Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-Viral hsa-miR-132 Processing in CEM-SS Cells
Abstract
:1. Introduction
2. Results
2.1. Expression Profiling of Pro- and Anti-HIV-1 miRNAs in Response to Enoxacin and Nalidixic Acid in Cellulo
2.2. Anti-HIV-1 Replicative Effect of Enoxacin but Not Nalidixic Acid in CEM-SS Cells
2.3. Hsa-miR-132-3p Can Enhance HIV-1 Replication and Eventually Rescue the Anti-Replicative Effect of Enoxacin
2.4. DICER1 Processing of hsa-miR-132 Is Affected by Enoxacin In Vitro
3. Discussion
4. Materials and Methods
4.1. Viruses, Cell Lines and Virus Infections
4.2. Compound Preparation
4.3. p24 ELISA with Enoxacin/Nalidixic Acid and Rescue Assay with hsa-miR-132-3p
4.4. Cell Survival Assay
4.5. MiRNA RT-qPCR
4.6. In Vitro DICER1 Assay in CEM-SS Cell Lysates and with Recombinant DICER
4.7. SHAPE Assay
- (A)
- Pri-miR-132 In Vitro Transcription
- (B)
- Chemical Modification and Mutational Profiling of Pre-miR-132
- (C)
- Reverse Transcription
ShapeMapper2 Analysis
- --name <experiment_name>: Name for the output files.
- --target <reference_sequence_file>: Path to the reference sequence (FASTA format).
- --out <output_directory>: Directory for output files.
- --modified: Indicates modified samples.
- --R1 <modified_R1_read_file>: Path to R1 read file for modified samples.
- --R2 <modified_R2_read_file>: Path to R2 read file for modified samples.
- --untreated: Indicates untreated control samples.
- --R1 <untreated_R1_read_file>: Path to R1 read file for untreated samples.
- --R2 <untreated_R2_read_file>: Path to R2 read file for untreated samples.
- --denatured: Indicates denatured samples.
- --R1 <denatured_R1_read_file>: Path to R1 read file for denatured samples.
- --R2 <denatured_R2_read_file>: Path to R2 read file for denatured samples.
- --overwrite: Allows overwriting existing output files.
- --output-processed-read: Option to output processed read files.
- --output-aligned-reads: Option to output aligned read files.
- --output-parsed-mutations: Option to output parsed mutation files.
- --nproc <number_of_processes>: Number of CPU threads for processing.
- --serial: Indicates serial execution (not necessary if using multiple processes).
- Load Data: The script loads and combines data from the specified paths for both drug conditions and the control;
- Mean Reactivity Calculation: It calculates the mean reactivity for specific indices (19–28 and 43–50) from the loaded datasets;
- Normalization: The mean reactivity values for both drug conditions are normalized against the mean reactivity of the control condition;
- Statistical Testing: A Mann–Whitney U test is performed to assess whether there are statistically significant differences between the normalized reactivities of the drug conditions and the control. Z-values are also calculated to evaluate the test results.
- Fold RNA Sequence:
- ○
- Open RNAstructure.
- ○
- Load your .fa (FASTA) file.
- ○
- Use the RNA Single Fold option.
- ○
- Generate and save the .ct file.
- Annotate Structure:
- ○
- Go to Annotation Options in RNAstructure.
- ○
- Input your combined.shape file.
- Visualize Results:
- ○
- Check the annotated structure in RNAstructure.
4.8. Flow Cytometry
4.9. Luciferase Assay
4.10. Oligonucleotides, miRNA Mimics and TaqMan™ Probes
siREN Sense-Strand: GAGCGAAGAGGGCGAGAAAUU
4.11. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- UNAIDS. UN Joint Programme on HIV/AIDS (UNAIDS), Global AIDS Update—2016. June 2016. Available online: https://www.refworld.org/reference/annualreport/unaids/2016/en/110274 (accessed on 11 November 2024).
- Cullen, B.R. Viral and cellular messenger RNA targets of viral microRNAs. Nature 2009, 457, 421–425. [Google Scholar] [CrossRef]
- Esteller, M. Non-coding RNAs in human disease. Nat. Rev. Genet. 2011, 12, 861–874. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, D.; DeWitt, N. In Vivo Cellular Reprogramming: The Next Generation. Cell 2016, 166, 1386–1396. [Google Scholar] [CrossRef]
- Bartel, D.P. Metazoan MicroRNAs. Cell 2018, 173, 20–51. [Google Scholar] [CrossRef]
- Ebert, M.S.; Sharp, P.A. Roles for microRNAs in conferring robustness to biological processes. Cell 2012, 149, 515–524. [Google Scholar] [CrossRef] [PubMed]
- Lecellier, C.H.; Dunoyer, P.; Arar, K.; Lehmann-Che, J.; Eyquem, S.; Himber, C.; Saïb, A.; Voinnet, O. A cellular microRNA mediates antiviral defense in human cells. Science 2005, 308, 557–560. [Google Scholar] [CrossRef] [PubMed]
- Jopling, C.L.; Yi, M.; Lancaster, A.M.; Lemon, S.M.; Sarnow, P. Modulation of hepatitis C virus RNA abundance by a liver-specific MicroRNA. Science 2005, 309, 1577–1581. [Google Scholar] [CrossRef] [PubMed]
- Jopling, C.; Norman, K.; Sarnow, P. Positive and negative modulation of viral and cellular mRNAs by liver-specific microRNA miR-122. Cold Spring Harb. Symp. Quant. Biol. 2006, 71, 369–376. [Google Scholar] [CrossRef] [PubMed]
- Rashid, F.; Zaongo, S.D.; Song, F.; Chen, Y. The diverse roles of miRNAs in HIV pathogenesis: Current understanding and future perspectives. Front. Immunol. 2022, 13, 1091543. [Google Scholar] [CrossRef] [PubMed]
- Klase, Z.; Houzet, L.; Jeang, K.-T. MicroRNAs and HIV-1: Complex interactions. J. Biol. Chem. 2012, 287, 40884–40890. [Google Scholar] [CrossRef] [PubMed]
- Lagos-Quintana, M.; Rauhut, R.; Yalcin, A.; Meyer, J.; Lendeckel, W.; Tuschl, T. Identification of tissue-specific microRNAs from mouse. Curr. Biol. 2002, 12, 735–739. [Google Scholar] [CrossRef]
- Janssen, H.L.; Reesink, H.W.; Lawitz, E.J.; Zeuzem, S.; Rodriguez-Torres, M.; Patel, K.; van der Meer, A.J.; Patick, A.K.; Chen, A.; Hodges, M.R.; et al. Treatment of HCV infection by targeting microRNA. N. Engl. J. Med. 2013, 368, 1685–1694. [Google Scholar] [CrossRef] [PubMed]
- Ramirez, P.W.; Pantoja, C.; Beliakova-Bethell, N. An Evaluation on the Role of Non-Coding RNA in HIV Transcription and Latency: A Review. HIV/AIDS-Res. Palliat. Care 2023, 15, 115–134. [Google Scholar] [CrossRef] [PubMed]
- Nathans, R.; Chu, C.-Y.; Serquina, A.K.; Lu, C.-C.; Cao, H.; Rana, T.M. Cellular microRNA and P bodies modulate host-HIV-1 interactions. Mol. Cell 2009, 34, 696–709. [Google Scholar] [CrossRef] [PubMed]
- Sun, G.; Li, H.; Wu, X.; Covarrubias, M.; Scherer, L.; Meinking, K.; Luk, B.; Chomchan, P.; Alluin, J.; Gombart, A.F.; et al. Interplay between HIV-1 infection and host microRNAs. Nucleic Acids Res. 2012, 40, 2181–2196. [Google Scholar] [CrossRef]
- Ahluwalia, J.K.; Khan, S.Z.; Soni, K.; Rawat, P.; Gupta, A.; Hariharan, M.; Scaria, V.; Lalwani, M.; Pillai, B.; Brahmachari, S.K.; et al. Human cellular microRNA hsa-miR-29a interferes with viral nef protein expression and HIV-1 replication. Retrovirology 2008, 5, 117. [Google Scholar] [CrossRef] [PubMed]
- Tumolo, M.R.; Scoditti, E.; Guarino, R.; Grassi, T.; Bagordo, F.; Sabina, S. MIR-29A-3P, MIR-29C-3P, MIR-146B-5P AND MIR-150-5P, Their Target Genes and lncrnas in HIV Infection: A Bioinformatic Study. Curr. HIV Res. 2023, 21, 128–139. [Google Scholar] [CrossRef] [PubMed]
- Morando, N.; Rosenzvit, M.C.; Pando, M.A.; Allmer, J. The Role of MicroRNAs in HIV Infection. Genes 2024, 15, 574. [Google Scholar] [CrossRef]
- Whisnant, A.W.; Bogerd, H.P.; Flores, O.; Ho, P.; Powers, J.G.; Sharova, N.; Stevenson, M.; Chen, C.-H.; Cullen, B.R. In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio 2013, 4, e000193. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Wang, F.; Argyris, E.; Chen, K.; Liang, Z.; Tian, H.; Huang, W.; Squires, K.; Verlinghieri, G.; Zhang, H. Cellular microRNAs contribute to HIV-1 latency in resting primary CD4+ T lymphocytes. Nat. Med. 2007, 13, 1241–1247. [Google Scholar] [CrossRef]
- Houzet, L.; Klase, Z.; Yeung, M.L.; Wu, A.; Le, S.Y.; Quinones, M.; Jeang, K.T. The extent of sequence complementarity correlates with the potency of cellular miRNA-mediated restriction of HIV-1. Nucleic Acids Res. 2012, 40, 11684–11696. [Google Scholar] [CrossRef]
- Triboulet, R.; Mari, B.; Lin, Y.L.; Chable-Bessia, C.; Bennasser, Y.; Lebrigand, K.; Cardinaud, B.; Maurin, T.; Barbry, P.; Benkirane, M.; et al. Suppression of microRNA-silencing pathway by HIV-1 during virus replication. Science 2007, 315, 1579–1582. [Google Scholar] [CrossRef] [PubMed]
- Vongrad, V.; Imig, J.; Mohammadi, P.; Kishore, S.; Jaskiewicz, L.; Hall, J.; Günthard, H.F.; Beerenwinkel, N.; Metzner, K.J. HIV-1 RNAs are Not Part of the Argonaute 2 Associated RNA Interference Pathway in Macrophages. PLoS ONE 2015, 10, e0132127. [Google Scholar] [CrossRef]
- Chiang, K.; Liu, H.; Rice, A.P. miR-132 enhances HIV-1 replication. Virology 2013, 438, 1–4. [Google Scholar] [CrossRef]
- Alpuche-Lazcano, S.P.; Scarborough, R.J.; Gatignol, A. MicroRNAs and long non-coding RNAs during transcriptional regulation and latency of HIV and HTLV. Retrovirology 2024, 21, 5. [Google Scholar] [CrossRef]
- Amaral, A.J.; Andrade, J.; Foxall, R.B.; Matoso, P.; Matos, A.M.; Soares, R.S.; Rocha, C.; Ramos, C.G.; Tendeiro, R.; Serra-Caetano, A.; et al. miRNA profiling of human naive CD4 T cells links miR-34c-5p to cell activation and HIV replication. EMBO J. 2017, 36, 346–360. [Google Scholar] [CrossRef] [PubMed]
- Kapoor, R.; Arora, S.; Ponia, S.S.; Kumar, B.; Maddika, S.; Banerjea, A.C. The miRNA miR-34a enhances HIV-1 replication by targeting PNUTS/PPP1R10, which negatively regulates HIV-1 transcriptional complex formation. Biochem. J. 2015, 470, 293–302. [Google Scholar] [CrossRef]
- Zhang, H.S.; Chen, X.Y.; Wu, T.C.; Sang, W.W.; Ruan, Z. MiR-34a is involved in Tat-induced HIV-1 long terminal repeat (LTR) transactivation through the SIRT1/NFkappaB pathway. FEBS Lett. 2012, 586, 4203–4207. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.-S.; Wu, T.-C.; Sang, W.-W.; Ruan, Z. MiR-217 is involved in Tat-induced HIV-1 long terminal repeat (LTR) transactivation by down-regulation of SIRT1. Biochim. Biophys. Acta Mol. Cell Res. 2012, 1823, 1017–1023. [Google Scholar] [CrossRef] [PubMed]
- Farberov, L.; Herzig, E.; Modai, S.; Isakov, O.; Hizi, A.; Shomron, N. MicroRNA-mediated regulation of p21 and TASK1 cellular restriction factors enhances HIV-1 infection. J. Cell. Sci. 2015, 128, 1607–1616. [Google Scholar] [PubMed]
- Kashiwase, H.; Momota, K.; Ohmine, T.; Komai, T.; Kimura, T.; Katsube, T.; Nishigaki, T.; Kimura, S.; Shimada, K.; Furukawa, H. A new fluoroquinolone derivative exhibits inhibitory activity against human immunodeficiency virus type 1 replication. Chemotherapy 1999, 45, 48–55. [Google Scholar] [CrossRef]
- Nozaki-Renard, J.; Iino, T.; Sato, Y.; Marumoto, Y.; Ohta, G.; Furusawa, M. Fluoroquinolones protect the human lymphocyte CEM cell line from HIV-1-mediated cytotoxicity. Cell Struct. Funct. 1990, 15, 295–299. [Google Scholar] [CrossRef] [PubMed]
- Shan, G.; Li, Y.; Zhang, J.; Li, W.; Szulwach, K.E.; Duan, R.; Faghihi, M.A.; Khalil, A.M.; Paroo, Z.; Jin, P.; et al. A small molecule enhances RNA interference and promotes microRNA processing. Nat. Biotechnol. 2008, 26, 933–940. [Google Scholar] [CrossRef]
- Sousa, E.J.; Graça, I.; Baptista, T.; Vieira, F.Q.; Palmeira, C.; Henrique, R.; Jerónimo, C. Enoxacin inhibits growth of prostate cancer cells and effectively restores microRNA processing. Epigenetics 2013, 8, 548–558. [Google Scholar] [CrossRef]
- Ponia, S.S.; Arora, S.; Kumar, B.; Banerjea, A.C. Arginine rich short linear motif of HIV-1 regulatory proteins inhibits dicer dependent RNA interference. Retrovirology 2013, 10, 97. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Lin, L.; Li, Z.; Ye, X.; Xiong, K.; Aryal, B.; Xu, Z.; Paroo, Z.; Liu, Q.; He, C.; et al. Iron homeostasis regulates the activity of the microRNA pathway through poly(C)-binding protein 2. Cell Metab. 2012, 15, 895–904. [Google Scholar] [CrossRef] [PubMed]
- Smalheiser, N.R.; Zhang, H.; Dwivedi, Y. Enoxacin Elevates MicroRNA Levels in Rat Frontal Cortex and Prevents Learned Helplessness. Front. Psychiatry 2014, 5, 6. [Google Scholar] [CrossRef] [PubMed]
- Ramírez-Moya, J.; Wert-Lamas, L.; Riesco-Eizaguirre, G.; Santisteban, P. Impaired microRNA processing by DICER1 downregulation endows thyroid cancer with increased aggressiveness. Oncogene 2019, 38, 5486–5499. [Google Scholar] [CrossRef] [PubMed]
- Pinto, S.; Sato, V.N.; De-Souza, E.A.; Ferraz, R.C.; Camara, H.; Pinca, A.P.F.; Mazzotti, D.R.; Lovci, M.T.; Tonon, G.; Lopes-Ramos, C.M.; et al. Enoxacin extends lifespan of C. elegans by inhibiting miR-34-5p and promoting mitohormesis. Redox Biol. 2018, 18, 84–92. [Google Scholar] [CrossRef] [PubMed]
- Young, D.D.; Connelly, C.M.; Grohmann, C.; Deiters, A. Small molecule modifiers of microRNA miR-122 function for the treatment of hepatitis C virus infection and hepatocellular carcinoma. J. Am. Chem. Soc. 2010, 132, 7976–7981. [Google Scholar] [CrossRef]
- Valianatos, G.; Valcikova, B.; Growkova, K.; Verlande, A.; Mlcochova, J.; Radova, L.; Stetkova, M.; Vyhnakova, M.; Slaby, O.; Uldrijan, S. A small molecule drug promoting miRNA processing induces alternative splicing of MdmX transcript and rescues p53 activity in human cancer cells overexpressing MdmX protein. PLoS ONE 2017, 12, e0185801. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.-W.; Noland, C.; Siridechadilok, B.; Taylor, D.W.; Ma, E.; Felderer, K.; Doudna, J.A.; Nogales, E. Structural insights into RNA processing by the human RISC-loading complex. Nat. Struct. Mol. Biol. 2009, 16, 1148–1153. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.Y.; Doudna, J.A. TRBP alters human precursor microRNA processing in vitro. RNA 2012, 18, 2012–2019. [Google Scholar] [CrossRef] [PubMed]
- Melo, S.; Villanueva, A.; Moutinho, C.; Davalos, V.; Spizzo, R.; Ivan, C.; Rossi, S.; Setien, F.; Casanovas, O.; Esteller, M.; et al. Small molecule enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2-mediated microRNA processing. Proc. Natl. Acad. Sci. USA 2011, 108, 4394–4399. [Google Scholar] [CrossRef] [PubMed]
- Quenelle, D.C.; Keith, K.A.; Dunleavy, K.E.; Taylor, B.A.; Bowdon, B.J.; Brazier, A.D.; Mullon, C.J.-P.; Harris, R.E.; Allen, L.B. Evaluation of anti-AIDS drugs in conventional mice implanted with a permeable membrane device containing human T cells infected with HIV. Antivir. Res. 1997, 35, 123–129. [Google Scholar] [CrossRef]
- Gyuris, A.; Vajda, G.; Földes, I. Establishment of an MT4 cell line persistently producing infective HIV-1 particles. Acta Microbiol. Hung. 1992, 39, 271–279. [Google Scholar]
- Landgraf, P.; Rusu, M.; Sheridan, R.; Sewer, A.; Iovino, N.; Aravin, A.; Pfeffer, S.; Rice, A.; Kamphorst, A.O.; Tuschl, T.; et al. A mammalian microRNA expression atlas based on small RNA library sequencing. Cell 2007, 129, 1401–1414. [Google Scholar] [CrossRef]
- Alvarez-Saavedra, M.; Antoun, G.; Yanagiya, A.; Oliva-Hernandez, R.; Cornejo-Palma, D.; Perez-Iratxeta, C.; Sonenberg, N.; Cheng, H.-Y.M. miRNA-132 orchestrates chromatin remodeling and translational control of the circadian clock. Hum. Mol. Genet. 2011, 20, 731–751. [Google Scholar] [CrossRef] [PubMed]
- Leuschner, P.J.; Martinez, J. In vitro analysis of microRNA processing using recombinant Dicer and cytoplasmic extracts of HeLa cells. Methods 2007, 43, 105–109. [Google Scholar] [CrossRef]
- Schlösser, V.; Hall, J. Labeling microRNA precursors for Dicer assays. Anal. Biochem. 2019, 579, 35–37. [Google Scholar] [CrossRef]
- Smola, M.J.; Rice, G.M.; Busan, S.; Siegfried, N.A.; Weeks, K.M. Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis. Nat. Protoc. 2015, 10, 1643–1669. [Google Scholar] [CrossRef] [PubMed]
- Reuter, J.S.; Mathews, D.H. RNAstructure: Software for RNA secondary structure prediction and analysis. BMC Bioinform. 2010, 11, 129. [Google Scholar] [CrossRef]
- Kingston, E.R.; Bartel, D.P. Global analyses of the dynamics of mammalian microRNA metabolism. Genome Res. 2019, 29, 1777–1790. [Google Scholar] [CrossRef]
- Marzi, M.J.; Ghini, F.; Cerruti, B.; de Pretis, S.; Bonetti, P.; Giacomelli, C.; Gorski, M.M.; Kress, T.; Pelizzola, M.; Muller, H.; et al. Degradation dynamics of microRNAs revealed by a novel pulse-chase approach. Genome Res. 2016, 26, 554–565. [Google Scholar] [CrossRef]
- Campbell, E.M.; Hope, T.J. HIV-1 capsid: The multifaceted key player in HIV-1 infection. Nat. Rev. Microbiol. 2015, 13, 471–483. [Google Scholar] [CrossRef] [PubMed]
- Barré-Sinoussi, F.; Ross, A.L.; Delfraissy, J.F. Past, present and future: 30 years of HIV research. Nat. Rev. Microbiol. 2013, 11, 877–883. [Google Scholar] [CrossRef]
- Zhu, J.; Davoli, T.; Perriera, J.M.; Chin, C.R.; Gaiha, G.D.; John, S.P.; Sigiollot, F.D.; Gao, G.; Xu, Q.; Qu, H.; et al. Comprehensive identification of host modulators of HIV-1 replication using multiple orthologous RNAi reagents. Cell Rep. 2014, 9, 752–766. [Google Scholar] [CrossRef] [PubMed]
- Freed, E.O. HIV-1 assembly, release and maturation. Nat. Rev. Microbiol. 2015, 13, 484–496. [Google Scholar] [CrossRef] [PubMed]
- Soliman, M.; Srikrishna, G.; Balagopal, A. Mechanisms of HIV-1 Control. Curr. HIV/AIDS Rep. 2017, 14, 101–109. [Google Scholar] [CrossRef]
- Imig, J.; Brunschweiger, A.; Brümmer, A.; Guennewig, B.; Mittal, N.; Kishore, S.; Tsikrika, P.; Zavolan, M.; Gerber, A.P.; Hall, J. miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction. Nat. Chem. Biol. 2015, 11, 107–114. [Google Scholar] [CrossRef] [PubMed]
- Rahimian, P.; He, J.J. HIV-1 Tat-shortened neurite outgrowth through regulation of microRNA-132 and its target gene expression. J. Neuroinflammation 2016, 13, 247. [Google Scholar] [CrossRef]
- Harada, S.; Koyanagi, Y.; Yamamoto, N. Infection of human T-lymphotropic virus type-I (HTLV-I)-bearing MT-4 cells with HTLV-III (AIDS virus): Chronological studies of early events. Virology 1985, 146, 272–281. [Google Scholar] [CrossRef] [PubMed]
- Abe, M.; Suzuki, H.; Nishitsuji, H.; Shida, H.; Takaku, H. Interaction of human T-cell lymphotropic virus type I Rex protein with Dicer suppresses RNAi silencing. FEBS Lett. 2010, 584, 4313–4318. [Google Scholar] [CrossRef] [PubMed]
- Wilson, R.C.; Tambe, A.; Kidwell, M.A.; Noland, C.L.; Schneider, C.P.; Doudna, J.A. Dicer-TRBP complex formation ensures accurate mammalian microRNA biogenesis. Mol. Cell 2015, 57, 397–407. [Google Scholar] [CrossRef] [PubMed]
- Felicetti, T.; Cecchetti, V.; Manfroni, G. Modulating microRNA Processing: Enoxacin, the Progenitor of a New Class of Drugs. J. Med. Chem. 2020, 63, 12275–12289. [Google Scholar] [CrossRef]
- Groher, F.; Bofill-Bosch, C.; Schneider, C.; Braun, J.; Jager, S.; Geißler, K.; Hamacher, K.; Suess, B. Riboswitching with ciprofloxacin-development and characterization of a novel RNA regulator. Nucleic Acids Res. 2018, 46, 2121–2132. [Google Scholar] [CrossRef]
- Felicetti, T.; Di Iacovo, N.; Della Fazia, M.A.; Piobbico, D.; Pieroni, S.; Pacetti, M.; Yu, J.; Sun, Y.; Massari, S.; Barreca, M.L.; et al. New anti-ovarian cancer quinolone derivatives acting by modulating microRNA processing machinery. RSC Med. Chem. 2025. [Google Scholar] [CrossRef] [PubMed]
- Jałbrzykowska, K.; Chrzanowska, A.; Roszkowski, P.; Struga, M. The New Face of a Well-Known Antibiotic: A Review of the Anticancer Activity of Enoxacin and Its Derivatives. Cancers 2022, 14, 3056. [Google Scholar] [CrossRef] [PubMed]
- Cecchetti, V.; Parolin, C.; Moro, S.; Pecere, T.; Filipponi, E.; Calistri, A.; Tabarrini, O.; Gatto, B.; Palumbo, M.; Fravolini, A.; et al. 6-Aminoquinolones as new potential anti-HIV agents. J. Med. Chem. 2000, 43, 3799–3802. [Google Scholar] [CrossRef] [PubMed]
- Parolin, C.; Gatto, B.; Del Vecchio, C.; Pecere, T.; Tramontano, E.; Cecchetti, V.; Fravolini, A.; Masiero, S.; Palumbo, M.; Palù, G. New anti-human immunodeficiency virus type 1 6-aminoquinolones: Mechanism of action. Antimicrob. Agents Chemother. 2003, 47, 889–896. [Google Scholar] [CrossRef] [PubMed]
- Massari, S.; Daelemans, D.; Barreca, M.L.; Knezevich, A.; Sabatini, S.; Cecchetti, V.; Marcello, A.; Pannecouque, C.; Tabarrini, O. A 1,8-naphthyridone derivative targets the HIV-1 Tat-mediated transcription and potently inhibits the HIV-1 replication. J. Med. Chem. 2010, 53, 641–648. [Google Scholar] [CrossRef] [PubMed]
- O’Doherty, U.; Swiggard, W.J.; Malim, M.H. Malim, Human immunodeficiency virus type 1 spinoculation enhances infection through virus binding. J. Virol. 2000, 74, 10074–10080. [Google Scholar] [CrossRef] [PubMed]
- Nara, P.L.; Hatch, W.C.; Dunlop, N.M.; Robey, W.G.; Arthur, L.O.; Gonda, M.A.; Fischinger, P.J. Simple, rapid, quantitative, syncytium-forming microassay for the detection of human immunodeficiency virus neutralizing antibody. AIDS Res. Hum. Retroviruses 1987, 3, 283–302. [Google Scholar] [CrossRef]
- Moore, J.P.; McKeating, J.A.; Weiss, R.A.; Sattentau, Q.J. Dissociation of gp120 from HIV-1 virions induced by soluble CD4. Science 1990, 250, 1139–1142. [Google Scholar] [CrossRef] [PubMed]
- Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
- Tian, S.; Das, R. Primerize-2D: Automated primer design for RNA multidimensional chemical mapping. Bioinformatics 2017, 33, 1405–1406. [Google Scholar] [CrossRef] [PubMed]
- Mortimer, S.A.; Weeks, K.M. A fast-acting reagent for accurate analysis of RNA secondary and tertiary structure by SHAPE chemistry. J. Am. Chem. Soc. 2007, 129, 4144–4145. [Google Scholar] [CrossRef] [PubMed]
- Busan, S.; Weeks, K.M. Accurate detection of chemical modifications in RNA by mutational profiling (MaP) with ShapeMapper 2. RNA 2018, 24, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Meyer, S.M.; Williams, C.C.; Akahori, Y.; Tanaka, T.; Aikawa, H.; Tong, Y.; Childs-Disney, J.L.; Disney, M.D. Small molecule recognition of disease-relevant RNA structures. Chem. Soc. Rev. 2020, 49, 7167–7199. [Google Scholar] [CrossRef] [PubMed]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schlösser, V.; Lightfoot, H.L.; Leemann, C.; Bejoy, A.M.; Tiwari, S.; Schloßhauer, J.L.; Vongrad, V.; Brunschweiger, A.; Hall, J.; Metzner, K.J.; et al. Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-Viral hsa-miR-132 Processing in CEM-SS Cells. Non-Coding RNA 2025, 11, 8. https://doi.org/10.3390/ncrna11010008
Schlösser V, Lightfoot HL, Leemann C, Bejoy AM, Tiwari S, Schloßhauer JL, Vongrad V, Brunschweiger A, Hall J, Metzner KJ, et al. Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-Viral hsa-miR-132 Processing in CEM-SS Cells. Non-Coding RNA. 2025; 11(1):8. https://doi.org/10.3390/ncrna11010008
Chicago/Turabian StyleSchlösser, Verena, Helen Louise Lightfoot, Christine Leemann, Aathma Merin Bejoy, Shashank Tiwari, Jeffrey L. Schloßhauer, Valentina Vongrad, Andreas Brunschweiger, Jonathan Hall, Karin J. Metzner, and et al. 2025. "Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-Viral hsa-miR-132 Processing in CEM-SS Cells" Non-Coding RNA 11, no. 1: 8. https://doi.org/10.3390/ncrna11010008
APA StyleSchlösser, V., Lightfoot, H. L., Leemann, C., Bejoy, A. M., Tiwari, S., Schloßhauer, J. L., Vongrad, V., Brunschweiger, A., Hall, J., Metzner, K. J., & Imig, J. (2025). Anti-HIV-1 Effect of the Fluoroquinolone Enoxacin and Modulation of Pro-Viral hsa-miR-132 Processing in CEM-SS Cells. Non-Coding RNA, 11(1), 8. https://doi.org/10.3390/ncrna11010008