Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting
Abstract
1. Introduction
2. Materials and Methods
2.1. Raw Materials and Experiment Design
2.2. Analytical Methods
2.3. DNA Extraction and qPCR Analysis
2.4. Data Statistical Analysis
3. Results and Discussion
3.1. Changes in Maturity Indexes
3.2. EEM-PARAFAC Analysis
3.3. Heavy Metals Transformation
3.4. Variations of MRGs, ARGs and MGEs
3.5. Factors That Affected the Fates of HMs, ARGs and MRGs
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ahmad, M.; Lee, S.S.; Lim, J.E.; Lee, S.E.; Cho, J.S.; Moon, D.H.; Hashimoto, Y.; Ok, Y.S. Speciation and phytoavailability of lead and antimony in a small arms range soil amended with mussel shell, cow bone and biochar: EXAFS spectroscopy and chemical extractions. Chemosphere 2014, 95, 433–441. [Google Scholar] [CrossRef] [PubMed]
- Awasthi, M.K.; Wang, M.J.; Chen, H.Y.; Wang, Q.; Zhao, J.C.; Ren, X.N.; Li, D.S.; Awasthi, S.K.; Shen, F.; Li, R.H.; et al. Heterogeneity of biochar amendment to improve the carbon and nitrogen sequestration through reduce the greenhouse gases emissions during sewage sludge composting. Bioresour. Technol. 2016, 224, 428–438. [Google Scholar] [CrossRef] [PubMed]
- Awasthi, M.K.; Duan, Y.M.; Awasthi, S.K.; Liu, T.; Chen, H.Y.; Pandey, A.; Zhang, Z.Q.; Taherzadeh, M. Emerging applications of biochar: Improving pig manure composting and attenuation of heavy metal mobility in mature compost. J. Hazard. Mater. 2020, 389, 122116. [Google Scholar] [CrossRef] [PubMed]
- Baker-Austin, C.; Wright, M.S.; Stepanauskas, R.; Mcarthur, J.V. Co-selection of antibiotic and metal resistance. Trends Microbiol. 2006, 14, 176–182. [Google Scholar] [CrossRef] [PubMed]
- Bao, H.Y.; Chen, Z.Q.; Wen, Q.X.; Wu, Y.Q. Effects of oxytetracycline on variation in intracellular and extracellular antibiotic resistance genes during swine manure composting. Bioresour. Technol. 2024, 393, 130127. [Google Scholar] [CrossRef]
- Bernal, M.P.; Alburquerque, J.A.; Moral, R. Composting of animal manures and chemical criteria for compost maturity assessment. A review. Bioresour. Technol. 2009, 100, 5444–5453. [Google Scholar] [CrossRef]
- Bolan, N.; Adriano, D.; Mahimairaja, S. Distribution and Bioavailability of Trace Elements in Livestock and Poultry Manure By-Products. Crit. Rev. Environ. Sci. Technol. 2004, 34, 291–338. [Google Scholar] [CrossRef]
- Chen, Y.X.; Huang, X.D.; Han, Z.Y.; Huang, X.; Hu, B.; Shi, D.Z.; Wu, W.X. Effects of bamboo charcoal and bamboo vinegar on nitrogen conservation and heavy metals immobility during pig manure composting. Chemosphere 2010, 78, 1177–1181. [Google Scholar] [CrossRef]
- Chen, H.Y.; Awasthi, M.K.; Liu, T.; Zhao, J.C.; Ren, X.N.; Wang, M.J.; Duan, Y.M.; Awasthi, S.K.; Zhang, Z.Q. Influence of clay as additive on greenhouse gases emission and maturity evaluation during chicken manure composting. Bioresour. Technol. 2018, 266, 82–88. [Google Scholar] [CrossRef]
- Chen, M.L.; Wang, C.; Wang, B.R.; Bai, X.J.; Gao, H.; Huang, Y.M. Enzymatic mechanism of organic nitrogen conversion and ammonia formation during vegetable waste composting using two amendments. Waste Manag. 2019, 95, 306–315. [Google Scholar] [CrossRef]
- Chen, X.M.; Zhao, Y.; Zeng, C.C.; Li, Y.J.; Zhu, L.J.; Wu, J.Q.; Chen, J.; Wei, Z.M. Assessment contributions of physicochemical properties and bacterial community to mitigate the bioavailability of heavy metals during composting based on structural equation models. Bioresour. Technol. 2019, 289, 121657. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.R.; Chen, Y.N.; Li, Y.P.; Wu, Y.X.; Zeng, Z.P.; Xu, R.; Wang, S.; Li, H.; Zhang, J.C. Changes of heavy metal fractions during co-composting of agricultural waste and river sediment with inoculation of Phanerochaete chrysosporium. J. Hazard. Mater. 2019, 378, 120757. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.Q.; Wu, Y.Q.; Wen, Q.X.; Bao, H.Y.; Fu, Q.Q. Insight into the effects of sulfamethoxazole and norfloxacin on nitrogen transformation functional genes during swine manure composting. Bioresour. Technol. 2020, 297, 122463. [Google Scholar] [CrossRef] [PubMed]
- Cohen, E.; Levy, G.J.; Borisover, M. Fluorescent components of organic matter in wastewater: Efficacy and selectivity of the water treatment. Water Res. 2014, 55, 323–334. [Google Scholar] [CrossRef] [PubMed]
- Cui, E.; Wu, Y.; Zuo, Y.R.; Chen, H. Effect of different biochars on antibiotic resistance genes and bacterial community during chicken manure composting. Bioresour. Technol. 2016, 203, 11–17. [Google Scholar] [CrossRef]
- Cui, H.; Ou, Y.; Wang, L.X.; Yan, B.X.; Li, Y.X.; Ding, D.W. The passivation effect of heavy metals during biochar-amended composting: Emphasize on bacterial communities. Waste Manag. 2020, 118, 360–368. [Google Scholar] [CrossRef]
- Cui, H.; Ou, Y.; Wang, L.X.; Yan, B.X.; Li, Y.X.; Bao, M.W. Critical passivation mechanisms on heavy metals during aerobic composting with different grain-size zeolite. J. Hazard. Mater. 2021, 406, 124313. [Google Scholar] [CrossRef]
- Darwish, M.; Aris, A.; Puteh, M.H.; Jusoh, M.N.H.; Kadir, A.A. Waste bones ash as an alternative source of P for struvite precipitation. J. Environ. Manag. 2016, 203, 861–866. [Google Scholar] [CrossRef]
- Gyadi, T.; Bharti, A.; Basack, S.; Kumar, P.; Lucchi, E. Influential factors in anaerobic digestion of rice-derived food waste and animal manure: A comprehensive review. Bioresour. Technol. 2024, 413, 131398. [Google Scholar] [CrossRef]
- Hao, X.W.; Huang, Y.Z.; Cui, Y.S. Effect of bone char addition on the fractionation and bio-accessibility of Pb and Zn in combined contaminated soil. Acta Ecol. Sin. 2010, 30, 118–122. [Google Scholar] [CrossRef]
- Hao, J.K.; Wei, Z.M.; Wei, D.; Mohamed, T.A.; Yu, H.M.; Xie, X.Y.; Zhu, L.J.; Zhao, Y. Roles of adding biochar and montmorillonite alone on reducing the bioavailability of heavy metals during chicken manure composting. Bioresour. Technol. 2019, 294, 122199. [Google Scholar] [CrossRef] [PubMed]
- Hodson, M.E.; Valsami-Jones, E.; Cotter-Howells, J.D. Bone meal additions as a remediation treatment for metal contaminated soil. Environ. Sci. Technol. 2000, 34, 3501–3507. [Google Scholar] [CrossRef]
- Huang, G.Y.; Gao, R.L.; You, J.W.; Zhu, J.; Fu, Q.L.; Hu, H.Q. Oxalic acid activated phosphate rock and bone meal to immobilize Cu and Pb in mine soils. Ecotoxicol. Environ. Saf. 2019, 174, 401–407. [Google Scholar] [CrossRef] [PubMed]
- Jang, H.M.; Lee, J.; Kim, Y.B.; Jeon, J.H.; Shin, J.; Park, M.R.; Kim, Y.M. Fate of antibiotic resistance genes and metal resistance genes during thermophilic aerobic digestion of sewage sludge. Bioresour. Technol. 2018, 249, 635–643. [Google Scholar] [CrossRef] [PubMed]
- Jutaporn, P.; Armstrong, M.D.; Coronell, O. Assessment of C-DBP and N-DBP formation potential and its reduction by MIEX® DOC and MIEX® GOLD resins using fluorescence spectroscopy and parallel factor analysis. Water Res. 2020, 172, 115460. [Google Scholar] [CrossRef]
- Kang, J.; Zhang, Z.Q.; Wang, J.J. Influence of humic substances on bioavailability of Cu and Zn during sewage sludge composting. Bioresour. Technol. 2011, 102, 8022–8026. [Google Scholar] [CrossRef]
- Lang, Q.Q.; Chen, M.J.; Guo, Y.C.; Liu, Z.G.; Gai, C. Effect of hydrothermal carbonization on heavy metals in swine manure: Speciation, bioavailability and environmental risk. J. Environ. Manag. 2019, 234, 97–103. [Google Scholar] [CrossRef]
- Li, R.H.; Wang, J.J.; Zhang, Z.Q.; Shen, F.; Zhang, G.J.; Qin, R.; Li, X.L.; Xiao, R. Nutrient transformations during composting of pig manure with bentonite. Bioresour. Technol. 2012, 121, 362–368. [Google Scholar] [CrossRef]
- Lin, Q.; Liang, L.; Wang, L.H.; Ni, Q.L.; Yang, K.; Zhang, J.; Chen, D.L.; Yang, J.J.; Shen, X.D. Roles of pyrolysis on availability, species and distribution of Cu and Zn in the swine manure: Chemical extractions and high-energy synchrotron analyses. Chemosphere 2013, 93, 2094–2100. [Google Scholar] [CrossRef]
- Lu, D.A.; Wang, L.X.; Yan, B.X.; Ou, Y.; Guan, J.N.; Bian, Y.; Zhang, Y.B. Speciation of Cu and Zn during composting of pig manure amended with rock phosphate. Waste Manag. 2014, 34, 1529–1536. [Google Scholar] [CrossRef]
- Lv, B.Y.; Xing, M.Y.; Zhao, C.H.; Yang, J.; Xiang, L. Towards understanding the stabilization process in vermicomposting using PARAFAC analysis of fluorescence spectra. Chemosphere 2014, 117, 216–222. [Google Scholar] [CrossRef] [PubMed]
- Ma, L.C.; Zhou, Y.C.; Wang, A.; Li, Q.L. A potential heavy metals detoxification system in composting: Biotic and abiotic synergy mediated by shell powder. Bioresour. Technol. 2023, 386, 129576. [Google Scholar] [CrossRef] [PubMed]
- Murphy, K.R.; Stedmon, C.A.; Wenig, P.; Bro, R. OpenFluor—An online spectral library of auto-fluorescence by organic compounds in the environment. Anal. Methods 2014, 6, 658–661. [Google Scholar] [CrossRef]
- Najar, I.N.; Sherpa, M.T.; Das, S.; Das, S.; Thakur, N. Diversity analysis and metagenomic insights into antibiotic and metal resistance among Himalayan hot spring bacteriobiome insinuating inherent environmental baseline levels of antibiotic and metal tolerance. J. Glob. Antimicrob. Resist. 2020, 21, 342–352. [Google Scholar] [CrossRef]
- Pan, J.T.; Li, R.H.; Zhai, L.M.; Zhang, Z.Q.; Ma, J.Y.; Liu, H.B. Influence of palygorskite addition on biosolids composting process enhancement. J. Clean. Prod. 2019, 217, 371–379. [Google Scholar] [CrossRef]
- Niu, Q.Q.; Yan, H.L.; Meng, Q.R.; Wang, S.S.; Li, G.; Zhu, Q.H.; Li, X.T.; Li, Q.L. Hydrogen peroxide plus ascorbic acid enhanced organic matter deconstructions and composting performances via changing microbial communities. J. Environ. Manag. 2021, 295, 113126. [Google Scholar] [CrossRef]
- Olugbemide, A.D.; Oberlintner, A.; Novak, U.; Likozar, B. Lignocellulosic Corn Stover Biomass Pre-Treatment by Deep Eutectic Solvents (DES) for Biomethane Production Process by Bioresource Anaerobic Digestion. Sustainability 2021, 13, 10504. [Google Scholar] [CrossRef]
- Olugbemide, A.D.; Likozar, B. Assessment of Liquid and Solid Digestates from Anaerobic Digestion of Rice Husk as Potential Biofertilizer and Nutrient Source for Microalgae Cultivation. Processes 2022, 10, 1007. [Google Scholar] [CrossRef]
- Pu, Q.; Fan, X.T.; Sun, A.Q.; Pan, T.; Li, H.; Bo, L.S.; An, X.L.; Su, J.Q. Co-effect of cadmium and iron oxide nanoparticles on plasmid-mediated conjugative transfer of antibiotic resistance genes. Environ. Int. 2021, 152, 106453. [Google Scholar] [CrossRef]
- Ren, X.N.; Wang, Q.; Awasthi, M.K.; Zhao, J.C.; Wang, J.C.; Liu, T.; Li, R.S.; Zhang, Z.Q. Improvement of cleaner composting production by adding Diatomite: From the nitrogen conservation and greenhouse gas emission. Bioresour. Technol. 2019, 286, 121377. [Google Scholar] [CrossRef]
- Ren, X.N.; Wang, Q.; Li, R.H.; Chang, C.C.; Pan, J.T.; Zhang, Z.Q. Effect of clay on greenhouse gas emissions and humification during pig manure composting as supported by spectroscopic evidence. Sci. Total Environ. 2020, 737, 139712. [Google Scholar] [CrossRef] [PubMed]
- Sardar, M.F.; Zhu, C.X.; Geng, B.; Ahmad, H.R.; Song, T.T.; Li, H.N. The fate of antibiotic resistance genes in cow manure composting: Shaped by temperature-controlled composting stages. Bioresour. Technol. 2021, 320, 124403. [Google Scholar] [CrossRef] [PubMed]
- Shaheen, S.M.; Shams, M.S.; Khalifa, M.R.; El-Dali, M.A.; Rinklebe, J. Various soil amendments and environmental wastes affect the (im) mobilization and phytoavailability of potentially toxic elements in a sewage effluent irrigated sandy soil. Ecotoxicol. Environ. Saf. 2017, 142, 375–387. [Google Scholar] [CrossRef] [PubMed]
- Sneddon, I.R.; Orueetxebarria, M.; Hodson, M.E.; Schofield, P.F.; Valsami-Jones, E. Field trial using bone meal amendments to remediate mine waste derived soil contaminated with zinc, lead and cadmium. Appl. Geochem. 2008, 23, 2414–2424. [Google Scholar] [CrossRef]
- Stedmon, C.A.; Bro, R. Characterizing dissolved organic matter fluorescence with parallel factor analysis: A tutorial. Limnol. Oceanogr. Methods 2008, 6, 572–579. [Google Scholar] [CrossRef]
- Sun, R.J.; Chen, J.H.; Fan, T.T.; Zhou, D.M.; Wang, Y.J. Effect of nanoparticle hydroxyapatite on the immobilization of Cu and Zn in polluted soil. Environ. Sci. Pollut. Res. 2018, 25, 73–80. [Google Scholar] [CrossRef]
- Tang, J.; Zhuang, L.; Yu, Z.; Liu, X.M.; Wang, Y.Q.; Wen, P.; Zhou, S.G. Insight into complexation of Cu(II) to hyperthermophilic compost-derived humic acids by EEM-PARAFAC combined with heterospectral two dimensional correlation analyses. Sci. Total Environ. 2018, 656, 29–38. [Google Scholar] [CrossRef] [PubMed]
- Valipour, M.; Shahbazi, K.; Khanmirzaei, A. Chemical Immobilization of Lead, Cadmium, Copper, and Nickel in Contaminated Soils by Phosphate Amendments. CLEAN-Soil Air Water 2016, 44, 572–578. [Google Scholar] [CrossRef]
- Wang, X.K.; Zheng, G.D.; Chen, T.B.; Shi, X.X.; Wang, Y.W.; Nie, E.; Liu, J.W. Effect of phosphate amendments on improving the fertilizer efficiency and reducing the mobility of heavy metals during sewage sludge composting. J. Environ. Manag. 2019, 235, 124–132. [Google Scholar] [CrossRef]
- Wang, X.K.; Chen, T.B.; Zheng, G.D. Preservation of nitrogen and sulfur and passivation of heavy metals during sewage sludge composting with KH2PO4 and FeSO4. Bioresour. Technol. 2020, 297, 122383. [Google Scholar] [CrossRef]
- Wu, D.; Huang, Z.T.; Yang, K.; Graham, D.; Xie, B. Relationships between Antibiotics and Antibiotic Resistance Gene Levels in Municipal Solid Waste Leachates in Shanghai, China. Environ. Sci. Technol. 2015, 49, 4122–4128. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.Q.; Zhao, Y.; Qi, H.S.; Zhao, X.Y.; Yang, T.X.; Du, Y.Q.; Zhang, H.; Wei, Z.M. Identifying the key factors that affect the formation of humic substance during different materials composting. Bioresour. Technol. 2017, 244, 1193–1196. [Google Scholar] [CrossRef] [PubMed]
- Wu, N.; Xie, S.Y.; Zeng, M.; Xu, X.Y.; Liu, X.Y.; Wang, X.B. Impacts of pile temperature on antibiotic resistance, metal resistance and microbial community during swine manure composting. Sci. Total Environ. 2020, 744, 140920. [Google Scholar] [CrossRef] [PubMed]
- Xie, D.; Gao, M.; Yang, M.; Xu, M.Y.; Meng, J.; Wu, C.F.; Wang, Q.H.; Liu, S.; Sun, X.H. Composting-a solution of eliminating a nitrite-rich wastewater by reusing it as a moisture conditioning agent. Chemosphere 2021, 284, 131365. [Google Scholar] [CrossRef]
- Xiong, X.; Li, Y.X.; Li, W.; Lin, C.Y.; Han, W.; Yang, M. Copper content in animal manures and potential risk of soil copper pollution with animal manure use in agriculture. Resour. Conserv. Recycl. 2010, 54, 985–990. [Google Scholar] [CrossRef]
- Yin, Y.N.; Gu, J.; Wang, X.J.; Zhang, K.Y.; Hu, T.; Ma, J.Y.; Wang, Q.Z. Impact of copper on the diazotroph abundance and community composition during swine manure composting. Bioresour. Technol. 2018, 255, 257–265. [Google Scholar] [CrossRef]
- Yuan, X.Z.; Huang, H.J.; Zeng, G.M.; Li, H.; Wang, J.Y.; Zhou, C.F.; Zhu, H.N.; Pei, X.K.; Liu, Z.F.; Liu, Z.T. Total concentrations and chemical speciation of heavy metals in liquefaction residues of sewage sludge. Bioresour. Technol. 2011, 102, 4104–4110. [Google Scholar] [CrossRef]
- Yu, Z.; Liu, X.M.; Chen, C.Y.; Liao, H.P.; Chen, Z.; Zhou, S.G. Molecular insights into the transformation of dissolved organic matter during hyperthermophilic composting using ESI FT-ICR MS. Bioresource. Technol. 2019, 292, 122007. [Google Scholar] [CrossRef]
- Zhang, L.; Sun, X.Y. Changes in physical, chemical, and microbiological properties during the two-stage co-composting of green waste with spent mushroom compost and biochar. Bioresour. Technol. 2014, 171, 274–284. [Google Scholar] [CrossRef]
- Zhang, S.H.; Chen, Z.Q.; Wen, Q.X.; Zheng, J. Assessing the stability in composting of penicillin mycelial dreg via parallel factor (PARAFAC) analysis of fluorescence excitation–emission matrix (EEM). Chem. Eng. J. 2016, 299, 167–176. [Google Scholar] [CrossRef]
- Zhang, C.S.; Xu, Y.; Zhao, M.H.; Rong, H.W.; Zhang, K.F. Influence of inoculating white-rot fungi on organic matter transformations and mobility of heavy metals in sewage sludge based composting. J. Hazard. Mater. 2017, 344, 163–168. [Google Scholar] [CrossRef] [PubMed]
- Zheng, G.D.; Wang, X.K.; Chen, T.B.; Yang, J.; Yang, J.X.; Liu, J.W.; Shi, X.X. Passivation of lead and cadmium and increase of the nutrient content during sewage sludge composting by phosphate amendments. Environ. Res. 2020, 185, 109431. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.B.; Meng, H.B.; Zhao, L.X.; Shen, Y.J.; Hou, Y.Q.; Cheng, Y.S.; Song, L.Q. Effect of biochar and humic acid on the copper, lead, and cadmium passivation during composting. Bioresour. Technol. 2018, 258, 279–286. [Google Scholar] [CrossRef] [PubMed]
- Zucconi, F.; Pera, A.; Forte, M.; de Bertoldi, M. Evaluating toxicity of immature compost. Biocycle 1981, 22, 54–57. [Google Scholar]
Raw Materials | Moisture Content | pH | Organic Carbon Content | Organic Nitrogen Content |
---|---|---|---|---|
unit | % | g·kg−1 DW | g·kg−1 DW | |
Swine manure | 82.57 | 8.24 | 409 | 25.38 |
Sawdust | 1.81 | 6.53 | 465 | 2.66 |
Gene Nee | Forward Primer | Reverse Primer | |
---|---|---|---|
Copper resistance genes | pcoA | TCGCGTATCGAGTTTCAATGC | GAATAATGCCGTGCCAGTGAA |
tcrB | GTGCCGGAACTCAAGTAGCA | GCACCGACTGCTGGACTTAA | |
cop A | TGCACCTGACVGGSCAYAT | GVACTTCRCGGAACATRCC | |
Zinc resistance genes | zntA | ATCGTCCGCTCGCTGTATCTCT | CCGCCTTTTCCCCTCACCCTAACC |
Integron gene | intI1 | CGAACGAGTGGCGGAGGGTG | TACCCGAGAGCTTGGCACCCA |
Fluoroquinolone resistance genes | Aac(6’)-ib-cr | GTTTGAGAGGCAAGGTACCGTAA | GAATGCCTGGCGTGTTTGA |
parC | GGTGGAATATCGGTCGCCAT | AAACTTCGACGGCACTTTGC | |
Macrolide resistance genes | ermB | TAAAGGGCATTTAACGACGAAACT | TTTATACCTCTGTTTGTTAGGGAATTGAA |
ermF | CAGCTTTGGTTGAACATTTACGAA | AAATTCCTAAAATCACAACCGACAA | |
Sulfonamide resistance genes | sul1 | CACCGGAAACATCGCTGCA | AAGTTCCGCCGCAAGGCT |
Sul2 | CTCCGATGGAGGCCGGTAT | GGGAATGCCATCTGCCTTGA | |
Tetracycine resistance genes | tetW | ATGAACATTCCCACCGTTATCTTT | ATATCGGCGGAGAGCTTATCC |
tetX | CAATAATTGGTGGTGGACCC | TTCTTACCTTGGACATCCCG | |
tetG | GCAGAGCAGGTCGCTGG | CCYGCAAGAGAAGCCAGAAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, S.; Feng, X.; Fu, M.; Jin, X. Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting. Fermentation 2024, 10, 603. https://doi.org/10.3390/fermentation10120603
Chen S, Feng X, Fu M, Jin X. Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting. Fermentation. 2024; 10(12):603. https://doi.org/10.3390/fermentation10120603
Chicago/Turabian StyleChen, Shanshuai, Xiaoqiang Feng, Maode Fu, and Xin Jin. 2024. "Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting" Fermentation 10, no. 12: 603. https://doi.org/10.3390/fermentation10120603
APA StyleChen, S., Feng, X., Fu, M., & Jin, X. (2024). Effect of Cow Bone Addition on the Humification, Heavy Metals Passivation and Fate of Resistance Genes During Swine Manure Composting. Fermentation, 10(12), 603. https://doi.org/10.3390/fermentation10120603