Next Article in Journal
Recent Advances and Challenges in the Production of Hydroxylated Natural Products Using Microorganisms
Previous Article in Journal
Application of Pseudomonas cepacia CCT 6659 Biosurfactant as a Metal Corrosion Inhibitor in a Constructed Accelerated Corrosion Chamber (ACC)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting

1
School of Breeding and Multiplication, Sanya Institute of Breeding and Multiplication, Hainan University, Sanya 572025, China
2
College of Tropical Agriculture and Forestry, Hainan University, Danzhou 571737, China
*
Author to whom correspondence should be addressed.
Fermentation 2024, 10(12), 603; https://doi.org/10.3390/fermentation10120603
Submission received: 27 September 2024 / Revised: 13 November 2024 / Accepted: 20 November 2024 / Published: 26 November 2024

Abstract

Bone meal has been used as economic and effective additive for heavy metals (HMs) pollution remediation due to the distinct components and structures that enable their favorable properties, such as its low cost, high adsorption capacity, acid-base adjustability, and ion-exchange capability. However, no attempt has been made to establish whether cow bone could promote the passivation of HMs and the removal of metal resistance genes (MRGs) and antibiotics resistance genes (ARGs) during the composting process. Two sizes of cow bone (meal (T2) and granule (T3)) were added to investigate their effects on humification, HMs passivation and the abundance of ARGs and MRGs during swine manure composting. Excitation-emission matrix (EEM)-parallel factor analysis showed that the percentage of maximum fluorescence intensity of humic-like substances were higher in T2 (91.82%) than in T3 (88.46%), implying that T2 could promote the humification process compared to T3. In comparison with control (T1), the addition of T2 and T3 could promote the change of exchangeable Cu and reducible Cu into oxidizable Cu, thus reducing the mobility factors (MF) of Cu in T2 and T3 treatments by 10.48% and 6.98%, respectively. In addition, T2 and T3 could increase exchangeable Zn into reducible Zn and oxidizable Zn, thereby reducing the MF of Zn in T2 and T3 treatments by 18.80% and 2.0%, respectively. Quantitative Real-time PCR (qPCR) analysis revealed that the total abundances of MRGs were decreased by 100% in T2 and T3 treatments, and T2 decreased the total relative abundance of ARGs. Furthermore, the relative abundance of ARGs and MRGs had significantly correlated with intI1 and bio-available of Cu and Zn, which was triggered by selective pressure of HMs and horizontal gene transfer. The present study suggested that cow bone meal as additives can be a feasible approach to promote the passivation of HMs and enhance the removal of MGRs and ARGs by decreasing horizontal gene transfer and selective pressure by bioavailable HMs.

1. Introduction

Livestock manure is regarded as a major problem in China. Approximately 1.5 billion tons of livestock manure is produced every year, accounting for almost 39.5% of the total waste output [1]. Swine manure is rich in nutrients and organic content, as well as pollutants including pathogens, heavy metals (HMs), organic pollutants and other pollutants [2]. HM pollution in animal husbandry has been the focus of attention for years, mainly because metal elements (such as Cu, Zn, etc.) are constantly added to animal feed to promote growth and control disease in livestock farms [3,4]. However, these elements are poorly absorbed by animals, and a large part is excreted in animal urine and feces [5]. It is reported that in China, the contents of Cu and Zn in swine manure can be up to 2017 mg·kg−1 and 1506 mg·kg−1, respectively [6,7] In addition to HMs, animal manure has become a hotspot for antibiotics resistance genes (ARGs), and the agricultural application of animal manure represents an important pathway for the dissemination of ARGs in the environment. The high concentration of HMs in animal manure can exert significant selective pressure on the generation of ARGs and metal resistance genes (MRGs) by using several mechanisms such as co-resistance, resulting in the ARGs and MRGs dissemination with unperceived risk [8]. In addition, plasmid-mediated antibiotic resistance between bacteria could be promoted by sub-inhibitory concentrations of HMs (Cu2+, Ag+, Cr6+ and Zn2+) [9]. Metal species in swine manure are categorized into four fractions: exchangeable, reducible, oxidizable and residual fractions, and exchangeable and reducible fractions were regarded as the bioavailability fractions of HMs [10]. It is noted that a direct relationship was discovered between the bioavailability HMs and ARGs and MRGs. Furthermore, Cui et al. [11] revealed that the correlations between bioavailable HMs and ARGs were more significant than those between total HMs and ARGs. Therefore, the decrease of bioavailability HMs may reduce the selective pressure for antibiotic resistance and further aid in attenuation of ARGs.
Various methodologies can be employed for the treatment of livestock manure, including aerobic composting, drying techniques, anaerobic digestion and utilization as animal feed [12,13,14,15]. Composting is a widely utilized and effective method for treating animal manure, known to alter the chemical forms and reduce the bioavailability of HMs [16]. The humus present in composting exhibits a diverse array of reactive and functional groups, which facilitate the adsorption of heavy metal cations and formation of complexes with these metals. This process effectively reduces their mobility and potential bioavailability, thereby mitigating heavy metal contamination [17]. The BCR sequential extraction procedure, developed by the European Community Bureau of Reference, enables the categorization of heavy metals (HMs) into four fractions: the acid soluble/exchangeable fraction (F1), reducible fraction (F2), oxidizable fraction (F3) and residual fraction (F4). HMs passivation refers to the transformation of F1 and F2 of HMs to F3 and F4 of HMs. However, previous research found that the efficiency of HMs passivation was limited during composting process. Hao et al. [18] found that the bioavailable Zn in composting products only decreased by 8.5%. Furthermore, Wang et al. [19] indicated that the mobility factors of Cu increased by 12.5% after 21 days of composting. In order to increase the transfer of HMs from the bioavailable phase to stable phases, many methods have been applied in previous studies [20,21,22,23]. Phosphate amendments could effectively immobilize the HMs of Pb, Cd, Zn, Cu and Ni, and are widely used in remediation of soil polluted by HMs [24]. Wang et al. [25] indicated that calcium magnesium phosphate addition obviously decreased the mobility factor of Zn and Cu by 1.7% and 18.8%, respectively. In addition, Wang et al. [19] illustrated that the addition of KH2PO4 decreased the mobility factors of Cu and Zn by 13.6% and 21.6%, respectively. Cow bone, predominantly composed of Ca10(PO4)6(OH)2 and Ca3(PO4)2, with around 30% of calcium and 56% of phosphorus, was widely used in soil remediation [26,27]. Commission regulation No. 181/2006 in European countries authorized the use of bone meal as fertilizer, because of its high nutrient content and low HMs content [28]. Shaheen et al. [29] found that compared to the control, the addition of bone meal decreased NH4NO3-extractable Cu by 18% in soils. Moreover, the application of cow bone powder enhanced the residual fraction of Pb and Cu through the increase of soil pH and soluble P contents [30]. However, to our best knowledge, few studies have attempted to research the effect of cow bone on the variation of HMs speciation during composting process.
Therefore, we postulate that the incorporation of cow bones can effectively promote HMs passivation, thereby diminishing the prevalence of ARGs and MRGs during the composting process. The objectives of this work are to: (1) quantify the difference in the degree of humification added with cow bone meal and cow bone granules by excitation-emission matrix-parallel factor analysis (EEM-PARAFAC); (2) evaluate the dynamic changes in HM-fractions (Cu and Zn) during swine manure composting process added with different grain-size cow bone; and (3) investigate the changes of MRGs and AGRs abundance with respect to the grain-sizes of cow bone during the composting. The findings have significant implications for enhancing compost qualities in swine manure composting.

2. Materials and Methods

2.1. Raw Materials and Experiment Design

Swine manure was collected from a local farm in Hulan District, Harbin, China. Poplar sawdust (<5 mm) was used as the bulking agent and cow bone (meal and 2–3 cm granules) were purchased from a local sawmill and Sanhui feed raw material company (Jinan China). Cow bones were steamed in a high-pressure tank for 8 h to ensure that the nutrients in the bones are not destroyed and can be sterilized, defatted and desalinated more efficiently. The XRD (Holland PANalytical Corporation, Eindhoven, Holland, The Netherlands) analysis of cow bone is exhibited in Figure 1. The physicochemical characteristics of the swine manure and sawdust are shown in Table 1. Mixed raw materials of swine manure and sawdust (5:1 in weight ratio) were placed in a 20 L reactor to ensure the C/N ratio was maintained at approximately 25 and the moisture content at 60%. Aerobic composting was conducted in 20 L PVC reactors and schematic diagram of the composting reactor are shown in our previous study [31].
Three treatments were set in this experiment: no cow bone addition (T1), addition with 10% (w/w) of cow bone meal (T2) and addition with 10% (w/w) cow bone granules (T3). According to the change in compost temperature, samples were taken on days 0, 2, 10, 22 and 42. The composting samples were divided into three parts. One part of the sample was lyophilized in the freeze-dryer (Biocool FD-1, Shanghai, China) for determination of HMs. The other part was stored at 4 °C for the measurement of pH, electrical conductivity (EC) and germination index (GI), and the rest were stored at −80 °C for DNA extraction.

2.2. Analytical Methods

The temperature was measured by a thermometer twice at 9 a.m. and 9 p.m. every day, and the average temperature was recorded. The moisture content of initial compost samples was determined by placing them in an oven at 105 °C for 24 h, and the pH was measured using a pH meter (HI8424C, Shanghai, China). The organic carbon content was determined by potassium dichromate oxidation [32]. Total nitrogen was determined by the Kjeldahl method [33]. The accumulated temperature was calculated according to the previous study described by Chen et al. [34]. To determine the pH, EC and GI, 3 g of fresh composts were mixed with 30 mL distilled water and shaken for 1 h. The seed GI was determined according to the previous study by Chen et al. [34]. The pH and EC were determined by a pH meter and a conductivity meter (DDS-11A, Shanghai, China). A total of 3 g of fresh composts were mixed with 30 mL distilled water and shaken for 24 h to obtained dissolved organic matter (DOM) of compost. EEM spectra of dissolved organic matter (DOM) was measured with an FP-6500 fluorescence spectrophotometer (Hitachi, Japan) with excitation wavelengths between 220 and 500 nm at 1 nm increments and emission wavelengths between 250 and 550 nm in 5 nm increments. In order to identify the different component peaks corresponding to the evidenced fluorophores in the sample, the obtained fluorescent EEMs were processed by PARAFAC analysis. Briefly, the fluorescence data of 15 EEMs (day 0, day 2, day 10, day 22 and day 42) were modeled using MATLAB 2010a (MathWorks, Natick, MA, USA) with the DOMFluor Toolbox recommended by Stedmon and Bro’s work [27]. A range of PARAFAC models comprising between 3 and 7 components was generated. Model validation was performed through residual analysis, examination of spectral properties, split-half analysis, and random initialization. The fractions of Cu and Zn were divided into four fractions, named exchangeable (F1), reducible (F2), oxidizable (F3) and residual (F4), by using the modified Community Bureau of Reference (BCR) sequential extraction method [10]. The inductively coupled plasma mass spectrometry (PerkinElmer, Shelton, CT, USA) was used to determine the contents of Cu and Zn. The major crystalline compounds in cow bone were determined by powder X-ray diffraction (XRD; BRUKER, Karlsruhe, Germany).

2.3. DNA Extraction and qPCR Analysis

Approximately 0.25 g of composting samples were collected from day 0, 10, 22 and 42 to extract DNA by E.Z.N.A.® soil DNA Kit (OMEGA Bio-Tek, Norcross, GA, USA) according to the protocol of the manufacturer. The DNA quality and concentration was determined by NanoDrop ND-2000C spectrophotometer (Thermofisher, Waltham, MA, USA).
Quantitative PCR analysis (qPCR) was used to determine the abundance of 16S rRNA; MRGs (copA, tcrB, pcoA and zntA); ARGs (sul1, sul2, tetX, tetG, tetW, parC, ermF, ermB and aac(6)-ib-cr); and mobile genetic elements (MGEs). The primer pairs of ARGs and MRGs are described in Table 2. The qPCR reactions were performed using the StepOnePlus™ real-time PCR system (Thermo, Waltham, MA, USA). The reaction mixture was heated for 30 s at 95 °C and then 40 cycles of 5 s at 95 °C and 30 s at 60 °C.

2.4. Data Statistical Analysis

EEM fluorescence data were modeled in Matlab 2018a (Math works, Natick, MA, USA) with DOMFluor Toolbox for PARAFAC analysis. The redundancy analysis (RDA) was performed using Canoco 5 software. The figures in this manuscript were made by Origin 2016. The mobility factor (MF) of HMs in the compost was calculated as follows [35]:
MF (%) = (F1 + F2)/F × 100%
where F1 is the total amount of exchangeable heavy metals.
F2 is the total amount of reducible heavy metals.
F is the total amount of heavy metals.

3. Results and Discussion

3.1. Changes in Maturity Indexes

Temperature could reflect the activity of microorganisms during the composting process and also be used to characterize the efficiency of composting [36]. As shown in Figure 2a, the temperature variation of the three treatments showed similar trend during the composting process. Whether or not the addition of cow bone, the compost temperature increased rapidly and reached 50 °C on the third day due to the rapid biodegradation of organic matter [22]. All three treatments were kept over 50 °C for 13 days, which was in compliance with the sanitary and safety requirements for further use of compost [37]. The effective accumulated temperature in T1, T2 and T3 treatments was 18,646, 19,180 and 18,442 °C·h, respectively. This result indicated that the addition of cow bone meal improved the effective accumulated temperature, possibly due to the increase of available phosphorus content enhanced the activity of microorganism during composting [19]. In addition, a fine particle has a larger surface area than a coarse particle, which provides a more favorable micro-environment for microorganisms during composting process [38], resulting in a higher accumulated temperature.
EC reflects the salinity level of compost and the inhibitory effect on plant growth in agriculture [39]. During the 42-day composting process, the value of EC in the three treatments increased rapidly in the first 10 days, and then gradually decreased until the end of the composting process (Figure 2b). In this research, the value of EC in all the treatments met the requirement (<4 ms·cm−1) for safe use of compost, which was 1.76 ms·cm−1 and 1.40 ms·cm−1 in T2 and T3, respectively, but a little bit higher in T1 (1.95 ms·cm−1). The decrease in EC value may be caused by ammonia volatilization or inorganic salt precipitation during the composting [40]. Hodson et al. [41] found that cow bone meal significantly decreased the concentration of metals in leachates and CaCl2-extractable metals in soils via the formation of HMs phosphates, which might be the reason for the decrease of EC in T2 and T3 treatments.
GI values were determined to investigate the changes of the phytotoxicity and maturity of the compost products [42]. As shown in Figure 2c, the values of GI in the three treatments decreased obviously during the first 10 days, which was due to the release of ammonia, degradable organic acids and volatile fatty acid [43]. As the composting proceeded, the value of GI in all treatments increased owing to the decomposition of toxic substances and organic matter [39]. After 42 days’ composting, the values of GI were 0.96, 1.14 and 0.87, in T1, T2 and T3 treatments, respectively, which surpassed the recommended GI value of 0.80, indicating the non-toxicity and maturity of the final compost product [43,44]. It is worth noting that the GI value was high in T2 treatment, indicating the low phytotoxic substances in the compost product.

3.2. EEM-PARAFAC Analysis

The maturity and stabilization of compost is largely attributed to the change of dissolved organic matter (DOM) components [45]. Accordingly, the EEM spectra of DOM samples were analyzed by PARAFAC to obtain more details about the characteristics of DOM during the composting process. In this study, four components were successfully decomposed by PARAFAC (Figure 3a). According to the existing literature in the openfluor database [46], the composition spectrum, and the minimum similarity score (congruence coefficient) was 0.95. Component 1 (C1) showed a fluorescence peak at 355/432 nm excitation/emission wavelength pair, corresponding well to terrestrial humic-like component [47]. Component 2 (C2) was composed of one emission peak centered at 476 nm and two excitation maxima at 275 and 390 nm, resembling the terrestrial and ubiquitous humic-like fluorophores [48]. Component 3 (C3) displayed one excitation maxima at 290 nm and one emission peak at 396 nm, which was previously identified as microbial humic-like component. Component 4 (C4, Ex/Em, 275/346 nm) was generally assigned to proteinaceous component, most likely associated with the amino acid tryptophan [48].
The maximum fluorescence intensity (Fmax) percentages of each component in DOM obtained by PARAFAC analysis are shown in Figure 3c. The Fmax percentage of C4 increased after 2 days of composting (the percentages of Fmax = 62.20%, 72.93% and 63.79% for T1, T2 and T3, respectively), indicating that larger organic molecules were broken into smaller soluble molecules [49]. Thereafter, the Fmax values of C4 in the three treatments gradually decreased along the composting process. The decrease of soluble microbial by-products may be due to the strong biological oxidation of microbial by-products by microorganisms [45]. C1, C2 and C3 were all identified as humic-like substances. The total Fmax percentages of C1, C2 and C3 showed a steady increase during the composting process, suggesting enrichment of the humic acid-like fraction and enhancement of the degree of humification. An inverse relationship of Fmax percentage between the increased C1, C2 and C3 and decreased C4 was clearly observed, suggesting that soluble microbial by-products and protein-like substances may act as the organic precursors for humification. Similarly, Zhang et al. [50] indicated that the reduction of protein like components was beneficial to the formation of humus during the composting. After 10 days of the composting, the total Fmax percentages of C1, C2 and C3 were more than 80% in the three treatments, indicating high temperatures can be expected to lead to a significant decomposition of organic matter. In the compost product, the total Fmax percentages of C1, C2 and C3 were 91.82%, 91.91% and 88.46%, respectively, in T1, T2 and T3 treatments. Notably, the addition of cow bone meal was better than cow bone granule to promote humification during the composting. Cui et al. [38] indicated that compared with fine zeolite, coarse grain-size zeolite acts as an expansion agent to ensure optimal oxygen supply, and thereby improve the degree of compost maturity. Unlike mineral additives, cow bone granules are easy to absorb water after degreasing and desalination, thus decreasing the oxygen supply for organic matter decomposition.

3.3. Heavy Metals Transformation

In this study, the content of Cu and Zn in the swine manure were 235.7 mg·kg−1 and 1282 mg·kg−1, and the bioavailable content of Cu and Zn were 138.8 mg·kg−1 and 1219 mg·kg−1, respectively, which indicated the high risk of Cu and Zn in swine manure. The distributions of the four fractions of Cu and Zn in the compost are shown in Figure 4. According to previous studies, the exchangeable and reducible Cu and Zn were generally considered to be mobile and bioavailable, and the exchangeable heavy metals had the highest mobility and bioavailability than other three fractions [23,51].
The relative contents of F1 (exchangeable) and F2 (reducible) of Cu in the three treatments was obviously higher than those of F3 (oxidizable) and F4 (residual) in the initial phase, indicating the higher toxicity of Cu in the initial stage of the composting (Figure 4a). The relative contents of F1 in the three treatments showed an increase in the heating phases of the composting, and then it decreased in the thermophilic and mature phases [52]. The reason for this might be that the dissolved organic carbons were gradually transformed into humus substances, which adsorbs HMs more strongly because of its functional groups [18]. In addition, the F2 of Cu decreased during the composting process, while the distribution coefficients of F3 increased obviously during the composting process, suggesting that the exchangeable and residual fractions of Cu transformed to oxidizable fraction [53]. In this research, the MF value of Cu decreased by 46.37% in T1 treatment after the composting, suggesting the composting process could effectively accelerate the passivation of Cu. A 10.48% and 6.98% decrease of MF were observed in T2 and T3, respectively, compared to T1. The results indicated that the addition of cow bone could effectively decrease the mobility of Cu in the composting process via transforming copper into oxidizable fraction. Similarly, Huang et. al. [30] found that compared to the control, the concentration of CaCl2-extractable Cu in soil decreased by 67.1%, and the percentage of oxidizable Cu increased by 5.93% when bone meal was added. Furthermore, Sun et al. [54] indicated that compared to the control, the oxidizable Cu increased by 83.5% when 5% of nanoparticle hydroxyapatite was added.
The content of Zn in swine manure was higher than Cu. As shown in Figure 4b, the dominant fractions of Zn were F1 and F2, which occupied more than 90% of the total Zn in the initial phase. After 42 days of composting, the bioavailable Zn (F1 and F2) decreased by 3.85% in T1 treatment. It is apparent that compared to Cu, the composting process was more effective in stabilizing Cu than Zn. The form of humic substances in the process of organic matter degradation has an important impact on the passivation of HMs [55]. Kang et al. [56] indicated that Zn had weaker affinity for humic acid than Cu. Chen et al. [57] revealed that Zn associated with the organic fraction could transfer to the mobile fraction during composting process, thus mainly existing as free ions in the composting. After 42 days composting, the F1 of Zn decreased, while the F2 and F3 of Zn increased. Compared to the T1 treatment, the MF of Zn in the T2 and T3 treatments decreased by 18.80% and 2.0%, respectively. Hao et al. [58] found that addition of 5% bone char decreased the concentration of CH3COOH extractable Zn by 47.80%. Shaheen et al. [29] indicated that the diethylenetriaminepentaacetic acid (DTPA) extractable Zn decreased with bone meal addition. It is notable that the passivation of Cu and Zn in T2 was obviously higher than that in the T3 treatment. In comparison to cow bone granules, bone meal had large contact area, which might increase the dissolution of phosphate, thus increased the formation of HM phosphates. Cui et al. [38] indicated that zeolite with fine grain-sizes shows a stronger adsorption capacity to metal ions than coarse zeolite owing to the higher surface area.

3.4. Variations of MRGs, ARGs and MGEs

Due to the pressure of selective evolution, microorganisms have developed metal resistance in the environment [59] Among the targeted MRGs, one Zn resistance gene (zntA) and three Cu resistance genes (copA, tcrB and pcoA) were detected in the composting process. As shown in Figure 5a, total MRGs in all the treatments obviously decreased during the thermophilic phase. This may be due to the fact that a temperature exceeding 50 °C represents a critical tipping point for the growth of strictly mesophilic aerobic bacteria [60]. After 42 days of composting, the removal efficiencies of copA, pocA and tcrB genes reached 100%, Cu resistance genes could be completely removed through the composting process. In addition, the zntA gene was not detected in T2 and T3 treatments, but a low level in T1 treatment. In addition, the results also showed that there were significant positive correlations (p < 0.05) between three Cu resistance genes and the F1 and F2 of Cu, and zntA gene had significant positive correlations (p < 0.05) with F1 of Zn (Figure 6), which indicated that the bioavailable HMs imposed selective pressure to MRGs.
HMs in animal feces can exert continuous selective pressure on ARGs through co-resistance or cross-resistance, thus aggravating environmental pollution [61]. The changes in relative abundance of ARGs and MGEs detected during the composting are shown in Figure 5b. The tetW and ermB, which conferred resistance to tetracycline and macrolide, respectively, were consistently identified at the high relative abundance in the compost samples on day 0, which was due to selection driven by the high concentration of residual antibiotics in swine manure. On day 10, the total copy numbers of ARGs decreased dramatically, indicating thermophilic period was important for the reduction in ARGs. After 42 days of composting, the total ARGs abundance decreased more than 70% compared to that of day 0. It is worth noting that sul1 was the most abundant ARGs in compost products. Compared with other ARGs, sul genes are often more persistent in conventional composting systems where the enrichment of sul1 after composting has been frequently observed [6]. In the compost product, the relative abundances of all detected ARGs except for ermF were lower in T2 treatment, compared with T1, while T3 increased the abundance of ARGs, indicating that T2 was more effective for the removal of ARGs than T3. intI1, being considered as an indicator of MGEs, can capture exogenous ARG cassettes, and promote multidrug resistance [62]. At the initial stage, the relative abundances of the intI1 were 4.01 × 10−3, 9.97 × 10−3 and 2.42 × 10−2 in the T1, T2 and T3 treatments, respectively. By the end of the composting, the relative abundance of intI1 in T2 treatment can not be detected, which indicated that the presence of bone meal could potentially reduce the risk of possibility of horizontal gene transfer (HGT) through MGEs.Microbial contact is the first step of conjugative transmission of ARGs. Bone meal could expand the space between microorganisms, thus reducing the rate of microbial contact. Additionally, bone meal was able to promote HMs passivation, which led to the removal of intI1 and ARGs due to the less co-selection from HMs.

3.5. Factors That Affected the Fates of HMs, ARGs and MRGs

Redundancy analysis (RDA) was carried out to reveal the relationship among environmental factors, HMs, the four components of DOM, ARGs and MRGs. As shown in Figure 6, F1 of Cu negatively correlated with GI, owing to the high toxicity of exchangeable Cu. There was obvious correlation between C1 and F3 of Cu and Zn. C1, as the humic-like component of DOM, has been demonstrated to exhibit better complexation ability to HMs than protein-like fractions [63]. In addition, pH had significant negative correlation with F1 and F2 of Cu, but a positive relationship with F3 of Cu and F2 of Zn, indicating that pH increment promoted the passivation of HMs.
intI1 had significant positive correlations with tetG, sul1, sul2 and aac(6)-ib-cr. The close relationship between intI1 and ARGs implied that intI1 exerted essential effects as a promoter on the persistence and proliferation of multi ARGs by HGT [64]. Many previous studies indicated sul1 and sul2 encoding resistance to sulfonamide is typically related to intI1. In addition, Zhou et al. [23] found that there was a strong correlation of intI1 and tetG in the chicken manure composting. intI1 was not detected in T2 treatment, which indicated the spread of MRGs and ARGs via HGT could be decreased in T2 treatment. Additionally, there were significant correlations among ARGs and MRGs. For example, pcoA had significant correlations with tetX, tetW, ermF and ermB. It may be explained by the co-resistance mechanism between ARGs and MRGs. The effect of Cu and Zn on the fate of ARGs and MRGs could not be ignored. F1 of Zn and Cu, F2 of Cu, pcoA, copA, tcrB, ermB, ermF, tetW, tetX and parC were positively correlated with each other. Cui et al. [11] revealed that the correlation between bioavailable HMs and ARGs is more obvious than that between total HMs and ARGs. Thus, the selective pressure imposed by bioavailable Cu and Zn may promote the co-propagation and diffusion of pcoA, copA, tcrB, ermB, ermF, tetW, tetX and parC. Overall, bone meal application promoted the removal of MRGs and ARGs through the following two reasons. Firstly, the addition of bone meal increased the transfer of HMs from the bioavailable phase to stable phases, thus reducing the selective pressure posed by HMs. Secondly, bone meal effectively promoted the removal of intI1 during composting process, thus decreasing the potential HGT through intI1.

4. Conclusions

This study indicated that the addition cow bone, especially for cow bone meal, could effectively increase the passivation of Cu and Zn during swine manure composting. Moreover, compared with cow bone granules, the addition of cow bone meal could promote the formation of humus substances, and mitigated the potential risk of spread and proliferation of MRGs and ARGs via decreasing horizontal gene transfer and selective pressure by bioavailable HMs. Overall, this study revealed that cow bone meal could be used as an effective additive for HMs passivation and the reduction of ARGs and MRGs during composting process.

Author Contributions

S.C.: Software, Investigation, Writing—original draft, Funding acquisition. X.F.: Formal analysis. M.F.: Software, Investigation. X.J.: Methodology, Formal analysis, Investigation, Writing—review & editing. All authors have read and agreed to the published version of the manuscript.

Funding

Funding: This work was supported by the Project of the Hainan Provincial Natural Science Foundation of China (Grant number 223QN190), the Sanya Yazhou Bay Science and Technology City (Grant number SCKJ-JYRC-2023-13), the National Key R&D Program of China (2023YFD1901405), the Hainan University Startup Fund (Grant number KYQD(ZR)-22104), and the Collaborative Innovation Center for Southern and Tropical Efficient Agriculture (Grant number XTCX2022NYC08).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors have no relevant financial or non-financial interests to disclose.

References

  1. Ahmad, M.; Lee, S.S.; Lim, J.E.; Lee, S.E.; Cho, J.S.; Moon, D.H.; Hashimoto, Y.; Ok, Y.S. Speciation and phytoavailability of lead and antimony in a small arms range soil amended with mussel shell, cow bone and biochar: EXAFS spectroscopy and chemical extractions. Chemosphere 2014, 95, 433–441. [Google Scholar] [CrossRef] [PubMed]
  2. Awasthi, M.K.; Wang, M.J.; Chen, H.Y.; Wang, Q.; Zhao, J.C.; Ren, X.N.; Li, D.S.; Awasthi, S.K.; Shen, F.; Li, R.H.; et al. Heterogeneity of biochar amendment to improve the carbon and nitrogen sequestration through reduce the greenhouse gases emissions during sewage sludge composting. Bioresour. Technol. 2016, 224, 428–438. [Google Scholar] [CrossRef] [PubMed]
  3. Awasthi, M.K.; Duan, Y.M.; Awasthi, S.K.; Liu, T.; Chen, H.Y.; Pandey, A.; Zhang, Z.Q.; Taherzadeh, M. Emerging applications of biochar: Improving pig manure composting and attenuation of heavy metal mobility in mature compost. J. Hazard. Mater. 2020, 389, 122116. [Google Scholar] [CrossRef] [PubMed]
  4. Baker-Austin, C.; Wright, M.S.; Stepanauskas, R.; Mcarthur, J.V. Co-selection of antibiotic and metal resistance. Trends Microbiol. 2006, 14, 176–182. [Google Scholar] [CrossRef] [PubMed]
  5. Bao, H.Y.; Chen, Z.Q.; Wen, Q.X.; Wu, Y.Q. Effects of oxytetracycline on variation in intracellular and extracellular antibiotic resistance genes during swine manure composting. Bioresour. Technol. 2024, 393, 130127. [Google Scholar] [CrossRef]
  6. Bernal, M.P.; Alburquerque, J.A.; Moral, R. Composting of animal manures and chemical criteria for compost maturity assessment. A review. Bioresour. Technol. 2009, 100, 5444–5453. [Google Scholar] [CrossRef]
  7. Bolan, N.; Adriano, D.; Mahimairaja, S. Distribution and Bioavailability of Trace Elements in Livestock and Poultry Manure By-Products. Crit. Rev. Environ. Sci. Technol. 2004, 34, 291–338. [Google Scholar] [CrossRef]
  8. Chen, Y.X.; Huang, X.D.; Han, Z.Y.; Huang, X.; Hu, B.; Shi, D.Z.; Wu, W.X. Effects of bamboo charcoal and bamboo vinegar on nitrogen conservation and heavy metals immobility during pig manure composting. Chemosphere 2010, 78, 1177–1181. [Google Scholar] [CrossRef]
  9. Chen, H.Y.; Awasthi, M.K.; Liu, T.; Zhao, J.C.; Ren, X.N.; Wang, M.J.; Duan, Y.M.; Awasthi, S.K.; Zhang, Z.Q. Influence of clay as additive on greenhouse gases emission and maturity evaluation during chicken manure composting. Bioresour. Technol. 2018, 266, 82–88. [Google Scholar] [CrossRef]
  10. Chen, M.L.; Wang, C.; Wang, B.R.; Bai, X.J.; Gao, H.; Huang, Y.M. Enzymatic mechanism of organic nitrogen conversion and ammonia formation during vegetable waste composting using two amendments. Waste Manag. 2019, 95, 306–315. [Google Scholar] [CrossRef]
  11. Chen, X.M.; Zhao, Y.; Zeng, C.C.; Li, Y.J.; Zhu, L.J.; Wu, J.Q.; Chen, J.; Wei, Z.M. Assessment contributions of physicochemical properties and bacterial community to mitigate the bioavailability of heavy metals during composting based on structural equation models. Bioresour. Technol. 2019, 289, 121657. [Google Scholar] [CrossRef] [PubMed]
  12. Chen, Y.R.; Chen, Y.N.; Li, Y.P.; Wu, Y.X.; Zeng, Z.P.; Xu, R.; Wang, S.; Li, H.; Zhang, J.C. Changes of heavy metal fractions during co-composting of agricultural waste and river sediment with inoculation of Phanerochaete chrysosporium. J. Hazard. Mater. 2019, 378, 120757. [Google Scholar] [CrossRef] [PubMed]
  13. Chen, Z.Q.; Wu, Y.Q.; Wen, Q.X.; Bao, H.Y.; Fu, Q.Q. Insight into the effects of sulfamethoxazole and norfloxacin on nitrogen transformation functional genes during swine manure composting. Bioresour. Technol. 2020, 297, 122463. [Google Scholar] [CrossRef] [PubMed]
  14. Cohen, E.; Levy, G.J.; Borisover, M. Fluorescent components of organic matter in wastewater: Efficacy and selectivity of the water treatment. Water Res. 2014, 55, 323–334. [Google Scholar] [CrossRef] [PubMed]
  15. Cui, E.; Wu, Y.; Zuo, Y.R.; Chen, H. Effect of different biochars on antibiotic resistance genes and bacterial community during chicken manure composting. Bioresour. Technol. 2016, 203, 11–17. [Google Scholar] [CrossRef]
  16. Cui, H.; Ou, Y.; Wang, L.X.; Yan, B.X.; Li, Y.X.; Ding, D.W. The passivation effect of heavy metals during biochar-amended composting: Emphasize on bacterial communities. Waste Manag. 2020, 118, 360–368. [Google Scholar] [CrossRef]
  17. Cui, H.; Ou, Y.; Wang, L.X.; Yan, B.X.; Li, Y.X.; Bao, M.W. Critical passivation mechanisms on heavy metals during aerobic composting with different grain-size zeolite. J. Hazard. Mater. 2021, 406, 124313. [Google Scholar] [CrossRef]
  18. Darwish, M.; Aris, A.; Puteh, M.H.; Jusoh, M.N.H.; Kadir, A.A. Waste bones ash as an alternative source of P for struvite precipitation. J. Environ. Manag. 2016, 203, 861–866. [Google Scholar] [CrossRef]
  19. Gyadi, T.; Bharti, A.; Basack, S.; Kumar, P.; Lucchi, E. Influential factors in anaerobic digestion of rice-derived food waste and animal manure: A comprehensive review. Bioresour. Technol. 2024, 413, 131398. [Google Scholar] [CrossRef]
  20. Hao, X.W.; Huang, Y.Z.; Cui, Y.S. Effect of bone char addition on the fractionation and bio-accessibility of Pb and Zn in combined contaminated soil. Acta Ecol. Sin. 2010, 30, 118–122. [Google Scholar] [CrossRef]
  21. Hao, J.K.; Wei, Z.M.; Wei, D.; Mohamed, T.A.; Yu, H.M.; Xie, X.Y.; Zhu, L.J.; Zhao, Y. Roles of adding biochar and montmorillonite alone on reducing the bioavailability of heavy metals during chicken manure composting. Bioresour. Technol. 2019, 294, 122199. [Google Scholar] [CrossRef] [PubMed]
  22. Hodson, M.E.; Valsami-Jones, E.; Cotter-Howells, J.D. Bone meal additions as a remediation treatment for metal contaminated soil. Environ. Sci. Technol. 2000, 34, 3501–3507. [Google Scholar] [CrossRef]
  23. Huang, G.Y.; Gao, R.L.; You, J.W.; Zhu, J.; Fu, Q.L.; Hu, H.Q. Oxalic acid activated phosphate rock and bone meal to immobilize Cu and Pb in mine soils. Ecotoxicol. Environ. Saf. 2019, 174, 401–407. [Google Scholar] [CrossRef] [PubMed]
  24. Jang, H.M.; Lee, J.; Kim, Y.B.; Jeon, J.H.; Shin, J.; Park, M.R.; Kim, Y.M. Fate of antibiotic resistance genes and metal resistance genes during thermophilic aerobic digestion of sewage sludge. Bioresour. Technol. 2018, 249, 635–643. [Google Scholar] [CrossRef] [PubMed]
  25. Jutaporn, P.; Armstrong, M.D.; Coronell, O. Assessment of C-DBP and N-DBP formation potential and its reduction by MIEX® DOC and MIEX® GOLD resins using fluorescence spectroscopy and parallel factor analysis. Water Res. 2020, 172, 115460. [Google Scholar] [CrossRef]
  26. Kang, J.; Zhang, Z.Q.; Wang, J.J. Influence of humic substances on bioavailability of Cu and Zn during sewage sludge composting. Bioresour. Technol. 2011, 102, 8022–8026. [Google Scholar] [CrossRef]
  27. Lang, Q.Q.; Chen, M.J.; Guo, Y.C.; Liu, Z.G.; Gai, C. Effect of hydrothermal carbonization on heavy metals in swine manure: Speciation, bioavailability and environmental risk. J. Environ. Manag. 2019, 234, 97–103. [Google Scholar] [CrossRef]
  28. Li, R.H.; Wang, J.J.; Zhang, Z.Q.; Shen, F.; Zhang, G.J.; Qin, R.; Li, X.L.; Xiao, R. Nutrient transformations during composting of pig manure with bentonite. Bioresour. Technol. 2012, 121, 362–368. [Google Scholar] [CrossRef]
  29. Lin, Q.; Liang, L.; Wang, L.H.; Ni, Q.L.; Yang, K.; Zhang, J.; Chen, D.L.; Yang, J.J.; Shen, X.D. Roles of pyrolysis on availability, species and distribution of Cu and Zn in the swine manure: Chemical extractions and high-energy synchrotron analyses. Chemosphere 2013, 93, 2094–2100. [Google Scholar] [CrossRef]
  30. Lu, D.A.; Wang, L.X.; Yan, B.X.; Ou, Y.; Guan, J.N.; Bian, Y.; Zhang, Y.B. Speciation of Cu and Zn during composting of pig manure amended with rock phosphate. Waste Manag. 2014, 34, 1529–1536. [Google Scholar] [CrossRef]
  31. Lv, B.Y.; Xing, M.Y.; Zhao, C.H.; Yang, J.; Xiang, L. Towards understanding the stabilization process in vermicomposting using PARAFAC analysis of fluorescence spectra. Chemosphere 2014, 117, 216–222. [Google Scholar] [CrossRef] [PubMed]
  32. Ma, L.C.; Zhou, Y.C.; Wang, A.; Li, Q.L. A potential heavy metals detoxification system in composting: Biotic and abiotic synergy mediated by shell powder. Bioresour. Technol. 2023, 386, 129576. [Google Scholar] [CrossRef] [PubMed]
  33. Murphy, K.R.; Stedmon, C.A.; Wenig, P.; Bro, R. OpenFluor—An online spectral library of auto-fluorescence by organic compounds in the environment. Anal. Methods 2014, 6, 658–661. [Google Scholar] [CrossRef]
  34. Najar, I.N.; Sherpa, M.T.; Das, S.; Das, S.; Thakur, N. Diversity analysis and metagenomic insights into antibiotic and metal resistance among Himalayan hot spring bacteriobiome insinuating inherent environmental baseline levels of antibiotic and metal tolerance. J. Glob. Antimicrob. Resist. 2020, 21, 342–352. [Google Scholar] [CrossRef]
  35. Pan, J.T.; Li, R.H.; Zhai, L.M.; Zhang, Z.Q.; Ma, J.Y.; Liu, H.B. Influence of palygorskite addition on biosolids composting process enhancement. J. Clean. Prod. 2019, 217, 371–379. [Google Scholar] [CrossRef]
  36. Niu, Q.Q.; Yan, H.L.; Meng, Q.R.; Wang, S.S.; Li, G.; Zhu, Q.H.; Li, X.T.; Li, Q.L. Hydrogen peroxide plus ascorbic acid enhanced organic matter deconstructions and composting performances via changing microbial communities. J. Environ. Manag. 2021, 295, 113126. [Google Scholar] [CrossRef]
  37. Olugbemide, A.D.; Oberlintner, A.; Novak, U.; Likozar, B. Lignocellulosic Corn Stover Biomass Pre-Treatment by Deep Eutectic Solvents (DES) for Biomethane Production Process by Bioresource Anaerobic Digestion. Sustainability 2021, 13, 10504. [Google Scholar] [CrossRef]
  38. Olugbemide, A.D.; Likozar, B. Assessment of Liquid and Solid Digestates from Anaerobic Digestion of Rice Husk as Potential Biofertilizer and Nutrient Source for Microalgae Cultivation. Processes 2022, 10, 1007. [Google Scholar] [CrossRef]
  39. Pu, Q.; Fan, X.T.; Sun, A.Q.; Pan, T.; Li, H.; Bo, L.S.; An, X.L.; Su, J.Q. Co-effect of cadmium and iron oxide nanoparticles on plasmid-mediated conjugative transfer of antibiotic resistance genes. Environ. Int. 2021, 152, 106453. [Google Scholar] [CrossRef]
  40. Ren, X.N.; Wang, Q.; Awasthi, M.K.; Zhao, J.C.; Wang, J.C.; Liu, T.; Li, R.S.; Zhang, Z.Q. Improvement of cleaner composting production by adding Diatomite: From the nitrogen conservation and greenhouse gas emission. Bioresour. Technol. 2019, 286, 121377. [Google Scholar] [CrossRef]
  41. Ren, X.N.; Wang, Q.; Li, R.H.; Chang, C.C.; Pan, J.T.; Zhang, Z.Q. Effect of clay on greenhouse gas emissions and humification during pig manure composting as supported by spectroscopic evidence. Sci. Total Environ. 2020, 737, 139712. [Google Scholar] [CrossRef] [PubMed]
  42. Sardar, M.F.; Zhu, C.X.; Geng, B.; Ahmad, H.R.; Song, T.T.; Li, H.N. The fate of antibiotic resistance genes in cow manure composting: Shaped by temperature-controlled composting stages. Bioresour. Technol. 2021, 320, 124403. [Google Scholar] [CrossRef] [PubMed]
  43. Shaheen, S.M.; Shams, M.S.; Khalifa, M.R.; El-Dali, M.A.; Rinklebe, J. Various soil amendments and environmental wastes affect the (im) mobilization and phytoavailability of potentially toxic elements in a sewage effluent irrigated sandy soil. Ecotoxicol. Environ. Saf. 2017, 142, 375–387. [Google Scholar] [CrossRef] [PubMed]
  44. Sneddon, I.R.; Orueetxebarria, M.; Hodson, M.E.; Schofield, P.F.; Valsami-Jones, E. Field trial using bone meal amendments to remediate mine waste derived soil contaminated with zinc, lead and cadmium. Appl. Geochem. 2008, 23, 2414–2424. [Google Scholar] [CrossRef]
  45. Stedmon, C.A.; Bro, R. Characterizing dissolved organic matter fluorescence with parallel factor analysis: A tutorial. Limnol. Oceanogr. Methods 2008, 6, 572–579. [Google Scholar] [CrossRef]
  46. Sun, R.J.; Chen, J.H.; Fan, T.T.; Zhou, D.M.; Wang, Y.J. Effect of nanoparticle hydroxyapatite on the immobilization of Cu and Zn in polluted soil. Environ. Sci. Pollut. Res. 2018, 25, 73–80. [Google Scholar] [CrossRef]
  47. Tang, J.; Zhuang, L.; Yu, Z.; Liu, X.M.; Wang, Y.Q.; Wen, P.; Zhou, S.G. Insight into complexation of Cu(II) to hyperthermophilic compost-derived humic acids by EEM-PARAFAC combined with heterospectral two dimensional correlation analyses. Sci. Total Environ. 2018, 656, 29–38. [Google Scholar] [CrossRef] [PubMed]
  48. Valipour, M.; Shahbazi, K.; Khanmirzaei, A. Chemical Immobilization of Lead, Cadmium, Copper, and Nickel in Contaminated Soils by Phosphate Amendments. CLEAN-Soil Air Water 2016, 44, 572–578. [Google Scholar] [CrossRef]
  49. Wang, X.K.; Zheng, G.D.; Chen, T.B.; Shi, X.X.; Wang, Y.W.; Nie, E.; Liu, J.W. Effect of phosphate amendments on improving the fertilizer efficiency and reducing the mobility of heavy metals during sewage sludge composting. J. Environ. Manag. 2019, 235, 124–132. [Google Scholar] [CrossRef]
  50. Wang, X.K.; Chen, T.B.; Zheng, G.D. Preservation of nitrogen and sulfur and passivation of heavy metals during sewage sludge composting with KH2PO4 and FeSO4. Bioresour. Technol. 2020, 297, 122383. [Google Scholar] [CrossRef]
  51. Wu, D.; Huang, Z.T.; Yang, K.; Graham, D.; Xie, B. Relationships between Antibiotics and Antibiotic Resistance Gene Levels in Municipal Solid Waste Leachates in Shanghai, China. Environ. Sci. Technol. 2015, 49, 4122–4128. [Google Scholar] [CrossRef] [PubMed]
  52. Wu, J.Q.; Zhao, Y.; Qi, H.S.; Zhao, X.Y.; Yang, T.X.; Du, Y.Q.; Zhang, H.; Wei, Z.M. Identifying the key factors that affect the formation of humic substance during different materials composting. Bioresour. Technol. 2017, 244, 1193–1196. [Google Scholar] [CrossRef] [PubMed]
  53. Wu, N.; Xie, S.Y.; Zeng, M.; Xu, X.Y.; Liu, X.Y.; Wang, X.B. Impacts of pile temperature on antibiotic resistance, metal resistance and microbial community during swine manure composting. Sci. Total Environ. 2020, 744, 140920. [Google Scholar] [CrossRef] [PubMed]
  54. Xie, D.; Gao, M.; Yang, M.; Xu, M.Y.; Meng, J.; Wu, C.F.; Wang, Q.H.; Liu, S.; Sun, X.H. Composting-a solution of eliminating a nitrite-rich wastewater by reusing it as a moisture conditioning agent. Chemosphere 2021, 284, 131365. [Google Scholar] [CrossRef]
  55. Xiong, X.; Li, Y.X.; Li, W.; Lin, C.Y.; Han, W.; Yang, M. Copper content in animal manures and potential risk of soil copper pollution with animal manure use in agriculture. Resour. Conserv. Recycl. 2010, 54, 985–990. [Google Scholar] [CrossRef]
  56. Yin, Y.N.; Gu, J.; Wang, X.J.; Zhang, K.Y.; Hu, T.; Ma, J.Y.; Wang, Q.Z. Impact of copper on the diazotroph abundance and community composition during swine manure composting. Bioresour. Technol. 2018, 255, 257–265. [Google Scholar] [CrossRef]
  57. Yuan, X.Z.; Huang, H.J.; Zeng, G.M.; Li, H.; Wang, J.Y.; Zhou, C.F.; Zhu, H.N.; Pei, X.K.; Liu, Z.F.; Liu, Z.T. Total concentrations and chemical speciation of heavy metals in liquefaction residues of sewage sludge. Bioresour. Technol. 2011, 102, 4104–4110. [Google Scholar] [CrossRef]
  58. Yu, Z.; Liu, X.M.; Chen, C.Y.; Liao, H.P.; Chen, Z.; Zhou, S.G. Molecular insights into the transformation of dissolved organic matter during hyperthermophilic composting using ESI FT-ICR MS. Bioresource. Technol. 2019, 292, 122007. [Google Scholar] [CrossRef]
  59. Zhang, L.; Sun, X.Y. Changes in physical, chemical, and microbiological properties during the two-stage co-composting of green waste with spent mushroom compost and biochar. Bioresour. Technol. 2014, 171, 274–284. [Google Scholar] [CrossRef]
  60. Zhang, S.H.; Chen, Z.Q.; Wen, Q.X.; Zheng, J. Assessing the stability in composting of penicillin mycelial dreg via parallel factor (PARAFAC) analysis of fluorescence excitation–emission matrix (EEM). Chem. Eng. J. 2016, 299, 167–176. [Google Scholar] [CrossRef]
  61. Zhang, C.S.; Xu, Y.; Zhao, M.H.; Rong, H.W.; Zhang, K.F. Influence of inoculating white-rot fungi on organic matter transformations and mobility of heavy metals in sewage sludge based composting. J. Hazard. Mater. 2017, 344, 163–168. [Google Scholar] [CrossRef] [PubMed]
  62. Zheng, G.D.; Wang, X.K.; Chen, T.B.; Yang, J.; Yang, J.X.; Liu, J.W.; Shi, X.X. Passivation of lead and cadmium and increase of the nutrient content during sewage sludge composting by phosphate amendments. Environ. Res. 2020, 185, 109431. [Google Scholar] [CrossRef] [PubMed]
  63. Zhou, H.B.; Meng, H.B.; Zhao, L.X.; Shen, Y.J.; Hou, Y.Q.; Cheng, Y.S.; Song, L.Q. Effect of biochar and humic acid on the copper, lead, and cadmium passivation during composting. Bioresour. Technol. 2018, 258, 279–286. [Google Scholar] [CrossRef] [PubMed]
  64. Zucconi, F.; Pera, A.; Forte, M.; de Bertoldi, M. Evaluating toxicity of immature compost. Biocycle 1981, 22, 54–57. [Google Scholar]
Figure 1. The X-ray diffraction patterns of cow bone meal. 1: hydroxyapatite.
Figure 1. The X-ray diffraction patterns of cow bone meal. 1: hydroxyapatite.
Fermentation 10 00603 g001
Figure 2. Variation in temperature (a), EC (b) and germination index (c) during composting process. T1: no cow bone addition. T2: addition with 10% cow bone meals. T3: addition with 10% cow bone granules.
Figure 2. Variation in temperature (a), EC (b) and germination index (c) during composting process. T1: no cow bone addition. T2: addition with 10% cow bone meals. T3: addition with 10% cow bone granules.
Fermentation 10 00603 g002
Figure 3. EEM contours (a), excitation and emission loadings (b) of the four components of DOM identified by the DOMFluor PARAFAC analysis. C1, C2, C3 and C4 percentages of Fmax at 0, 2, 10, 22, 42 d (c). T1: no cow bone addition. T2: addition with 10% cow bone meals. T3: addition with 10% cow bone granules.
Figure 3. EEM contours (a), excitation and emission loadings (b) of the four components of DOM identified by the DOMFluor PARAFAC analysis. C1, C2, C3 and C4 percentages of Fmax at 0, 2, 10, 22, 42 d (c). T1: no cow bone addition. T2: addition with 10% cow bone meals. T3: addition with 10% cow bone granules.
Fermentation 10 00603 g003
Figure 4. Changes in distributions of Cu (a) and Zn (b) during swine manure composting. T1: no cow bone addition. T2: addition with 10% cow bone meals. T3: addition with 10% cow bone granules.
Figure 4. Changes in distributions of Cu (a) and Zn (b) during swine manure composting. T1: no cow bone addition. T2: addition with 10% cow bone meals. T3: addition with 10% cow bone granules.
Fermentation 10 00603 g004
Figure 5. Changes in the relative abundance of MRGs (a) and ARGs (b) in different treatments. T1: no cow bone addition. T2: addition with 10% cow bone meals. T3: addition with 10% cow bone granules.
Figure 5. Changes in the relative abundance of MRGs (a) and ARGs (b) in different treatments. T1: no cow bone addition. T2: addition with 10% cow bone meals. T3: addition with 10% cow bone granules.
Fermentation 10 00603 g005
Figure 6. Redundancy analysis (RDA) of environmental factor, HMs, the four components of DOM, ARGs and MRGs. Explanatory note: F1, F2, F3 and F4 of Cu represent CuF1, CuF2, CuF3 and CuF4, respectively; F1, F2, F3 and F4 of Zn represent ZnF1, ZnF2, ZnF3 and ZnF4, respectively.
Figure 6. Redundancy analysis (RDA) of environmental factor, HMs, the four components of DOM, ARGs and MRGs. Explanatory note: F1, F2, F3 and F4 of Cu represent CuF1, CuF2, CuF3 and CuF4, respectively; F1, F2, F3 and F4 of Zn represent ZnF1, ZnF2, ZnF3 and ZnF4, respectively.
Fermentation 10 00603 g006
Table 1. Physicochemical characteristics of the swine manure and sawdust.
Table 1. Physicochemical characteristics of the swine manure and sawdust.
Raw MaterialsMoisture ContentpHOrganic Carbon ContentOrganic Nitrogen Content
unit% g·kg−1 DWg·kg−1 DW
Swine manure82.578.2440925.38
Sawdust1.816.534652.66
Table 2. The PCR primer sequences of MRGs, ARGs and intI1.
Table 2. The PCR primer sequences of MRGs, ARGs and intI1.
Gene NeeForward PrimerReverse Primer
Copper resistance genespcoATCGCGTATCGAGTTTCAATGCGAATAATGCCGTGCCAGTGAA
tcrBGTGCCGGAACTCAAGTAGCAGCACCGACTGCTGGACTTAA
cop ATGCACCTGACVGGSCAYATGVACTTCRCGGAACATRCC
Zinc resistance geneszntAATCGTCCGCTCGCTGTATCTCTCCGCCTTTTCCCCTCACCCTAACC
Integron geneintI1CGAACGAGTGGCGGAGGGTGTACCCGAGAGCTTGGCACCCA
Fluoroquinolone resistance genesAac(6’)-ib-crGTTTGAGAGGCAAGGTACCGTAAGAATGCCTGGCGTGTTTGA
parCGGTGGAATATCGGTCGCCATAAACTTCGACGGCACTTTGC
Macrolide resistance genesermBTAAAGGGCATTTAACGACGAAACTTTTATACCTCTGTTTGTTAGGGAATTGAA
ermFCAGCTTTGGTTGAACATTTACGAAAAATTCCTAAAATCACAACCGACAA
Sulfonamide resistance genessul1CACCGGAAACATCGCTGCAAAGTTCCGCCGCAAGGCT
Sul2CTCCGATGGAGGCCGGTATGGGAATGCCATCTGCCTTGA
Tetracycine resistance genestetWATGAACATTCCCACCGTTATCTTTATATCGGCGGAGAGCTTATCC
tetXCAATAATTGGTGGTGGACCCTTCTTACCTTGGACATCCCG
tetGGCAGAGCAGGTCGCTGGCCYGCAAGAGAAGCCAGAAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, S.; Feng, X.; Fu, M.; Jin, X. Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting. Fermentation 2024, 10, 603. https://doi.org/10.3390/fermentation10120603

AMA Style

Chen S, Feng X, Fu M, Jin X. Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting. Fermentation. 2024; 10(12):603. https://doi.org/10.3390/fermentation10120603

Chicago/Turabian Style

Chen, Shanshuai, Xiaoqiang Feng, Maode Fu, and Xin Jin. 2024. "Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting" Fermentation 10, no. 12: 603. https://doi.org/10.3390/fermentation10120603

APA Style

Chen, S., Feng, X., Fu, M., & Jin, X. (2024). Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting. Fermentation, 10(12), 603. https://doi.org/10.3390/fermentation10120603

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop