Polydeoxynucleotide-Loaded Visible Light Photo-Crosslinked Gelatin Methacrylate Hydrogel: Approach to Accelerating Cartilage Regeneration
Abstract
1. Introduction
| Gelatin Methacrylate (GelMA) | Chitosan | Polyethlene Glycol (PEG) | Polycaprolactone (PCL) | Polylactic Acid (PLA) | |
|---|---|---|---|---|---|
| Biocompatibility | Excellent; supports cell adhesion and growth | High; promotes cell proliferation | Good; supports cell attachment and growth | Good; supports cell attachment and growth | Good; widely used in medical applications |
| Biodegradability | Biodegradable; rate adjustable by crosslinking | Biodegradable; consistent degradation profile | Biodegradable; rate adjustable by molecular weight | Slowly biodegradable; suitable for long-term applications | Biodegradable; rate adjustable by copolymer composition |
| Gelation Process | UV or visible light-induced crosslinking | Ionic crosslinking or temperature change | Chemical crosslinking or photopolymerization | Thermal processing or solvent casting | Thermal processing or solvent casting |
| Hydrophilic/ Hydrophobic | High water retention capacity | High water retention and good swelling properties | High water retention; non-fouling surface | Lower water retention; hydrophobic | Lower water retention; hydrophobic |
| Potential for Cartilage Regeneration | Promotes chondrogenesis with growth factors | Promotes chondrogenesis, especially in composites | Useful as a hydrogel; often combined with other materials | Excellent for load-bearing scaffolds; supports chondrogenesis | Promotes chondrogenesis; often used in combination with other materials |
| References | [8,27] | [28,29,30] | [31,32,33] | [34,35,36] | [37,38] |
2. Results and Discussion
2.1. GelMA Hydrogel Fabrication and Charaterization
2.2. GelMA Hydrogel Mechanical Properties
2.3. PDRN Release Profile in gelMA Hydrogels
2.4. Cytotoxicity Test of Hydrogels
2.5. Glycosaminoglycan (GAG) Activity
2.6. Evaluation of Cartilage-Specific Genes Expression
2.7. Histology Assessment
3. Conclusions
4. Materials and Methods
4.1. Reagents and Materials
4.2. Synthesis Process of GelMA
4.3. Preparation of PDRN-Loaded gelMA Hydrogel
4.4. Evaluation of the Physicochemical Properties of gelMA Hydrogel
4.4.1. 1H-Nuclear Magnetic Resonance
4.4.2. Determination of Degree of Functionalization of gelMA
4.4.3. Fourier Transform Infrared Spectroscopy (FT-IR)
4.4.4. Morphological Analysis
4.4.5. Water Content Analysis of gelMA Hydrogels
4.4.6. Degradation Studies
4.4.7. Compression Test of gelMA Hydrogels
4.4.8. Release Profile of PDRN
4.5. Evaluation of the Physicochemical Properties of GelMA Hydrogel
4.5.1. Cell Culture
4.5.2. Cytotoxicity Test
4.5.3. Glycosaminoglycan (GAG) Assay
4.5.4. Evaluation of Cartilage-Specific Genes Expression
4.6. In Vivo Cartilage Defect Model and Implantation Hydrogels
4.7. Histological Analysis
4.8. Statistics
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Huey, D.J.; Hu, J.C.; Athanasiou, K.A. Unlike bone, cartilage regeneration remains elusive. Science 2012, 338, 917–921. [Google Scholar] [CrossRef]
- Kilmer, C.E.; Battistoni, C.M.; Cox, A.; Breur, G.J.; Panitch, A.; Liu, J.C. Collagen type I and II blend hydrogel with autologous mesenchymal stem cells as a scaffold for articular cartilage defect repair. ACS Biomater. Sci. Eng. 2020, 6, 3464–3476. [Google Scholar] [CrossRef] [PubMed]
- Krishnan, Y.; Grodzinsky, A.J. Cartilage diseases. Matrix Biol. 2018, 71, 51–69. [Google Scholar] [CrossRef] [PubMed]
- Spahn, G.; Hofmann, G.O.; Klinger, H.M. The effects of arthroscopic joint debridement in the knee osteoarthritis: Results of a meta-analysis. Knee Surg. Sports Traumatol. Arthrosc. 2013, 21, 1553–1561. [Google Scholar] [CrossRef]
- Riedl, M.; Vadalà, G.; Papalia, R.; Denaro, V. Three-dimensional, scaffold-free, autologous chondrocyte transplantation: A systematic review. Orthop. J. Sports Med. 2020, 8, 2325967120951152. [Google Scholar] [CrossRef] [PubMed]
- Han, C.; Li, X.; Tian, X.; Zhao, J.; Zhou, L.; Tan, Y.; Ma, S.; Hu, Y.; Chen, H.; Huang, Y. The effect of distal tibial tuberosity high tibial osteotomy on postoperative patellar height and patellofemoral joint degeneration. J. Orthop. Surg. Res. 2020, 15, 1–9. [Google Scholar] [CrossRef]
- Wu, X.; Liu, S.; Chen, K.; Wang, F.; Feng, C.; Xu, L.; Zhang, D. 3D printed chitosan-gelatine hydrogel coating on titanium alloy surface as biological fixation interface of artificial joint prosthesis. Int. J. Biol. Macromol. 2021, 182, 669–679. [Google Scholar] [CrossRef]
- Zhou, C.; Wang, C.; Xu, K.; Niu, Z.; Zou, S.; Zhang, D.; Qian, Z.; Liao, J.; Xie, J. Hydrogel platform with tunable stiffness based on magnetic nanoparticles cross-linked GelMA for cartilage regeneration and its intrinsic biomechanism. Bioact. Mater. 2023, 25, 615–628. [Google Scholar] [CrossRef]
- Shin, D.Y.; Park, J.-U.; Choi, M.-H.; Kim, S.; Kim, H.-E.; Jeong, S.-H. Polydeoxyribonucleotide-delivering therapeutic hydrogel for diabetic wound healing. Sci. Rep. 2020, 10, 16811. [Google Scholar] [CrossRef] [PubMed]
- Gennero, L.; Denysenko, T.; Calisti, G.F.; Vercelli, A.; Vercelli, C.M.; Amedeo, S.; Mioletti, S.; Parino, E.; Montanaro, M.; Melcarne, A. Protective effects of polydeoxyribonucleotides on cartilage degradation in experimental cultures. Cell Biochem. Funct. 2013, 31, 214–227. [Google Scholar] [CrossRef]
- Baek, A.; Kim, Y.; Lee, J.W.; Lee, S.C.; Cho, S.-R. Effect of polydeoxyribonucleotide on angiogenesis and wound healing in an in vitro model of osteoarthritis. Cell Transplant. 2018, 27, 1623–1633. [Google Scholar] [CrossRef] [PubMed]
- Xiao, D.; Bi, R.; Liu, X.; Mei, J.; Jiang, N.; Zhu, S. Notch signaling regulates MMP-13 expression via Runx2 in chondrocytes. Sci. Rep. 2019, 9, 15596. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Sampson, E.R.; Jin, H.; Li, J.; Ke, Q.H.; Im, H.-J.; Chen, D. MMP13 is a critical target gene during the progression of osteoarthritis. Arthritis Res. Ther. 2013, 15, R5. [Google Scholar] [CrossRef]
- Squadrito, F.; Bitto, A.; Irrera, N.; Pizzino, G.; Pallio, G.; Minutoli, L.; Altavilla, D. Pharmacological activity and clinical use of PDRN. Front. Pharmacol. 2017, 8, 224. [Google Scholar] [CrossRef]
- Ahmed, E.M. Hydrogel: Preparation, characterization, and applications: A review. J. Adv. Res. 2015, 6, 105–121. [Google Scholar] [CrossRef] [PubMed]
- Jeon, H.Y.; Shin, E.Y.; Choi, J.H.; Song, J.E.; Reis, R.L.; Khang, G. Evaluation of saponin loaded gellan gum hydrogel scaffold for cartilage regeneration. Macromol. Res. 2018, 26, 724–729. [Google Scholar] [CrossRef]
- Lee, S.; Choi, J.H.; Park, A.; Rim, M.; Youn, J.; Lee, W.; Song, J.E.; Khang, G. Advanced gellan gum-based glycol chitosan hydrogel for cartilage tissue engineering biomaterial. Int. J. Biol. Macromol. 2020, 158, 452–460. [Google Scholar] [CrossRef]
- Lyu, C.; Cheng, C.; He, Y.; Qiu, L.; He, Z.; Zou, D.; Li, D.; Lu, J. Graphene hydrogel as a porous scaffold for cartilage regeneration. ACS Appl. Mater. Interfaces 2022, 14, 54431–54438. [Google Scholar] [CrossRef] [PubMed]
- Ju, H.J.; Ji, Y.B.; Kim, S.; Yun, H.W.; Kim, J.H.; Min, B.H.; Kim, M.S. Development and In Vivo Assessment of an Injectable Cross-Linked Cartilage Acellular Matrix-PEG Hydrogel Scaffold Derived from Porcine Cartilage for Tissue Engineering. Macromol. Biosci. 2023, 23, 2300029. [Google Scholar] [CrossRef] [PubMed]
- Shahidi, S.; Janmaleki, M.; Riaz, S.; Nezhad, A.S.; Syed, N. A tuned gelatin methacryloyl (GelMA) hydrogel facilitates myelination of dorsal root ganglia neurons in vitro. Mater. Sci. Eng. C 2021, 126, 112131. [Google Scholar] [CrossRef]
- Xiao, S.; Zhao, T.; Wang, J.; Wang, C.; Du, J.; Ying, L.; Lin, J.; Zhang, C.; Hu, W.; Wang, L. Gelatin methacrylate (GelMA)-based hydrogels for cell transplantation: An effective strategy for tissue engineering. Stem Cell Rev. Rep. 2019, 15, 664–679. [Google Scholar] [CrossRef] [PubMed]
- Yue, K.; Trujillo-de Santiago, G.; Alvarez, M.M.; Tamayol, A.; Annabi, N.; Khademhosseini, A. Synthesis, properties, and biomedical applications of gelatin methacryloyl (GelMA) hydrogels. Biomaterials 2015, 73, 254–271. [Google Scholar] [CrossRef] [PubMed]
- Liang, J.; Dijkstra, P.; Poot, A.; Grijpma, D. Hybrid hydrogels based on methacrylate-functionalized gelatin (GelMA) and synthetic polymers. Biomed. Mater. Devices 2023, 1, 191–201. [Google Scholar] [CrossRef]
- Pepelanova, I.; Kruppa, K.; Scheper, T.; Lavrentieva, A. Gelatin-methacryloyl (GelMA) hydrogels with defined degree of functionalization as a versatile toolkit for 3D cell culture and extrusion bioprinting. Bioengineering 2018, 5, 55. [Google Scholar] [CrossRef] [PubMed]
- Sharifi, S.; Sharifi, H.; Akbari, A.; Chodosh, J. Systematic optimization of visible light-induced crosslinking conditions of gelatin methacryloyl (GelMA). Sci. Rep. 2021, 11, 23276. [Google Scholar] [CrossRef]
- Hölzl, K.; Fürsatz, M.; Göcerler, H.; Schädl, B.; Žigon-Branc, S.; Markovic, M.; Gahleitner, C.; Hoorick, J.V.; Van Vlierberghe, S.; Kleiner, A. Gelatin methacryloyl as environment for chondrocytes and cell delivery to superficial cartilage defects. J. Tissue Eng. Regen. Med. 2022, 16, 207–222. [Google Scholar] [CrossRef]
- Machado, I.; Marques, C.F.; Martins, E.; Alves, A.L.; Reis, R.L.; Silva, T.H. Marine gelatin-methacryloyl-based hydrogels as cell templates for cartilage tissue engineering. Polymers 2023, 15, 1674. [Google Scholar] [CrossRef]
- Zhang, R.; Chang, S.J.; Jing, Y.; Wang, L.; Chen, C.-J.; Liu, J.-T. Application of chitosan with different molecular weights in cartilage tissue engineering. Carbohydr. Polym. 2023, 314, 120890. [Google Scholar] [CrossRef] [PubMed]
- Shen, Y.; Xu, Y.; Yi, B.; Wang, X.; Tang, H.; Chen, C.; Zhang, Y. Engineering a highly biomimetic chitosan-based cartilage scaffold by using short fibers and a cartilage-decellularized matrix. Biomacromolecules 2021, 22, 2284–2297. [Google Scholar] [CrossRef]
- Garcia, C.E.G.; Lardy, B.; Bossard, F.; Martínez, F.A.S.; Rinaudo, M. Chitosan based biomaterials for cartilage tissue engineering: Chondrocyte adhesion and proliferation. Food Hydrocoll. Health 2021, 1, 100018. [Google Scholar] [CrossRef]
- Carriero, V.C.; Di Muzio, L.; Petralito, S.; Casadei, M.A.; Paolicelli, P. Cryogel Scaffolds for Tissue-Engineering: Advances and Challenges for Effective Bone and Cartilage Regeneration. Gels 2023, 9, 979. [Google Scholar] [CrossRef] [PubMed]
- Mehrali, M.; Thakur, A.; Pennisi, C.P.; Talebian, S.; Arpanaei, A.; Nikkhah, M.; Dolatshahi-Pirouz, A. Nanoreinforced hydrogels for tissue engineering: Biomaterials that are compatible with load-bearing and electroactive tissues. Adv. Mater. 2017, 29, 1603612. [Google Scholar] [CrossRef]
- Sridhar, B.V.; Brock, J.L.; Silver, J.S.; Leight, J.L.; Randolph, M.A.; Anseth, K.S. Development of a cellularly degradable PEG hydrogel to promote articular cartilage extracellular matrix deposition. Adv. Healthc. Mater. 2015, 4, 702–713. [Google Scholar] [CrossRef] [PubMed]
- Valipour, F.; Valioğlu, F.; Rahbarghazi, R.; Navali, A.M.; Rashidi, M.R.; Davaran, S. Thermosensitive and biodegradable PCL-based hydrogels: Potential scaffolds for cartilage tissue engineering. J. Biomater. Sci. Polym. Ed. 2023, 34, 695–714. [Google Scholar] [CrossRef]
- Pankongadisak, P.; Jaiong, S.; Sirimethawong, Y.; Chuenjitkuntaworn, B.; Supaphol, P.; Suwantong, O. Evaluation of polycaprolactone scaffolds containing a crude Curcuma comosa extract for potential use as cartilage scaffolds. Emergent Mater. 2024, 7, 1605–1617. [Google Scholar] [CrossRef]
- Gruber, S.M.; Murab, S.; Ghosh, P.; Whitlock, P.W.; Lin, C.-Y.J. Direct 3D printing of decellularized matrix embedded composite polycaprolactone scaffolds for cartilage regeneration. Biomater. Adv. 2022, 140, 213052. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.; Premaratne, I.D.; Bernstein, J.L.; Samadi, A.; Lin, A.J.; Toyoda, Y.; Kim, J.; Bonassar, L.J.; Spector, J.A. Three-dimensional-printed external scaffolds mitigate loss of volume and topography in engineered elastic cartilage constructs. Cartilage 2021, 13, 1780S–1789S. [Google Scholar] [CrossRef]
- Dussault, A.; Pitaru, A.A.; Weber, M.H.; Haglund, L.; Rosenzweig, D.H.; Villemure, I. Optimizing design parameters of PLA 3D-printed scaffolds for bone defect repair. Surgeries 2022, 3, 162–174. [Google Scholar] [CrossRef]
- Bryant, S.J.; Nuttelman, C.R.; Anseth, K.S. Cytocompatibility of UV and visible light photoinitiating systems on cultured NIH/3T3 fibroblasts in vitro. J. Biomater. Sci. Polym. Ed. 2000, 11, 439–457. [Google Scholar] [CrossRef] [PubMed]
- Akhavan, O.; Ghaderi, E.; Shirazian, S.A. Near infrared laser stimulation of human neural stem cells into neurons on graphene nanomesh semiconductors. Colloids Surf. B Biointerfaces 2015, 126, 313–321. [Google Scholar] [CrossRef] [PubMed]
- Noirbent, G.; Dumur, F. Recent advances on naphthalic anhydrides and 1,8-naphthalimide-based photoinitiators of polymerization. Eur. Polym. J. 2020, 132, 109702. [Google Scholar] [CrossRef]
- Hong, B.M.; Kim, H.C.; Jeong, J.E.; Park, S.A.; Park, W.H. Visible-light-induced hyaluronate hydrogel for soft tissue fillers. Int. J. Biol. Macromol. 2020, 165, 2834–2844. [Google Scholar] [CrossRef] [PubMed]
- Mahmoud, B.H.; Hexsel, C.L.; Hamzavi, I.H.; Lim, H.W. Effects of visible light on the skin. Photochem. Photobiol. 2008, 84, 450–462. [Google Scholar] [CrossRef] [PubMed]
- Partlow, B.P.; Applegate, M.B.; Omenetto, F.G.; Kaplan, D.L. Dityrosine cross-linking in designing biomaterials. ACS Biomater. Sci. Eng. 2016, 2, 2108–2121. [Google Scholar] [CrossRef]
- Loessner, D.; Meinert, C.; Kaemmerer, E.; Martine, L.C.; Yue, K.; Levett, P.A.; Klein, T.J.; Melchels, F.P.; Khademhosseini, A.; Hutmacher, D.W. Functionalization, preparation and use of cell-laden gelatin methacryloyl–based hydrogels as modular tissue culture platforms. Nat. Protoc. 2016, 11, 727–746. [Google Scholar] [CrossRef]
- Zheng, J.; Zhu, M.; Ferracci, G.; Cho, N.J.; Lee, B.H. Hydrolytic stability of methacrylamide and methacrylate in gelatin methacryloyl and decoupling of gelatin methacrylamide from gelatin methacryloyl through hydrolysis. Macromol. Chem. Phys. 2018, 219, 1800266. [Google Scholar] [CrossRef]
- Hoch, E.; Schuh, C.; Hirth, T.; Tovar, G.E.; Borchers, K. Stiff gelatin hydrogels can be photo-chemically synthesized from low viscous gelatin solutions using molecularly functionalized gelatin with a high degree of methacrylation. J. Mater. Sci. Mater. Med. 2012, 23, 2607–2617. [Google Scholar] [CrossRef] [PubMed]
- Abdul-Monem, M.M.; Kamoun, E.A.; Ahmed, D.M.; El-Fakharany, E.M.; Al-Abbassy, F.H.; Aly, H.M. Light-cured hyaluronic acid composite hydrogels using riboflavin as a photoinitiator for bone regeneration applications. J. Taibah Univ. Med. Sci. 2021, 16, 529–539. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, M.K.; Lee, D.S. Injectable biodegradable hydrogels. Macromol. Biosci. 2010, 10, 563–579. [Google Scholar] [CrossRef] [PubMed]
- Chiu, Y.-C.; Cheng, M.-H.; Engel, H.; Kao, S.-W.; Larson, J.C.; Gupta, S.; Brey, E.M. The role of pore size on vascularization and tissue remodeling in PEG hydrogels. Biomaterials 2011, 32, 6045–6051. [Google Scholar] [CrossRef]
- Park, S.; Kim, S.-I.; Choi, J.-H.; Kim, S.-E.; Choe, S.-H.; Son, Y.; Kang, T.-W.; Song, J.-E.; Khang, G. Evaluation of Silk Fibroin/Gellan Gum Hydrogels with Controlled Molecular Weight through Silk Fibroin Hydrolysis for Tissue Engineering Application. Molecules 2023, 28, 5222. [Google Scholar] [CrossRef]
- Chansoria, P.; Asif, S.; Polkoff, K.; Chung, J.; Piedrahita, J.A.; Shirwaiker, R.A. Characterizing the effects of synergistic thermal and photo-cross-linking during biofabrication on the structural and functional properties of gelatin methacryloyl (GelMA) hydrogels. ACS Biomater. Sci. Eng. 2021, 7, 5175–5188. [Google Scholar] [CrossRef] [PubMed]
- Xue, F.; He, X.; Cai, S.; Nie, J.; Shi, Z.; Wang, X. Synergistic effect of graphene oxide and sodium carboxymethylcellulose on the properties of poly (vinyl alcohol) hydrogels. J. Appl. Polym. Sci. 2019, 136, 47644. [Google Scholar] [CrossRef]
- Paxton, J.Z.; Donnelly, K.; Keatch, R.P.; Baar, K. Engineering the bone–ligament interface using polyethylene glycol diacrylate incorporated with hydroxyapatite. Tissue Eng. Part A 2009, 15, 1201–1209. [Google Scholar] [CrossRef]
- Griffin, D.R.; Archang, M.M.; Kuan, C.-H.; Weaver, W.M.; Weinstein, J.S.; Feng, A.C.; Ruccia, A.; Sideris, E.; Ragkousis, V.; Koh, J. Activating an adaptive immune response from a hydrogel scaffold imparts regenerative wound healing. Nat. Mater. 2021, 20, 560–569. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.; Shih, Y.-R.V.; Hwang, Y.; Wen, C.; Rao, V.; Seo, T.; Varghese, S. Mineralized gelatin methacrylate-based matrices induce osteogenic differentiation of human induced pluripotent stem cells. Acta Biomater. 2014, 10, 4961–4970. [Google Scholar] [CrossRef]
- Li, Q.; Xu, S.; Feng, Q.; Dai, Q.; Yao, L.; Zhang, Y.; Gao, H.; Dong, H.; Chen, D.; Cao, X. 3D printed silk-gelatin hydrogel scaffold with different porous structure and cell seeding strategy for cartilage regeneration. Bioact. Mater. 2021, 6, 3396–3410. [Google Scholar] [CrossRef] [PubMed]
- Miao, T.; Miller, E.J.; McKenzie, C.; Oldinski, R.A. Physically crosslinked polyvinyl alcohol and gelatin interpenetrating polymer network theta-gels for cartilage regeneration. J. Mater. Chem. B 2015, 3, 9242–9249. [Google Scholar] [CrossRef]
- Lee, S.; Choi, J.; Youn, J.; Lee, Y.; Kim, W.; Choe, S.; Song, J.; Reis, R.L.; Khang, G. Development and evaluation of gellan gum/silk fibroin/chondroitin sulfate ternary injectable hydrogel for cartilage tissue engineering. Biomolecules 2021, 11, 1184. [Google Scholar] [CrossRef]
- Moses, M.A.; Sudhalter, J.; Langer, R. Identification of an inhibitor of neovascularization from cartilage. Science 1990, 248, 1408–1410. [Google Scholar] [CrossRef] [PubMed]
- Mapp, P.I.; Walsh, D.A. Mechanisms and targets of angiogenesis and nerve growth in osteoarthritis. Nat. Rev. Rheumatol. 2012, 8, 390–398. [Google Scholar] [CrossRef]
- Reum Son, A.; Kim, D.Y.; Hun Park, S.; Yong Jang, J.; Kim, K.; Ju Kim, B.; Yun Yin, X.; Ho Kim, J.; Hyun Min, B.; Keun Han, D. Direct chemotherapeutic dual drug delivery through intra-articular injection for synergistic enhancement of rheumatoid arthritis treatment. Sci. Rep. 2015, 5, 14713. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Gao, H.; Wang, Q.; Liu, S. Enhancing the Toughness of PAA/LCNF/SA Hydrogel through Double-Network Crosslinking for Strain Sensor Application. Polymers 2023, 16, 102. [Google Scholar] [CrossRef] [PubMed]









| Gene | Forward (F) and Reverse (R) Primer Sequence (5′→3′) | |
|---|---|---|
| GAPDH | F | CGACTTCAACAGCGACACTCAC |
| R | CCCTGTTGCTGTAGCCAAATTC | |
| COL2 | F | GCCACTGGATTCCCTGGAGCT |
| R | TCTTGCTGCTCCACCAGTTC | |
| AGG | F | GCCACTGGATTCCCTGGAGCT |
| R | TCTGCAGCAGTTGATTCTGATT | |
| SOX9 | F | ACGGAGCAGACGCACATCTC |
| R | CTTCTCGCTCTCGTTCAGAAGT | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.; Son, Y.; Park, J.; Lee, S.; Kim, N.-H.; Jang, S.-N.; Kang, T.-W.; Song, J.-E.; Khang, G. Polydeoxynucleotide-Loaded Visible Light Photo-Crosslinked Gelatin Methacrylate Hydrogel: Approach to Accelerating Cartilage Regeneration. Gels 2025, 11, 42. https://doi.org/10.3390/gels11010042
Park S, Son Y, Park J, Lee S, Kim N-H, Jang S-N, Kang T-W, Song J-E, Khang G. Polydeoxynucleotide-Loaded Visible Light Photo-Crosslinked Gelatin Methacrylate Hydrogel: Approach to Accelerating Cartilage Regeneration. Gels. 2025; 11(1):42. https://doi.org/10.3390/gels11010042
Chicago/Turabian StylePark, Sunjae, Youngjun Son, Jonggyu Park, Soyoon Lee, Na-Hyeon Kim, Se-Na Jang, Tae-Woong Kang, Jeong-Eun Song, and Gilson Khang. 2025. "Polydeoxynucleotide-Loaded Visible Light Photo-Crosslinked Gelatin Methacrylate Hydrogel: Approach to Accelerating Cartilage Regeneration" Gels 11, no. 1: 42. https://doi.org/10.3390/gels11010042
APA StylePark, S., Son, Y., Park, J., Lee, S., Kim, N.-H., Jang, S.-N., Kang, T.-W., Song, J.-E., & Khang, G. (2025). Polydeoxynucleotide-Loaded Visible Light Photo-Crosslinked Gelatin Methacrylate Hydrogel: Approach to Accelerating Cartilage Regeneration. Gels, 11(1), 42. https://doi.org/10.3390/gels11010042

