A.-N., K.L.A.-H. and A.F.-G.; validation, C.V.-B. and J.A.-H.; formal analysis, M.M.M.-P.; investigation, M.A.-N. and K.L.A.-H.; resources, M.M.M.-P.; writing—original draft preparation, M.A.-N. and K.L.A.-H.; writing—review and editing, C.V.-B. and M.M.M.-P.; supervision and funding acquisition, M.M.M.-P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Universidad Michoacana de San Nicolás de Hidalgo, grant number 2.1 mmmp, and the APC was funded by the M3P Foundation.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article and supplementary materials.

Acknowledgments

The authors thank the M3P Foundation. K.L.A.-H. has a scholarship from CONAHCYT.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Barrera-Guzmán, L.A.; Cadena-Iñiguez, J.; Ramírez-Ojeda, G. Implementation of stubble in agricultural production: A review. Agro-Prod. 2022, IX, 185–193. [Google Scholar] [CrossRef]
  2. Kwiatkowski, C.A.; Harasim, E.; Haliniarz, M.; Gawęda, D.; Misztal-Majewska, B.; Chojnacka, S. Chemical composition of stubble crop biomass depending on a crop plant species and tillage system. J. Elem. 2019, 24, 1371–1381. [Google Scholar] [CrossRef]
  3. Morales-Máximo, C.N.; López-Sosa, L.B.; Rutiaga-Quiñones, J.G.; Corral-Huacuz, J.C.; Aguilera Mandujano, A.; Pintor-Ibarra, L.F.; López-Miranda, A.; Delgado Domínguez, S.N.; Rodríguez Magallón, M.d.C.; Morales-Máximo, M. Characterization of agricultural residues of Zea mays for their application as solid biofuel: Case study in San Francisco Pichátaro, Michoacán, México. Energies 2022, 15, 6870. [Google Scholar] [CrossRef]
  4. Garg, G.; Mahajan, R.; Kaur, A.; Sharma, J. Xylanase production using agro-residue in solid-state fermentation from Bacillus pumilus ASH for biodelignification of wheat straw pulp. Biodegradation 2011, 22, 1143–1154. [Google Scholar] [CrossRef]
  5. Martínez-Pacheco, M.M.; Flores-García, A.; Zamudio-Jaramillo, M.A.; Chávez-Parga, M.C.; Alvarez-Navarrete, M. Production of extracellular xylanase from a wild isolate of Fusarium solani. Rev. Argent. Microbiol. 2020, 52, 328–337. [Google Scholar] [CrossRef]
  6. Liu, W.; Shi, P.; Chen, Q.; Yang, P.; Wang, G.; Wang, Y.; Luo, H.; Yao, B. Gene cloning, overexpression, and characterization of a xylanase from Penicillium sp. CGMCC 1669. Appl. Biochem. Biotechnol. 2010, 162, 1–12. [Google Scholar] [CrossRef]
  7. Andrade-Hoyos, P.; Rivera-Jiménez, M.N.; Landero-Valenzuela, N.; Silva-Rojas, H.V.; Martínez-Salgado, S.J.; Romero-Arenas, O. Ecological and biological benefits of the cosmopolitan fungus Trichoderma spp. in agriculture: A perspective in the Mexican countryside. Rev. Argent. Microbiol. 2023, 55, 366–377. [Google Scholar] [CrossRef]
  8. Kumar, R.; Verma, D.; Sharma, S.; Satyanarayana, T. Applicability of fungal xylanases in food biotechnology. In Fungi and Fungal Products in Human Welfare and Biotechnology; Satyanarayana, T., Deshmukh, S.K., Eds.; Springer: Singapore, 2023. [Google Scholar] [CrossRef]
  9. Saldarriaga-Hernández, S.; Velasco-Ayala, C.; Leal-Isla Flores, P.; Rostro-Alanis, M.J.; Parra-Saldivar, R.; Iqbal, H.M.N.; Carrillo-Nieves, D. Biotransformation of lignocellulosic biomass into industrially relevant products with the aid of fungi-derived lignocellulolytic enzymes. Int. J. Biol. Macromol. 2020, 161, 1099–1116. [Google Scholar] [CrossRef] [PubMed]
  10. Carrillo-Nieves, D.; Saldarriaga-Hernández, S.; Gutiérrez-Soto, G.; Rostro-Alanis, M.; Hernández-Luna, C.; Alvarez, A.J.; Iqbal, H.M.N.; Parra-Saldívar, R. Biotransformation of agro-industrial waste to produce lignocellulolytic enzymes and bioethanol with a zero waste. Biomass Convers. Biorefin 2022, 12, 253–264. [Google Scholar] [CrossRef]
  11. Astorga-Trejo, R.; Fonseca-Peralta, H.M.; Beltrán-Arredondo, L.I.; Castro-Martínez, C. Use of corn stover for the production of 2G bioethanol, enzymes and xylitol under a biorefinery concept. World Acad. Sci. Eng. Technol. 2022, 16, 9. Available online: https://publications.waset.org/pdf/10012662. (accessed on 13 June 2023).
  12. Howard, R.L.; Abotsi, E.; Jansen van Rensburg, E.L.; Howard, S. Lignocellulose biotechnology: Issues of bioconversion and enzyme production. Afr. J. Biotechnol. 2003, 2, 602–619. [Google Scholar] [CrossRef]
  13. Narayanan Narayanan, M.; Sameh Samir, A.; El-Sheekh, M. A comprehensive review on the potential of microbial enzymes in multipollutant bioremediation: Mechanisms, challenges, and future prospects. J. Environ. Manag. 2023, 334, 117532. [Google Scholar] [CrossRef]
  14. Marinho, G.O.; Nogueira, E.A.; Machado Pasin, T.; Brito de Oliveira, T.; Bretas Roa, J.P.; Nelson, D.L.; Benassi, V.M. An environmentally safe production of xylanases by Fusarium sp. EA 1.3.1 using agroindustrial residues: Biochemical characterization and potential applications. Asian J. Biochem. Gen. Mol. Biol. 2023, 14, 11–26. [Google Scholar] [CrossRef]
  15. Kaur, D.; Joshi, A.; Sharma, V.; Batra, N.; Sharma, A.K. An insight into microbial sources, classification, and industrial applications of xylanases: A rapid review. Biotechnol. Appl. Biochem. 2023, 70, 1489–1503. [Google Scholar] [CrossRef]
  16. Zhao, X.; Chai, J.; Wang, F.; Jia, Y. Optimization of submerged culture parameters of the aphid pathogenic fungus Fusarium equiseti based on sporulation and mycelial biomass. Microorganisms 2023, 11, 190. [Google Scholar] [CrossRef]
  17. Alvarez-Navarrete, M.; Reyna López, G.E.; Flores García, A.; López Gómez, R.; Martínez-Pacheco, M.M. Selection and molecular identification of fungal isolates that produce xylanolytic enzymes. Genet. Mol. Res. 2015, 14, 8100–8116. [Google Scholar] [CrossRef]
  18. Lin, R.C.; Ding, Z.S.; Li, L.B.; Kuang, T.Y. A rapid and efficient DNA minipreparation suitable for screening transgenic plants. Plant Mol. Biol. Report. 2001, 19, 379. Available online: https://link.springer.com/content/pdf/10.1007/BF02772839.pdf. (accessed on 1 September 2023). [CrossRef]
  19. Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553–556. [Google Scholar] [CrossRef]
  20. Montgomery, D.C.; Runger, G.C. Applied Statistics and Probability for Engineers; John Wiley & Sons: New York, NY, USA, 1996. [Google Scholar]
  21. Bailey, M.J.; Biely, P.; Poutanen, K. Interlaboratory testing of methods for assay of xylanase activity. J. Biotechnol. 1992, 23, 257–271. [Google Scholar] [CrossRef]
  22. Ghose, T.K. Measurement of cellulase activities. Pure Appl. Chem. 1987, 59, 257–268. [Google Scholar] [CrossRef]
  23. Kristufek, D.; Zeilinger, S.; Kubicek, C.P. Regulation of β-xylosidase formation by xylose in Trichoderma reesei. Appl. Microbiol. Biotechnol. 1995, 42, 713–717. [Google Scholar] [CrossRef]
  24. Miller, G.L. Use of DNS for determination of reducing sugar. Anal. Chem. 1959, 31, 426–428. [Google Scholar] [CrossRef]
  25. Lowry, O.H.; Rosenbrough, N.J.; Farr, A.L.; Randall, R.J. Protein measurement with the Folin phenol reagent. J. Bio. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef]
  26. Derringer, G.; Suich, R. Simultaneous optimization of several response variables. J. Qual. Technol. 1980, 12, 214–219. [Google Scholar] [CrossRef]
  27. Cebrián, M.; Ibarruri, J. Filamentous fungi processing by solid-state fermentation. In Current Developments in Biotechnology and Bioengineering; Filamentous Fungi Biorefinery; Elsevier: Amsterdam, The Netherlands, 2023; pp. 251–292. [Google Scholar] [CrossRef]
  28. Gupta, V.K.; Gaur, R.; Yadava, S.K.; Darmwal, N.S. Optimization of xylanase production from free and immobilized cells of Fusarium solani F7. Bioresources 2009, 4, 932–945. Available online: https://bioresources.cnr.ncsu.edu/BioRes_04/BioRes_04_3_0932_Gupta_GYD_Opt_Xylanase_Prodn_Fee_Immob_Cells_434.pdf (accessed on 7 April 2023). [CrossRef]
  29. Obruca, S.; Marova, I.; Matouskova, P.; Haronikova, A.; Lichnova, A. Production of lignocellulose-degrading enzymes employing Fusarium solani F-552. Folia Microbiol. 2012, 57, 221–227. [Google Scholar] [CrossRef]
  30. Bakri, Y.; Jawhar, M.; Arabi, M.I.E. Molecular and xylanolytic variation identified among isolates of Fusarium species. J. Plant Biol. Res. 2012, 1, 51–56. Available online: http://www.inast.otg/jpbr.html (accessed on 7 April 2023).
  31. Agustini, L.; Efiyanti, L.; Faulina, S.A.; Santoso, E. Isolation and characterization of cellulase- and xylanase-producing microbes isolated from tropical forests in Java and Sumatra. Int. J. Environ. Bioener. 2012, 3, 154–167. Available online: https://modernscientificpress.com/Journals/ViewArticle.aspx?gkN1Z6Pb60HNQPymfPQlZM2QzBATUXAyEhQZJVFyB5jxACLp2DSn8X3BE2yz4Gxm (accessed on 7 April 2023).
  32. Lemos, J.L.S.; Fontes, M.C.A.; Pereira, N., Jr. Xylanase production by Aspergillus awamori in solid-state fermentation and influence of different nitrogen sources. Appl. Biochem. Biotechnol. 2001, 91–93, 681–690. [Google Scholar] [CrossRef]
  33. Chipeta, Z.A.; du Preez, J.C.; Szakacs, G.; Christopher, L. Xylanase production by fungal strains on spent sulfite liquor. Appl. Microbiol. Biotechnol. 2005, 69, 71–78. [Google Scholar] [CrossRef] [PubMed]
  34. Padmavathi, T.; Kavya, V. Isolation, identification and optimization of xylanase enzyme produced by Aspergillus niger under submerged fermentation. J. Microbiol. Biotechnol. Res. 2011, 1, 137–147. Available online: http://scholarsresearchlibrary.com/archive.html (accessed on 8 April 2023).
  35. Sridevi, B.; Charya, M.A.S. Isolation, identification, and screening of potential cellulase-free xylanase producing fungi. Afr. J. Biotechnol. 2011, 10, 4624–4630. [Google Scholar]
  36. Kheng, P.P.; Ibrahim, C.O. Xylanase production by a local fungal isolate, Aspergillus niger USM AI 1 via solid state fermentation using palm kernel cake (PKC) as substrate. Songklanakarin J. Sci. Technol. 2005, 27, 325–336. Available online: https://www.thaiscience.info/Journals/Article/SONG/10462555.pdf (accessed on 8 April 2023).
  37. Shah, A.R.; Madamwar, D. Xylanase production under solid-state fermentation and its characterization by an isolated strain of Aspergillus foetidus in India. World J. Microbiol. Biotechnol. 2005, 21, 233–243. [Google Scholar] [CrossRef]
  38. Xu, Y.-X.; Li, Y.-L.; Xu, S.-C.; Liu, Y.; Wang, X.; Tang, J.-W. Improvement of xylanase production by Aspergillus niger XY-1 using response surface methodology for optimizing the medium composition. J. Zhejiang Univ. Sci. B 2008, 9, 558–566. [Google Scholar] [CrossRef]
  39. Liu, C.; Sun, Z.-T.; Du, J.-H.; Wang, J. Response surface optimization of fermentation conditions for producing xylanase by Aspergillus niger SL-05. J. Ind. Microbiol. Biotechnol. 2008, 35, 703–711. [Google Scholar] [CrossRef]
  40. Maciel, G.M.; Vandenberghe, L.P.S.; Haminiuk, C.W.I.; Fendrich, R.C.; Bianca, B.E.D.; Brandalize, T.Q.S.; Pandey, A.; Soccol, C.R. Xylanase production by Aspergillus niger LPB 326 in solid-state fermentation using statistical experimental design. Food Technol. Biotechnol. 2008, 46, 183–189. Available online: https://ftb.com.hr/images/pdfarticles/2008/April-June/46-183.pdf (accessed on 8 April 2023).
  41. Kavya, V.; Padmavathi, T. Optimization of growth conditions for xylanase production by Aspergillus niger in solid state fermentation. Pol. J. Microbiol. 2009, 58, 125–130. Available online: http://www.pjmonline.org/wp-content/uploads/archive/vol5822009125.pdf (accessed on 16 April 2023). [PubMed]
  42. Regalado, C.; Vázquez-Obregón, I.; García-Almendárez, B.E.; Domínguez-Domínguez, J.; Aguilera-Barreyro, A.; Amaro-Reyes, A. Xylanolytic enzymes production by Aspergillus niger GS1 from solid state fermentation on corn stover and their effect on ruminal digestibility. Electronic J. Biotechnol. 2011, 14, 9. [Google Scholar] [CrossRef]
  43. Silvestro, L.B.; Stenglein, S.A.; Forjan, H.; Dinolfo, M.I.; Arambarri, A.M.; Manso, L.; Moreno, M.V. Occurrence and distribution of soil Fusarium species under wheat crop in zero tillage. Span. J. Agric. Res. 2013, 11, 72–79. [Google Scholar] [CrossRef]
  44. González-Rentería, S.M.; Soto-Cruz, N.O.; Rutiaga-Quiñones, O.M.; Medrano-Roldán, H.; Rutiaga-Quiñones, J.G.; López-Miranda, J. Optimización del proceso de hidrólisis enzimática de una mezcla de pajas de frijol de cuatro variedades (Pinto villa, Pinto saltillo, Pinto mestizo y Flor de mayo). Rev. Mex. Ing. Quim. 2011, 10, 17–28. [Google Scholar]
  45. Moctezuma-Zárate, M.; Vargas-Morales, J.; Cárdenas-González, J.; Martínez-Juárez, V.; Acosta-Rodríguez, I. Induction of extracellular lytic enzymes by Fusarium solani. Adv. Microbiol. 2013, 3, 24–30. Available online: https://www.scielo.org.mx/pdf/rmiq/v10n1/v10n1a3.pdf (accessed on 16 April 2023). [CrossRef]
  46. Bakri, Y.; Jawhar, M.; Arabi, M.I.E. Xylanase production by Fusarium solani in solid state fermentation. Res. Biotechnol. 2013, 4, 31–37. [Google Scholar]
  47. Ellatif, S.A.; Abdel Razik, E.S.; Al-Surhanee, A.A.; Al-Sarraj, F.; Daigham, G.E.; Mahfouz, A.Y. Enhanced production, cloning, and expression of a xylanase gene from endophytic fungal strain Trichoderma harzianum kj831197.1: Unveiling the in vitro anti-fungal activity against phytopathogenic fungi. J. Fungi 2022, 25, 447. [Google Scholar] [CrossRef] [PubMed]
  48. Dhaver, P.; Pletschke, B.; Sithole, B.; Govinden, R. Optimization, purification, and characterization of xylanase production by a newly isolated Trichoderma harzianum strain by a two-step statistical experimental design strategy. Sci. Rep. 2022, 12, 17791. [Google Scholar] [CrossRef] [PubMed]
  49. Cruz-Davila, J.; Vargas Perez, J.; Sosa del Castillo, D.; Diez, N. Fusarium graminearum as a producer of xylanases with low cellulases when grown on wheat bran. Biotechnol. Rep. 2022, 35, e00738. [Google Scholar] [CrossRef] [PubMed]
  50. Sharma, P.; Kaushik, N.; Sharma, S.; Kumar, V. Isolation, screening, characterization and optimization of xylanase production from thermostable alkalophillic Fusarium sp. XPF5. J. Biochem. Tech. 2016, 7, 1089–1092. [Google Scholar]
  51. Elegbede, J.A.; Lateef, A. Valorization of corn-cob by fungal isolates for production of xylanase in submerged and solid state fermentation media and potential biotechnological applications. Waste Biomass Valorization 2018, 9, 1273–1287. [Google Scholar] [CrossRef]
  52. Sakthi, S.S.; Saranraj, P.; Rajasekar, M. OOOptimization for cellulase production by Aspergillus niger using paddy straw as substrates. Int. J. Adv. Sci. Tech. Res. 2011, 1, 69–85. Available online: http://www.rspublication.com/ijst/index.html (accessed on 16 April 2023).
  53. Rodríguez Couto, S.R.; Sanromán, M.Á. Application of solid-state fermentation to food industry—A review. J. Food Eng. 2006, 76, 291–302. [Google Scholar] [CrossRef]
Fermentation 10 00084 g001
Figure 1. Holocellulolytic activity of F. solani (red) and Aspergillus sp. (green). (a) Endoxylanases; (b) β-xylosidases; (c) endocellulase. Values represent the X ¯ ± standard error, n = 3.
Figure 1. Holocellulolytic activity of F. solani (red) and Aspergillus sp. (green). (a) Endoxylanases; (b) β-xylosidases; (c) endocellulase. Values represent the X ¯ ± standard error, n = 3.
Fermentation 10 00084 g001
Fermentation 10 00084 g002aFermentation 10 00084 g002b
Figure 2. Correlation between the values predicted by the Box–Wilson design (Y-axis) and the experimental values of enzyme activity (X-axis). (a) Endoxylanase, (b) β-xylosidase, (c) endocellulose.
Figure 2. Correlation between the values predicted by the Box–Wilson design (Y-axis) and the experimental values of enzyme activity (X-axis). (a) Endoxylanase, (b) β-xylosidase, (c) endocellulose.
Fermentation 10 00084 g002aFermentation 10 00084 g002b
Fermentation 10 00084 g003
Figure 3. Effect of factors on response variables: (a) endoxylanase; (b) β-xylosidase; (c) endocellulase. (L) Linear effect of the factor, (Q) quadratic effect of the factor, ( x i Lby x j L) effect of interaction of linear factors x i and x j . The bars that cross the dotted red line correspond to the factors that have a significant effect on the production of holocellulases in their linear, quadratic forms or in interaction with other factors.
Figure 3. Effect of factors on response variables: (a) endoxylanase; (b) β-xylosidase; (c) endocellulase. (L) Linear effect of the factor, (Q) quadratic effect of the factor, ( x i Lby x j L) effect of interaction of linear factors x i and x j . The bars that cross the dotted red line correspond to the factors that have a significant effect on the production of holocellulases in their linear, quadratic forms or in interaction with other factors.
Fermentation 10 00084 g003
Table 1. Experiment generated from the rotatable composite Box–Wilson design (S: solid, Ss: semi-solid, L: liquid).
Table 1. Experiment generated from the rotatable composite Box–Wilson design (S: solid, Ss: semi-solid, L: liquid).
Experiment NumberCoded FactorsState of Aggregation
(Type of Culture Medium)
x1x2x3x4x5
1−1−1−1−1+1Ss
2−1−1−1+1−1Ss
3−1−1+1−1−1Ss
4−1−1+1+1+1Ss
5−1+1−1−1−1Ss
6−1+1−1+1+1Ss
7−1+1+1−1+1Ss
8−1+1+1+1−1Ss
9+1−1−1−1−1S
10+1−1−1+1+1S
11+1−1+1−1+1S
12+1−1+1+1−1S
13+1+1−1−1+1S
14+1+1−1+1−1S
15+1+1+1−1−1S
16+1+1+1+1+1S
17−20000L
18+20000S
190−2000S
200+2000S
2100−200S
2200+200S
23000−20S
24000+20S
250000−2S
260000+2S
2700000S
Table 2. Decoded factors and their corresponding values to the coded levels.
Table 2. Decoded factors and their corresponding values to the coded levels.
Variable (g/L or h)Decoded Factor
−2−10+1+2
x1 Carbon source2535067510001325
x2 Yeast extract13579
x3 Ammonium sulfate0.511.522.5
x4 Urea5356595125
x5 Time4884120156192
Table 3. Comparison of the maximum experimental holocellulolytic activity of F. solani and Aspergillus sp.
Table 3. Comparison of the maximum experimental holocellulolytic activity of F. solani and Aspergillus sp.
Fungal IsolateHolocellulolytic ActivityMaximum Enzymatic Activity (U/mg)Experiment Number/Type of Culture Medium
Apergillus sp.Endoxylanase5.9011/S
β-xylosidase0.2822/S
Endocellulase1.8020/S
F. solaniEndoxylanase14.152/Ss
β-xylosidase0.752/Ss
Endocellulase2.002/Ss
Table 4. ANOVA for the second-order polynomial model, F. solani (test of SS whole model vs. SS residual).
Table 4. ANOVA for the second-order polynomial model, F. solani (test of SS whole model vs. SS residual).
Holocellulolytic
Activity		Multiple
R		Multiple
R2		Adjusted
R2		ResidualFp
dfSSMS
Endoxylanase0.8462600.7161560.62154160228.95773.8159617.5691840.000000
β-xylosidase0.7895360.6233670.497823600.90510.0150854.9653120.000001
Endocellulase0.8750810.7657670.687689602.86430.0477399.8077530.000000
Table 5. ANOVA for the second-order polynomial model, Aspergillus sp. (test of SS whole model vs. SS residual).
Table 5. ANOVA for the second-order polynomial model, Aspergillus sp. (test of SS whole model vs. SS residual).
Holocellulolytic
Activity		Multiple
R		Multiple
R2		Adjusted
R2		ResidualFp
dfSSMS
Endoxylanase0.7369370.5430760.39076860100.18641.6697733.5656390.000071
β-xylosidase0.7514770.5647180.419624600.27080.0045133.8920840.000023
Endocellulase0.7563090.5720030.429337608.06940.1344904.0093920.000015
Table 6. Comparison of the theoretical optimal conditions to produce holocellulases by F. solani and Aspergillus sp.
Table 6. Comparison of the theoretical optimal conditions to produce holocellulases by F. solani and Aspergillus sp.
FungusFermentation Time
(h)		Optimal Nutritional Condition (g/L)Holocellulolytic Activity (U/mg)
CSYeast Extract(NH4)2SO4UreaEndoxy-Lanaseβ-xylosidaseEndocellulase
F. solani48251.02.50.720.481.192.38
Aspergillus sp.192259.02.51.313.200.500.74
Table 7. Verification of optimal culture conditions to produce fungal holocellulases. Experimental values represent the X ¯ ± standard error, n = 3.
Table 7. Verification of optimal culture conditions to produce fungal holocellulases. Experimental values represent the X ¯ ± standard error, n = 3.
Holocellulolytic Activity (U/mg)F. solaniAspergillus sp.
TheoreticalExperimentalTheoreticalExperimental
Endoxylanase20.4825.0 ± 0.1913.209.03 ± 0.64
β-xylosidase1.191.01 ± 0.010.500.29 ± 0.01
Endocellulase2.3800.742.25 ± 0.06
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Alvarez-Navarrete, M.; Alonso-Hurtado, K.L.; Flores-García, A.; Altamirano-Hernández, J.; Martínez-Pacheco, M.M.; Velázquez-Becerra, C. Comparative Study of the Extracellular Holocellulolytic Activity of Fusarium solani and Aspergillus sp. in Corn Stover. Fermentation 2024, 10, 84. https://doi.org/10.3390/fermentation10020084

AMA Style

Alvarez-Navarrete M, Alonso-Hurtado KL, Flores-García A, Altamirano-Hernández J, Martínez-Pacheco MM, Velázquez-Becerra C. Comparative Study of the Extracellular Holocellulolytic Activity of Fusarium solani and Aspergillus sp. in Corn Stover. Fermentation. 2024; 10(2):84. https://doi.org/10.3390/fermentation10020084

Chicago/Turabian Style

Alvarez-Navarrete, Mariana, Katia L. Alonso-Hurtado, Alberto Flores-García, Josué Altamirano-Hernández, Mauro M. Martínez-Pacheco, and Crisanto Velázquez-Becerra. 2024. "Comparative Study of the Extracellular Holocellulolytic Activity of Fusarium solani and Aspergillus sp. in Corn Stover" Fermentation 10, no. 2: 84. https://doi.org/10.3390/fermentation10020084

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop