Nucleic Acid-Based Detection of Pythium insidiosum: A Systematic Review
Abstract
1. Introduction
2. Methods
2.1. Study Search and Selection
2.2. Data Extraction
3. Results and Discussion
3.1. Study Recruitment
3.2. Classification, Principles, and Applications of P. insidiosum-Detecting NATs
3.2.1. Non-Amplification Technology: Nucleic Acid Hybridization
3.2.2. Nucleic Acid Amplification Technology
PCR-Based Techniques
- (1)
- Sequence homology analysis
- (2)
- Conventional PCR
- (3)
- Nested PCR

- (4)
- Multiplex PCR (m-PCR)
- (5)
- Real-time or quantitative PCR (qPCR)
Isothermal Amplification
- (1)
- Helicase-dependent amplification (HDA)
- (2)
- Loop-mediated isothermal amplification (LAMP)
Next-Generation Sequencing (NGS)
3.3. Advantages and Limitations of NATs for P. insidiosum Detection
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Gaastra, W.; Lipman, L.J.; de Cock, A.W.; Exel, T.K.; Pegge, R.B.; Scheurwater, J.; Vilela, R.; Mendoza, L. Pythium insidiosum: An overview. Vet. Microbiol. 2010, 146, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Krajaejun, T.; Sathapatayavongs, B.; Pracharktam, R.; Nitiyanant, P.; Leelachaikul, P.; Wanachiwanawin, W.; Chaiprasert, A.; Assanasen, P.; Saipetch, M.; Mootsikapun, P.; et al. Clinical and epidemiological analyses of human pythiosis in Thailand. Clin. Infect. Dis. 2006, 43, 569–576. [Google Scholar] [CrossRef] [PubMed]
- Sermsathanasawadi, N.; Praditsuktavorn, B.; Hongku, K.; Wongwanit, C.; Chinsakchai, K.; Ruangsetakit, C.; Hahtapornsawan, S.; Mutirangura, P. Outcomes and factors influencing prognosis in patients with vascular pythiosis. J. Vasc. Surg. 2016, 64, 411–417. [Google Scholar] [CrossRef] [PubMed]
- Permpalung, N.; Worasilchai, N.; Plongla, R.; Upala, S.; Sanguankeo, A.; Paitoonpong, L.; Mendoza, L.; Chindamporn, A. Treatment outcomes of surgery, antifungal therapy and immunotherapy in ocular and vascular human pythiosis: A retrospective study of 18 patients. J. Antimicrob. Chemother. 2015, 70, 1885–1892. [Google Scholar] [CrossRef] [PubMed]
- Chitasombat, M.N.; Jongkhajornpong, P.; Lekhanont, K.; Krajaejun, T. Recent update in diagnosis and treatment of human pythiosis. PeerJ 2020, 8, e8555. [Google Scholar] [CrossRef]
- Krajaejun, T.; Chongtrakool, P.; Angkananukul, K.; Brandhorst, T.T. Effect of temperature on growth of the pathogenic oomycete Pythium insidiosum. Southeast Asian J. Trop. Med. Public Health 2010, 41, 1462–1466. [Google Scholar]
- Thongsri, Y.; Wonglakorn, L.; Chaiprasert, A.; Svobodova, L.; Hamal, P.; Pakarasang, M.; Prariyachatigul, C. Evaluation for the clinical diagnosis of Pythium insidiosum using a single-tube nested PCR. Mycopathologia 2013, 176, 369–376. [Google Scholar] [CrossRef][Green Version]
- Law, J.W.; Ab Mutalib, N.S.; Chan, K.G.; Lee, L.H. Rapid methods for the detection of foodborne bacterial pathogens: Principles, applications, advantages and limitations. Front. Microbiol. 2014, 5, 770. [Google Scholar] [CrossRef]
- Jindayok, T.; Piromsontikorn, S.; Srimuang, S.; Khupulsup, K.; Krajaejun, T. Hemagglutination test for rapid serodiagnosis of human pythiosis. Clin. Vaccine Immunol. 2009, 16, 1047–1051. [Google Scholar] [CrossRef]
- Krajaejun, T.; Imkhieo, S.; Intaramat, A.; Ratanabanangkoon, K. Development of an immunochromatographic test for rapid serodiagnosis of human pythiosis. Clin. Vaccine Immunol. 2009, 16, 506–509. [Google Scholar] [CrossRef]
- Xihong, Z.; Chii-Wann, L.; Jun, W. Advances in Rapid Detection Methods for Foodborne Pathogens. J. Microbiol. Biotechnol. 2014, 24, 297–312. [Google Scholar] [CrossRef]
- Miraglia, B.M.; Mendoza, L.; Rammohan, R.; Vilela, L.; Vilela, C.; Vilela, G.; Huebner, M.; Mani, R.; Vilela, R. Pythium insidiosum complex hides a cryptic novel species: Pythium periculosum. Fungal Biol. 2022, 126, 366–374. [Google Scholar] [CrossRef] [PubMed]
- Page, M.J.; McKenzie, J.E.; Bossuyt, P.M.; Boutron, I.; Hoffmann, T.C.; Mulrow, C.D.; Shamseer, L.; Tetzlaff, J.M.; Akl, E.A.; Brennan, S.E.; et al. The PRISMA 2020 statement: An updated guideline for reporting systematic reviews. BMJ 2021, 372, n71. [Google Scholar] [CrossRef]
- Mothershed, E.A.; Whitney, A.M. Nucleic acid-based methods for the detection of bacterial pathogens: Present and future considerations for the clinical laboratory. Clin. Chim. Acta 2006, 363, 206–220. [Google Scholar] [CrossRef]
- Monis, P.T.; Giglio, S. Nucleic acid amplification-based techniques for pathogen detection and identification. Infect. Genet. Evol. 2006, 6, 2–12. [Google Scholar] [CrossRef]
- Botton, S.A.; Pereira, D.I.; Costa, M.M.; Azevedo, M.I.; Argenta, J.S.; Jesus, F.P.; Alves, S.H.; Santurio, J.M. Identification of Pythium insidiosum by nested PCR in cutaneous lesions of Brazilian horses and rabbits. Curr. Microbiol. 2011, 62, 1225–1229. [Google Scholar] [CrossRef]
- Grooters, A.M.; Gee, M.K. Development of a nested polymerase chain reaction assay for the detection and identification of Pythium insidiosum. J. Vet. Intern. Med. 2002, 16, 147–152. [Google Scholar] [CrossRef] [PubMed]
- Rivierre, C.; Laprie, C.; Guiard-Marigny, O.; Bergeaud, P.; Berthelemy, M.; Guillot, J. Pythiosis in Africa. Emerg. Infect. Dis. 2005, 11, 479–481. [Google Scholar] [CrossRef]
- Rujirawat, T.; Sridapan, T.; Lohnoo, T.; Yingyong, W.; Kumsang, Y.; Sae-Chew, P.; Tonpitak, W.; Krajaejun, T. Single nucleotide polymorphism-based multiplex PCR for identification and genotyping of the oomycete Pythium insidiosum from humans, animals and the environment. Infect. Genet. Evol. 2017, 54, 429–436. [Google Scholar] [CrossRef]
- Salipante, S.J.; Hoogestraat, D.R.; SenGupta, D.J.; Murphey, D.; Panayides, K.; Hamilton, E.; Castañeda-Sánchez, I.; Kennedy, J.; Monsaas, P.W.; Mendoza, L.; et al. Molecular diagnosis of subcutaneous Pythium insidiosum infection by use of PCR screening and DNA sequencing. J. Clin. Microbiol. 2012, 50, 1480–1483. [Google Scholar] [CrossRef]
- Sharma, S.; Balne, P.K.; Motukupally, S.R.; Das, S.; Garg, P.; Sahu, S.K.; Arunasri, K.; Manjulatha, K.; Mishra, D.K.; Shivaji, S. Pythium insidiosum keratitis: Clinical profile and role of DNA sequencing and zoospore formation in diagnosis. Cornea 2015, 34, 438–442. [Google Scholar] [CrossRef] [PubMed]
- Vanittanakom, N.; Szekely, J.; Khanthawong, S.; Sawutdeechaikul, P.; Vanittanakom, P.; Fisher, M.C. Molecular detection of Pythium insidiosum from soil in Thai agricultural areas. Int. J. Med. Microbiol. 2014, 304, 321–326. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Znajda, N.R.; Grooters, A.M.; Marsella, R. PCR-based detection of Pythium and Lagendium DNA in frozen and ethanol-fixed animal tissues. Vet. Dermatol. 2002, 13, 187–194. [Google Scholar] [CrossRef]
- Tartor, Y.H.; Hamad, M.H.; Abouzeid, N.Z.; El-Belkemy, F.A. Equine pythiosis in Egypt: Clinicopathological findings, detection, identification and genotyping of Pythium insidiosum. Vet. Dermatol. 2020, 31, 298-e73. [Google Scholar] [CrossRef]
- Weiblen, C.; Azevedo, M.I.D.; Ianiski, L.B.; Stibbe, P.C.; Pereira, D.I.B.; Zanette, R.A.; Sangioni, L.A.; Rivero, R.; Santurio, J.M.; Botton, S.D.A. Genotyping of South American clinical isolates of Pythium insidiosum based on single nucleotide polymorphism-based multiplex PCR. Ciência Rural 2019, 49. [Google Scholar] [CrossRef]
- Mar Htun, Z.; Laikul, A.; Pathomsakulwong, W.; Yurayart, C.; Lohnoo, T.; Yingyong, W.; Kumsang, Y.; Payattikul, P.; Sae-Chew, P.; Rujirawat, T.; et al. Identification and Biotyping of Pythium insidiosum Isolated from Urban and Rural Areas of Thailand by Multiplex PCR, DNA Barcode, and Proteomic Analyses. J. Fungi 2021, 7, 242. [Google Scholar] [CrossRef]
- Konradt, G.; Bassuino, D.M.; Bianchi, M.V.; Castro, L.; Caprioli, R.A.; Pavarini, S.P.; Santurio, J.M.; Azevedo, M.I.; Jesus, F.P.; Driemeier, D. Cutaneous Pythiosis in calves: An epidemiologic, pathologic, serologic and molecular characterization. Med. Mycol. Case Rep. 2016, 14, 24–26. [Google Scholar] [CrossRef]
- Supabandhu, J.; Fisher, M.C.; Mendoza, L.; Vanittanakom, N. Isolation and identification of the human pathogen Pythium insidiosum from environmental samples collected in Thai agricultural areas. Med. Mycol. 2008, 46, 41–52. [Google Scholar] [CrossRef]
- Rakeman, J.L.; Bui, U.; Lafe, K.; Chen, Y.C.; Honeycutt, R.J.; Cookson, B.T. Multilocus DNA sequence comparisons rapidly identify pathogenic molds. J. Clin. Microbiol. 2005, 43, 3324–3333. [Google Scholar] [CrossRef]
- Tarai, B.; Gupta, A.; Ray, P.; Shivaprakash, M.R.; Chakrabarti, A. Polymerase chain reaction for early diagnosis of post-operative fungal endophthalmitis. Indian J. Med. Res. 2006, 123, 671–678. [Google Scholar] [PubMed]
- Elshafie, N.O.; Hanlon, J.; Malkawi, M.; Sayedahmed, E.E.; Guptill, L.F.; Jones-Hall, Y.L.; Santos, A.P. Nested PCR Detection of Pythium sp. from Formalin-Fixed, Paraffin-Embedded Canine Tissue Sections. Vet Sci 2022, 9, 444. [Google Scholar] [CrossRef] [PubMed]
- Muñoz-Cadavid, C.; Rudd, S.; Zaki, S.R.; Patel, M.; Moser, S.A.; Brandt, M.E.; Gómez, B.L. Improving molecular detection of fungal DNA in formalin-fixed paraffin-embedded tissues: Comparison of five tissue DNA extraction methods using panfungal PCR. J. Clin. Microbiol. 2010, 48, 2147–2153. [Google Scholar] [CrossRef] [PubMed]
- Bosco Sde, M.; Reis, G.M.; Theodoro, R.C.; Macoris, S.A.; Marques, S.A.; Macoris Dda, G.; Bagagli, E. Morphological and molecular characterization of an equine isolate of Pythium insidiosum and comparison with the first human isolate from the same geographic region. Med. Mycol. 2008, 46, 557–565. [Google Scholar] [CrossRef] [PubMed]
- Kulandai, L.T.; Lakshmipathy, D.; Sargunam, J. Novel Duplex Polymerase Chain Reaction for the Rapid Detection of Pythium insidiosum Directly from Corneal Specimens of Patients with Ocular Pythiosis. Cornea 2020, 39, 775–778. [Google Scholar] [CrossRef] [PubMed]
- Vanittanakom, N.; Supabandhu, J.; Khamwan, C.; Praparattanapan, J.; Thirach, S.; Prasertwitayakij, N.; Louthrenoo, W.; Chiewchanvit, S.; Tananuvat, N. Identification of emerging human-pathogenic Pythium insidiosum by serological and molecular assay-based methods. J. Clin. Microbiol. 2004, 42, 3970–3974. [Google Scholar] [CrossRef]
- Badenoch, P.R.; Coster, D.J.; Wetherall, B.L.; Brettig, H.T.; Rozenbilds, M.A.; Drenth, A.; Wagels, G. Pythium insidiosum keratitis confirmed by DNA sequence analysis. Br. J. Ophthalmol. 2001, 85, 502–503. [Google Scholar] [CrossRef]
- Crawford, A.R.; Bassam, B.J.; Drenth, A.; Maclean, D.J.; Irwin, J.A.G. Evolutionary relationships among Phytophthora species deduced from rDNA sequence analysis. Mycol. Res. 1996, 100, 437–443. [Google Scholar] [CrossRef]
- Htun, Z.M.; Rotchanapreeda, T.; Rujirawat, T.; Lohnoo, T.; Yingyong, W.; Kumsang, Y.; Sae-Chew, P.; Payattikul, P.; Yurayart, C.; Limsivilai, O.; et al. Loop-mediated Isothermal Amplification (LAMP) for Identification of Pythium insidiosum. Int. J. Infect. Dis. 2020, 101, 149–159. [Google Scholar] [CrossRef]
- Kosrirukvongs, P.; Chaiprasert, A.; Canyuk, C.; Wanachiwanawin, W. Comparison of nested PCR and culture identification of Pythium insidiosum in patients with Pythium keratitis. J. Med. Assoc. Thail. 2016, 99, 1033–1038. [Google Scholar]
- Kosrirukvongs, P.; Chaiprasert, A.; Uiprasertkul, M.; Chongcharoen, M.; Banyong, R.; Krajaejun, T.; Wanachiwanawin, W. Evaluation of nested pcr technique for detection of Pythium insidiosum in pathological specimens from patients with suspected fungal keratitis. Southeast Asian J. Trop. Med. Public Health 2014, 45, 167. [Google Scholar] [PubMed]
- Reis, J.L., Jr.; de Carvalho, E.C.; Nogueira, R.H.; Lemos, L.S.; Mendoza, L. Disseminated pythiosis in three horses. Vet. Microbiol. 2003, 96, 289–295. [Google Scholar] [CrossRef]
- Mendoza, L.; Arias, M.; Colmenarez, V.; Perazzo, Y. Intestinal canine pythiosis in Venezuela confirmed by serological and sequencing analysis. Mycopathologia 2005, 159, 219–222. [Google Scholar] [CrossRef] [PubMed]
- Robideau, G.P.; de Cock, A.W.; Coffey, M.D.; Voglmayr, H.; Brouwer, H.; Bala, K.; Chitty, D.W.; Désaulniers, N.; Eggertson, Q.A.; Gachon, C.M.; et al. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Mol. Ecol. Resour. 2011, 11, 1002–1011. [Google Scholar] [CrossRef] [PubMed]
- Worasilchai, N.; Chaumpluk, P.; Chakrabarti, A.; Chindamporn, A. Differential diagnosis for pythiosis using thermophilic helicase DNA amplification and restriction fragment length polymorphism (tHDA-RFLP). Med. Mycol. 2018, 56, 216–224. [Google Scholar] [CrossRef] [PubMed]
- Worasilchai, N.; Permpalung, N.; Chindamporn, A. High-resolution melting analysis: A novel approach for clade differentiation in Pythium insidiosum and pythiosis. Med. Mycol. 2018, 56, 868–876. [Google Scholar] [CrossRef]
- Keeratijarut, A.; Lohnoo, T.; Yingyong, W.; Nampoon, U.; Lerksuthirat, T.; Onpaew, P.; Chongtrakool, P.; Krajaejun, T. PCR amplification of a putative gene for exo-1, 3-β-glucanase to identify the pathogenic oomycete Pythium insidiosum. Asian Biomed. 2014, 8, 637–644. [Google Scholar] [CrossRef]
- Keeratijarut, A.; Lohnoo, T.; Yingyong, W.; Rujirawat, T.; Srichunrusami, C.; Onpeaw, P.; Chongtrakool, P.; Brandhorst, T.T.; Krajaejun, T. Detection of the oomycete Pythium insidiosum by real-time PCR targeting the gene coding for exo-1,3-β-glucanase. J. Med. Microbiol. 2015, 64, 971–977. [Google Scholar] [CrossRef]
- Plongla, R.; Miller, M.B. Chapter 12—Molecular Testing for Diseases Associated with Bacterial Infections. In Diagnostic Molecular Pathology; Coleman, W.B., Tsongalis, G.J., Eds.; Academic Press: Cambridge, MA, USA, 2017; pp. 139–150. [Google Scholar]
- Thies, J.E. Chapter 6—Molecular Approaches to Studying the Soil Biota. In Soil Microbiology, Ecology and Biochemistry, 4th ed.; Paul, E.A., Ed.; Academic Press: Boston, MA, USA, 2015; pp. 151–185. [Google Scholar]
- Thies, J.E. 4—Molecular Methods for Studying Soil Ecology. In Soil Microbiology, Ecology and Biochemistry, 3rd ed.; Paul, E.A., Ed.; Academic Press: San Diego, CA, USA, 2007; pp. 85–118. [Google Scholar]
- Bhagavan, N.V.; Ha, C.-E. Chapter 21—Structure and Properties of DNA. In Essentials of Medical Biochemistry, 2nd ed.; Bhagavan, N.V., Ha, C.-E., Eds.; Academic Press: San Diego, CA, USA, 2015; pp. 381–400. [Google Scholar]
- Schurko, A.M.; Mendoza, L.; de Cock, A.W.; Bedard, J.E.; Klassen, G.R. Development of a species-specific probe for Pythium insidiosum and the diagnosis of pythiosis. J. Clin. Microbiol. 2004, 42, 2411–2418. [Google Scholar] [CrossRef]
- Hull, R. Chapter 13—Assay, Detection, and Diagnosis of Plant Viruses. In Plant Virology, 5th ed.; Hull, R., Ed.; Academic Press: Boston, MA, USA, 2014; pp. 755–808. [Google Scholar]
- Mullis, K.B. The unusual origin of the polymerase chain reaction. Sci. Am. 1990, 262, 56–61. [Google Scholar] [CrossRef]
- Pearson, W.R. An introduction to sequence similarity (“homology”) searching. Curr. Protoc. Bioinform. 2013, 42, 3.1. [Google Scholar] [CrossRef] [PubMed]
- Green, M.R.; Sambrook, J. Nested Polymerase Chain Reaction (PCR). Cold Spring Harb. Protoc. 2019, 2019, pdb-prot095182. [Google Scholar] [CrossRef] [PubMed]
- Apfalter, P.; Assadian, O.; Blasi, F.; Boman, J.; Gaydos, C.A.; Kundi, M.; Makristathis, A.; Nehr, M.; Rotter, M.L.; Hirschl, A.M. Reliability of nested PCR for detection of Chlamydia pneumoniae DNA in atheromas: Results from a multicenter study applying standardized protocols. J. Clin. Microbiol. 2002, 40, 4428–4434. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Shen, C.-H. Chapter 9—Amplification of Nucleic Acids. In Diagnostic Molecular Biology; Shen, C.-H., Ed.; Academic Press: Cambridge, MA, USA, 2019; pp. 215–247. [Google Scholar]
- Zhang, R.Q.; Li, Z.; Li, G.X.; Tie, Y.Q.; Li, X.N.; Gao, Y.; Duan, Q.X.; Wang, L.; Zhao, L.; Fan, G.H.; et al. A highly sensitive one-tube nested quantitative real-time PCR assay for specific detection of Bordetella pertussis using the LNA technique. Int. J. Infect. Dis. 2020, 93, 224–230. [Google Scholar] [CrossRef]
- Elnifro, E.M.; Ashshi, A.M.; Cooper, R.J.; Klapper, P.E. Multiplex PCR: Optimization and application in diagnostic virology. Clin. Microbiol. Rev. 2000, 13, 559–570. [Google Scholar] [CrossRef]
- Oliveira, B.B.; Veigas, B.; Baptista, P.V. Isothermal amplification of nucleic acids: The race for the next “gold standard”. Front. Sens. 2021, 2, 752600. [Google Scholar] [CrossRef]
- Zanoli, L.M.; Spoto, G. Isothermal amplification methods for the detection of nucleic acids in microfluidic devices. Biosensors 2013, 3, 18–43. [Google Scholar] [CrossRef]
- Vincent, M.; Xu, Y.; Kong, H. Helicase-dependent isothermal DNA amplification. EMBO Rep. 2004, 5, 795–800. [Google Scholar] [CrossRef]
- Barreda-García, S.; Miranda-Castro, R.; de-Los-Santos-Álvarez, N.; Miranda-Ordieres, A.J.; Lobo-Castañón, M.J. Helicase-dependent isothermal amplification: A novel tool in the development of molecular-based analytical systems for rapid pathogen detection. Anal. Bioanal. Chem. 2018, 410, 679–693. [Google Scholar] [CrossRef]
- Jeong, Y.J.; Park, K.; Kim, D.E. Isothermal DNA amplification in vitro: The helicase-dependent amplification system. Cell. Mol. Life Sci. 2009, 66, 3325–3336. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [PubMed]
- Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef] [PubMed]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef] [PubMed]
- Hasman, H.; Saputra, D.; Sicheritz-Ponten, T.; Lund, O.; Svendsen, C.A.; Frimodt-Møller, N.; Aarestrup, F.M. Rapid whole-genome sequencing for detection and characterization of microorganisms directly from clinical samples. J. Clin. Microbiol. 2014, 52, 139–146. [Google Scholar] [CrossRef]
- Ferone, M.; Gowen, A.; Fanning, S.; Scannell, A.G.M. Microbial detection and identification methods: Bench top assays to omics approaches. Compr. Rev. Food Sci. Food Saf. 2020, 19, 3106–3129. [Google Scholar] [CrossRef]
- Gilchrist, C.A.; Turner, S.D.; Riley, M.F.; Petri, W.A., Jr.; Hewlett, E.L. Whole-genome sequencing in outbreak analysis. Clin. Microbiol. Rev. 2015, 28, 541–563. [Google Scholar] [CrossRef]
- Ascunce, M.S.; Huguet-Tapia, J.C.; Braun, E.L.; Ortiz-Urquiza, A.; Keyhani, N.O.; Goss, E.M. Whole genome sequence of the emerging oomycete pathogen Pythium insidiosum strain CDC-B5653 isolated from an infected human in the USA. Genom. Data 2016, 7, 60–61. [Google Scholar] [CrossRef]
- Kittichotirat, W.; Patumcharoenpol, P.; Rujirawat, T.; Lohnoo, T.; Yingyong, W.; Krajaejun, T. Draft genome and sequence variant data of the oomycete Pythium insidiosum strain Pi45 from the phylogenetically-distinct Clade-III. Data Brief 2017, 15, 896–900. [Google Scholar] [CrossRef]
- Krajaejun, T.; Kittichotirat, W.; Patumcharoenpol, P.; Rujirawat, T.; Lohnoo, T.; Yingyong, W. Data on whole genome sequencing of the oomycete Pythium insidiosum strain CBS 101555 from a horse with pythiosis in Brazil. BMC Res. Notes 2018, 11, 880. [Google Scholar] [CrossRef]
- Krajaejun, T.; Kittichotirat, W.; Patumcharoenpol, P.; Rujirawat, T.; Lohnoo, T.; Yingyong, W. Genome data of four Pythium insidiosum strains from the phylogenetically-distinct clades I., II, and III. BMC Res. Notes 2021, 14, 197. [Google Scholar] [CrossRef]
- Patumcharoenpol, P.; Rujirawat, T.; Lohnoo, T.; Yingyong, W.; Vanittanakom, N.; Kittichotirat, W.; Krajaejun, T. Draft genome sequences of the oomycete Pythium insidiosum strain CBS 573.85 from a horse with pythiosis and strain CR02 from the environment. Data Brief 2018, 16, 47–50. [Google Scholar] [CrossRef] [PubMed]
- Rujirawat, T.; Patumcharoenpol, P.; Lohnoo, T.; Yingyong, W.; Lerksuthirat, T.; Tangphatsornruang, S.; Suriyaphol, P.; Grenville-Briggs, L.J.; Garg, G.; Kittichotirat, W.; et al. Draft Genome Sequence of the Pathogenic Oomycete Pythium insidiosum Strain Pi-S, Isolated from a Patient with Pythiosis. Genome Announc. 2015, 3, e00574-15. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Zhou, F.; Huang, J.; Liu, X.; Xu, H.; Liang, J.; Wang, J.; Chen, J.; Liu, L.; Li, Y.; et al. Severe skin and subcutaneous pythiosis in China: Metagenomic identification and characterization of Pythium insidiosum. Front. Microbiol. 2022, 13, 1002460. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.F.; Zhang, C.Y.; Wang, Y.Y.; Chen, W. Application of reverse dot blot hybridization to simultaneous detection and identification of harmful algae. Environ. Sci. Pollut. Res. Int. 2015, 22, 10516–10528. [Google Scholar] [CrossRef] [PubMed]
- Lévesque, C.A.; Harlton, C.E.; de Cock, A.W. Identification of some oomycetes by reverse dot blot hybridization. Phytopathology 1998, 88, 213–222. [Google Scholar] [CrossRef]
- Willcocks, M.M.; Carter, M.J.; Silcock, J.G.; Madeley, C.R. A dot-blot hybridization procedure for the detection of astrovirus in stool samples. Epidemiol. Infect. 1991, 107, 405–410. [Google Scholar] [CrossRef][Green Version]
- Murray, P.R.; Baron, E.J. Manual of Clinical Microbiology, 8th ed.; ASM Press: Washington, DC, USA, 2003. [Google Scholar]
- Garibyan, L.; Avashia, N. Polymerase chain reaction. J. Investig. Dermatol. 2013, 133, 1–4. [Google Scholar] [CrossRef]
- Liu, H.Y.; Hopping, G.C.; Vaidyanathan, U.; Ronquillo, Y.C.; Hoopes, P.C.; Moshirfar, M. Polymerase Chain Reaction and Its Application in the Diagnosis of Infectious Keratitis. Med. Hypothesis Discov. Innov. Ophthalmol. 2019, 8, 152–155. [Google Scholar]
- Soroka, M.; Wasowicz, B.; Rymaszewska, A. Loop-Mediated Isothermal Amplification (LAMP): The Better Sibling of PCR? Cells 2021, 10, 1931. [Google Scholar] [CrossRef]








| Target Sequence | Primer ID | Primer Sequence (5′–3′ Direction) | References |
|---|---|---|---|
| ITS region | ITS1 | TCCGTAGGTGAACCTGCGG | [16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31] |
| ITS2 | GCTGCGTTCTTCATCGATGC | [17,20,23,30] | |
| ITS2P | GCAGCGTTCTTCATCGATGT | [24] | |
| ITS2R ITS3 | ATAACCAGCGTCCAGT TCG GCATCGATGAAGAACGCAGC | [22] [23,32,33] | |
| ITS4 | TCCTCCGCTTATTGATATGC | [16,18,21,22,23,28,29,31,32,34] | |
| ITS5 | GGAAGTAAAAGTCGTAACAAGG | [23,34] | |
| ITSpy1 | CTGCGGAAGGATCATTACC | [29,35,36] | |
| ITSpy2 | GTCCTCGGAGTATAGATCAG | [29,35,36] | |
| NE Fw | ATGCCTGGAAGTATGCCTGT | [32] | |
| NE Rev | TCACTGCGTTCGAGCATTAC | [32] | |
| TW81 | GCGGATCCGTTTCCGTAGGTGAACCTGC | [37,38] | |
| AB28 | GCGGATCCATATGCTTAAGTTCAGCGGGT | [37,38] | |
| PI1 | TTCGTCGAAGCGGACTGCT | [16,17,22,24] | |
| PI2 | GCCGTACAACCCGAGAGTCATA | [16,17,24] | |
| R1 | CCTCACATTCTGCCATCTCG | [19,25,26,27] | |
| R2 | ATACCGCCAATAGAGGTCAT | [19,25,26,27] | |
| R3 | TTACCCGAAGGCGTCAAAGA | [19,25,26,27] | |
| ITS-F3 | GGCAGAATGTGAGGTGTCTC | [39] | |
| ITS-B3 | GGAAACAACACCCCGTCAG | [39] | |
| ITS-FIP | ACAGATCACTGCGTTCGAGCAT-TTTT-GGAGATAGCACGAGTCCCT | [39] | |
| ITS-BIP | TCAGATTGCTTTGCGCTGGTGG-TTTT-CCGAAGCCTAACATACCGC | [39] | |
| 18S rRNA | CPL6 | GACACAGGGAGGTAGTGACAATAAATA | [7,40,41] |
| CPR8 | CTTGGTAAATGCTTTCGCCT | [7,40,41] | |
| NS1 | GTAGTCATATGCTTGTCTC | [23,37,42,43] | |
| NS2 | GGCTGCTGGCACCAGACTTGC | [23,37] | |
| NS8 | TCCGCAGGTTCACCTACGGA | [23,42,43] | |
| Pin 1 | TGGCTCTTCGAGTCGGGCAA | [35,36] | |
| Pin 2 | GTCGGCATAGTTTATGGTTAAGA | [35,36] | |
| YTL1 | CTTTGAGTGTGTTGCTAGGATG | [7,40,41] | |
| YTR1 | CTGGAATATGAATACCCCCAAC | [7,40,41] | |
| cox1 | OomCoxI-Levup | TCAWCWMGATGGCTTTTTTCAAC | [20,44] |
| OomCoxI-Levlo | CYTCHGGRTGWCCRAAAAACCAAA | [20,44] | |
| cox2 | Cox_Pi_5 | TAATTTGGACTACTATTCCAGC | [45,46] |
| Cox_Pi_6 | GGATCAATGTATTTCATCCATAG | [45,46] | |
| exo1 | Dx3 | GCGAGTTCTGGCTCGACTTTA | [47] |
| Dx4 | ACAAGCGCCAAAAAGTCCCA | [47] | |
| Pr77 | AAGACGTACTACTGGAAG | [48] | |
| Pr78 | CATAAAGTCGAGCCAGAA | [48] |
| Method | Advantages | Limitations | References |
|---|---|---|---|
| Dot-blot hybridization | - Simultaneously detects multiple genes at once - High throughput assay - Does not require DNA separation by electrophoresis | - Provides no information about the amplicon size - Time-consuming and multi-step procedure - Requires expensive reagents | [53,80,81,82] |
| Sequence homology analysis | - Does not require P. insidiosum-specific primers - Is feasible to perform in a general molecular laboratory | - Requires universal fungal primers - Time-consuming and multi-step procedure - Requires expensive equipment and reagents - Requires a highly purified PCR product for sequencing - Requires a DNA-sequencing step | [5,83] |
| Conventional PCR | - Primer’s design is simple - Simple procedure | - Requires expensive equipment and reagents - Requires post-amplification gel electrophoresis - Susceptible to inhibitory substances present in a given test sample | [11,84,85] |
| Nested-PCR | - High detection sensitivity and specificity - Reduces appearance of non-specific products by second-round amplification - Ability to detect a microorganism present in a low quantity | - Requires expensive equipment and reagents - Time-consuming (requiring 2 sequential amplification reactions) - High risk of carry-over contamination - Susceptible to an inhibitory substance present in a test sample | [7,14,57] |
| Multiplex PCR | - Simultaneously detects multiple genes/sequences at once - Ability to genotype P. insidiosum | - Primer design is complex - Requires PCR condition optimizations - Relatively low detection sensitivity - Susceptible to an inhibitory substance present in a test sample | [8,11,61] |
| Real-time PCR | - High detection sensitivity and specificity - Provides a quantitative result - Provides a real-time result during the PCR process - Low chance of carry-over contamination - High throughput assay and short turnaround time - Does not require post-amplification gel electrophoresis | - Requires expensive equipment and reagents - Provides no information about the amplicon size - Detects non-specific PCR products when using a non-specific dye - Susceptible to an inhibitory substance present in a test sample | [8,11,14,15] |
| Helicase-dependent amplification (HDA) | - Does not require a thermocycler - Primer design is simple | - Yields non-specific products from mispriming and primer dimers - Requires expensive reagents - Susceptible to an inhibitory substance present in a test sample | [63,65] |
| Loop-mediated isothermal amplification (LAMP) | - Does not require a thermocycler - High detection specificity - Simple and low-cost procedure - Short assay duration (~30 min) - Direct result readout observable by the naked eye - Tolerant to an inhibitory substance present in a test sample | - Primer design is complex - Prone to carry-over contamination - No information about the amplicon size | [62,69,86] |
| Next-Generation Sequencing (NGS) | - Novel, rapid, and robust method for microbial detection - Does not require formation of hypothesis regarding the most-likely pathogen | - Requires expensive equipment and reagents - Assay is unavailable in many laboratories - Requires experienced personnel and exhaustive bioinformatic analysis | [79] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sridapan, T.; Krajaejun, T. Nucleic Acid-Based Detection of Pythium insidiosum: A Systematic Review. J. Fungi 2023, 9, 27. https://doi.org/10.3390/jof9010027
Sridapan T, Krajaejun T. Nucleic Acid-Based Detection of Pythium insidiosum: A Systematic Review. Journal of Fungi. 2023; 9(1):27. https://doi.org/10.3390/jof9010027
Chicago/Turabian StyleSridapan, Thanawat, and Theerapong Krajaejun. 2023. "Nucleic Acid-Based Detection of Pythium insidiosum: A Systematic Review" Journal of Fungi 9, no. 1: 27. https://doi.org/10.3390/jof9010027
APA StyleSridapan, T., & Krajaejun, T. (2023). Nucleic Acid-Based Detection of Pythium insidiosum: A Systematic Review. Journal of Fungi, 9(1), 27. https://doi.org/10.3390/jof9010027

