The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains
2.2. Preparation of Ammonia Assimilation Bacterial Inoculum
2.3. Growing Oyster Mushrooms on Compost
2.4. Co-Culture of Pleurotus ostreatus and Enterobacter sp. B12 on Plates
2.5. Determination of Ammoniacal Nitrogen and Total Nitrogen
2.6. Enzyme Activity Assay
2.7. Mycelial Reactive Oxygen Species (ROS) Detection
2.8. Quantitative RT-PCR
2.9. Statistical Analysis
3. Results
3.1. Application of Enterobacter sp. B12 in the Cultivation of Oyster Mushrooms with Compost
3.2. Impact of Enterobacter B12 on Mycelial Growth of Pleurotus ostreatus in Ammonia-Rich Medium
3.3. Effect of Enterobacter sp. B12 on the Activities of ROS-Scavenging Enzymes and Ammonia Assimilating Enzymes in the P. ostreatus Mycelia and Mycelia–B12 Co-Culture System
3.4. Effect of Enterobacter sp. B12 on ROS Level in P. ostreatus Mycelia
3.5. Gene Expression in P. ostreatus Mycelia and Enterobacter sp. B12 in Co-Culture
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAOSTAT. Food and Agriculture Organization of the United Nations Statistics Database. Available online: http://www.fao.org/faostat/en/#data (accessed on 12 January 2025).
- Bijla, S. Status of mushroom production: Global and national scenario. Mushroom Res. 2023, 32, 91–98. [Google Scholar] [CrossRef]
- Chang, S.T.; Miles, P.G. Mushroom biology-A new discipline. Mycologist 1992, 6, 64–65. [Google Scholar] [CrossRef]
- Islam, M.K.; Khan, M.M.H.; Islam, M.N. An unrealized manner for poverty alleviation. Mushroom Ind. Dhaka Univ. J. Mark. 2013, 16, 43–56. [Google Scholar]
- Großkopf, T.; Soyer, O.S. Synthetic microbial communities. Curr Opin Microbiol 2014, 18, 72–77. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Liu, H.; Chen, C.; Wang, J.; Han, Y.; Long, Z. Effects of element complexes containing Fe, Zn and Mn on artificial morel’s biological characteristics and soil bacterial community structures. PLoS ONE 2017, 12, e0174618. [Google Scholar] [CrossRef] [PubMed]
- Sbrana, C.; Agnolucci, M.; Bedini, S.; Lepera, A.; Toffanin, A.; Giovannetti, M.; Nuti, M.P. Diversity of culturable bacterial populations associated to Tuber borchii ectomycorrhizas and their activity on T. borchii mycelial growth. FEMS Microbiol. Lett. 2002, 211, 195–201. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Graziosi, S.; Puliga, F.; Iotti, M.; Amicucci, A.; Zambonelli, A. In vitro interactions between Bradyrhizobium spp. and Tuber magnatum mycelium. Environ. Microbiol. Rep. 2024, 16, e13271. [Google Scholar] [CrossRef] [PubMed]
- Iotti, M.; Piattoni, F.; Zambonelli, A. Techniques for host plant inoculation with truffles and other edible ectomycorrhizal mushrooms. In Edible Ectomycorrhizal Mushrooms: Current Knowledge and Future Prospects, Soil Biology; Zambonelli, A., Bonito, G.M., Eds.; Springer: Berlin/Heidelberg, Germany, 2012; pp. 145–161. [Google Scholar]
- Natvig, D.O.; Taylor, J.W.; Tsang, A.; Hutchinson, M.I.; Powell, A.J. Mycothermus thermophilus gen. et comb. nov. A new home for the itinerant thermophile Scytalidium thermophilum (Torula thermophila). Mycologia 2015, 107, 319–327. [Google Scholar] [CrossRef] [PubMed]
- Basotra, N.; Kaur, B.; Di Falco, M.; Tsang, A.; Chadha, B.S. Mycothermus thermophilus (Syn. Scytalidium thermophilum): Repertoire of a diverse array of efficient cellulases and hemicellulases in the secretome revealed. Bioresour. Technol. 2016, 222, 413–421. [Google Scholar] [CrossRef]
- Vieira, F.R.; Pecchia, J.A. An exploration into the bacterial community under different pasteurization conditions during substrate preparation (composting phase II) for Agaricus bisporus cultivation. Microb. Ecol. 2018, 75, 318–330. [Google Scholar] [CrossRef]
- Gao, Y.; Zhang, Q.; Chen, Y.; Yang, Y.; Zhou, C.; Yu, J.; Li, Y.; Qiu, L. Ammonia-assimilating bacteria promote wheat (Triticum aestivum) growth and nitrogen utilization. Microorganisms 2025, 13, 43. [Google Scholar] [CrossRef]
- Cetin, M.; Atila, F. The potential of bioinoculants in enhancing the mushroom productivity. In BIO Web of Conferences; EDP Sciences: Les Ulis, France, 2024; Volume 85, p. 01049. [Google Scholar]
- Hua, Z.; Liu, T.; Han, P.; Zhou, J.; Zhao, Y.; Huang, L.; Yuan, Y. Isolation, genomic characterization, and mushroom growth-promoting effect of the first fungus-derived Rhizobium. Front. Microbiol. 2022, 13, 947687. [Google Scholar] [CrossRef] [PubMed]
- Zarenejad, F.; Yakhchali, B.; Rasooli, I. Evaluation of indigenous potent mushroom growth promoting bacteria (MGPB) on Agaricus bisporus production. World J. Microbiol. Biotechnol. 2012, 28, 99–104. [Google Scholar] [CrossRef] [PubMed]
- Mohammad, A.; Sabaa, A.K. In vitro and in vivo impact of some Pseudomonas spp. on growth and yield of cultivated mushroom (Agaricus bisporus). Egypt. Soc. Exp. Biol. 2015, 11, 163–167. [Google Scholar] [CrossRef]
- Young, L.S.; Chu, J.N.; Hameed, A.; Young, C.C. Cultivable mushroom growth-promoting bacteria and their impact on Agaricus blazei productivity. Pesqui. Agropecuária Bras. 2013, 48, 636–644. [Google Scholar] [CrossRef]
- Kumari, S.; Naraian, R. Enhanced growth and yield of oyster mushroom by growth-promoting bacteria Glutamicibacter arilaitensis MRC119. J. Basic Microbiol. 2021, 61, 45–54. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Qiu, C.; Huang, T.; Zhou, W.; Qi, Y.; Gao, Y.; Shen, J.; Qiu, L. Effect of 1-aminocyclopropane-1-carboxylic acid deaminase producing bacteria on the hyphal growth and primordium initiation of Agaricus bisporus. Fungal Ecol. 2013, 6, 110–118. [Google Scholar] [CrossRef]
- Zhang, C.; Zhang, G.; Wen, Y.; Li, T.; Gao, Y.; Meng, F.; Qiu, L.; Ai, Y. Pseudomonas sp. UW4 acdS gene promotes primordium initiation and fruiting body development of Agaricus bisporus. World J. Microbiol. Biotechnol. 2019, 35, 163. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.M.; Cho, K.M. Identification of auxin from Pseudomonas sp. P7014 for the rapid growth of Pleurotus eryngii mycelium. Korean J. Microbiol. 2014, 50, 15–21. [Google Scholar] [CrossRef]
- Pandin, C.; Védie, R.; Rousseau, T.; Le Coq, D.; Aymerich, S.; Briandet, R. Dynamics of compost microbiota during the cultivation of Agaricus bisporus in the presence of Bacillus velezensis QST713 as biocontrol agent against Trichoderma aggressivum. Biol. Control 2018, 127, 39–54. [Google Scholar] [CrossRef]
- Šantrić, L.; Potočnik, I.; Radivojević, L.; Umiljendić, J.G.; Rekanović, E.; Duduk, B.; Milijašević-Marčić, S. Impact of a native Streptomyces flavovirens from mushroom compost on green mold control and yield of Agaricus bisporus. J. Environ. Sci. Health Part B 2018, 53, 677–684. [Google Scholar] [CrossRef] [PubMed]
- Tajalipour, S.; Hassanzadeh, N.; Khabbaz Jolfaee, H.; Heydari, A.; Ghasemi, A. Biological control of mushroom brown blotch disease using antagonistic bacteria. Biocontrol Sci. Technol. 2014, 24, 473–484. [Google Scholar] [CrossRef]
- Sasaki, H.; Maruyama, G.; Suzuki, H.; Nonaka, J.; Sato, M.; Sasaki, T.; Ohta, M.; Nakai, Y. Distribution of ammonia assimilating bacteria in the composting process. Compos. Sci. Util. 2004, 12, 108–113. [Google Scholar] [CrossRef]
- Wang, P.; Tan, Z.; Guan, L.; Tang, S.; Zhou, C.; Han, X.; Kang, J.; He, Z. Ammonia and amino acids modulates enzymes associated with ammonia assimilation pathway by ruminal microbiota in vitro. Livest. Sci. 2015, 178, 130–139. [Google Scholar] [CrossRef]
- Sharma, H.S.S.; Kilpatrick, M.; Lyons, G.; Murray, J.; Moore, S.; Cheung, L.; Finnegan, K.; Sturgeon, S.; Mellon, R. Changes in the quality of mushroom compost during the last decade. In Science and Cultivation of Edible and Medicinal Fungi; Romaine, P., Keil, C.B., Rinker, D.L., Royse, D.J., Eds.; Pennsylvania State University: Pennsylvania, PA, USA, 2004; pp. 229–239. [Google Scholar]
- Kong, W.; Guo, J.; Liu, Q.; Qi, M.; Cui, X.; Li, Y.; Gao, Y.; Qiu, L.; Zhang, Y. Establishment of the fast determination index for the compost degree of oyster mushroom substrate. China Cucurbits Veg. 2021, 34, 54–60. [Google Scholar]
- Liu, Q.; Kong, W.; Cui, X.; Hu, S.; Shi, Z.; Wu, J.; Zhang, Y.; Qiu, L. Dynamic succession of microbial compost communities and functions during Pleurotus ostreatus mushroom cropping on a short composting substrate. Front. Microbiol. 2022, 13, 946777. [Google Scholar] [CrossRef]
- Raigón, M.D.; García, M.; Maquieira, A.; Puchades, R. Determination of available nitrogen (nitic and ammoniacal) in soils by flow-injection analysis. Analysis 1992, 20, 483–487. [Google Scholar]
- Machida, K.; Tanaka, T.; Fujita, K.I.; Taniguchi, M. Farnesol-induced generation of reactive oxygen species via indirect inhibition of the mitochondrial electron transport chain in the yeast Saccharomyces cerevisiae. J. Bacteriol. 1998, 180, 4460–4465. [Google Scholar] [CrossRef] [PubMed]
- Zuo, Y.; Yang, Q.; Li, Y.; Zhang, J.; Qi, Y.; Gao, Y.; Shen, J.; Qiu, L. Functions and bioinformatics analysis of the NADPH oxidase NoxA in basidiomycete Pleurotus ostreatus: ROS production and fruiting body formation. Acad. J. Agric. Res. 2016, 4, 218–229. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wuest, P.; Duffy, M.D.; Royse, D.J. Six steps to mushroom farming. In Special Circular 268; The Pennsylvania State University, College of Agriculture, Extension Service: University Park, PA, USA, 1980. [Google Scholar]
- Li, Y.; Zhang, Y.; Shang, D.; Gao, Y.; Liu, Q.; Cui, X.; Kong, W.; Qiu, L. Ammonia tolerance of different Pleurotus ostreatus strains. Acta Edulis Fungi 2021, 28, 57–63. [Google Scholar]
- Baars, J.J.; den Camp, H.J.O.; van der Drift, C.; Joordens, J.J.; Wijmenga, S.S.; van Griensven, L.J.; Vogels, G.D. 15N-NMR study of ammonium assimilation in Agaricus bisporus. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 1996, 1310, 74–80. [Google Scholar] [CrossRef][Green Version]
- Baars, J.J.; Op den Camp, H.J.; van der Drift, C.; Van Griensven, L.J.; Vogels, G.D. Regulation of nitrogen-metabolizing enzymes in the commercial mushroom Agaricus bisporus. Curr. Microbiol. 1995, 31, 345–350. [Google Scholar] [CrossRef]
- Baars, J.J.; Op den Camp, H.J.; Hermans, J.M.; Mikeš, V.; van der Drift, C.; Van Griensven, L.J.; Vogels, G.D. Nitrogen assimilating enzymes in the white button mushroom Agaricus bisporus. Microbiology 1994, 140, 1161–1168. [Google Scholar] [CrossRef]
- Hubbe, M.A.; Nazhad, M.; Snchez, C. Composting as a way to convert cellulosic biomass and organic waste into high-value soil amendments: A review. BioResources 2010, 5, 2808–2854. [Google Scholar] [CrossRef]
- Ross, R.C.; Harris, P.J. The significance of thermophilic fungi in mushroom compost preparation. Sci. Hortic. 1983, 20, 61–70. [Google Scholar] [CrossRef]
- Rudolfová, J.; Mikeš, V. Involvement of the glutamine synthetase/glutamate synthase pathway in ammonia assimilation by the wood-rotting fungus Pleurotus ostreatus. Folia Microbiol. 1997, 42, 577–582. [Google Scholar] [CrossRef]
- Mikeš, V.; Zofall, M.; Chytil, M.; Fulneček, J.; Scháně, L. Ammonia-assimilating enzymes in the basidiomycete fungus Pleurotus ostreatus. Microbiology 1994, 140, 977–982. [Google Scholar] [CrossRef]
- Xu, Z.; Cao, J.; Qin, X.; Qiu, W.; Mei, J.; Xie, J. Toxic effects on bioaccumulation, hematological parameters, oxidative stress, immune responses and tissue structure in fish exposed to ammonia nitrogen: A review. Animals 2021, 11, 3304. [Google Scholar] [CrossRef]
- Sun, Y.; Fu, Z.; Ma, Z. The effects of acute ammonia stress on liver antioxidant, immune and metabolic responses of juvenile yellowfin tuna (Thunnus albacares). Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2024, 297, 111707. [Google Scholar] [CrossRef]
- Wang, C.; Zhang, S.H.; Wang, P.F.; Hou, J.; Li, W.; Zhang, W.J. Metabolic adaptations to ammonia-induced oxidative stress in leaves of the submerged macrophyte Vallisneria natans (Lour.) Hara. Aquat. Toxicol. 2008, 87, 88–98. [Google Scholar] [CrossRef]
- Barker, A.V. Ammonium accumulation and ethylene evolution by tomato infected with root-knot nematode and grown under different regimes of plant nutrition. Commun. Soil Sci. Plant Anal. 1999, 30, 175–182. [Google Scholar] [CrossRef]
- Shi, J.; Wang, X.; Wang, E. Mycorrhizal symbiosis in plant growth and stress adaptation: From genes to ecosystems. Annu. Rev. Plant Biol. 2023, 74, 569–607. [Google Scholar] [CrossRef] [PubMed]
- Hortal, S.; Plett, K.L.; Plett, J.M.; Cresswell, T.; Johansen, M.; Pendall, E.; Anderson, I.C. Role of plant–fungal nutrient trading and host control in determining the competitive success of ectomycorrhizal fungi. ISME J. 2017, 11, 2666–2676. [Google Scholar] [CrossRef]
- Larsen, P.E.; Sreedasyam, A.; Trivedi, G.; Podila, G.K.; Cseke, L.J.; Collart, F.R. Using next generation transcriptome sequencing to predict an ectomycorrhizal metabolome. BMC Syst. Biol. 2011, 5, 70. [Google Scholar] [CrossRef] [PubMed]
- Hui, J.; An, X.; Li, Z.; Neuhauser, B.; Ludewig, U.; Wu, X.; Schulze, W.X.; Chen, F.; Feng, G.; Lambers, H.; et al. The mycorrhiza-specific ammonium transporter ZmAMT3;1 mediates mycorrhiza-dependent nitrogen uptake in maize roots. Plant Cell 2022, 34, 4066–4087. [Google Scholar] [CrossRef]
- Duan, J.; Tian, H.; Drijber, R.A.; Gao, Y. Systemic and local regulation of phosphate and nitrogen transporter genes by arbuscular mycorrhizal fungi in roots of winter wheat (Triticum aestivum L.). Plant Physiol. Biochem. 2015, 96, 199–208. [Google Scholar] [CrossRef]
- Chen, W.; Mou, X.; Meng, P.; Chen, J.; Tang, X.; Meng, G.; Xin, K.; Zhang, Y.; Wang, C. Effects of arbuscular mycorrhizal fungus inoculation on the growth and nitrogen metabolism of Catalpa bungei CA Mey under different nitrogen levels. Front. Plant Sci. 2023, 14, 1138184. [Google Scholar]






| Kit Name | Manufacturer | Item No. | Methodology |
|---|---|---|---|
| Superoxide Dismutase (SOD) Activity Assay Kit | Solarbio, Beijing, China | BC5165 | WST-1 method |
| Peroxidase (POD) Activity Assay Kit | Solarbio, Beijing, China | BC0090 | Spectrophotometry |
| Catalase (CAT) Activity Assay Kit | Solarbio, Beijing, China | BC4785 | Ammonium molybdate method |
| Micro Glutamine Synthetase (GS) Assay Kit | Solarbio, Beijing, China | BC0915 | Spectrophotometry |
| Micro Glutamate Synthase (GOGAT) Assay Kit | Solarbio, Beijing, China | BC0075 | Spectrophotometry |
| Micro Glutamic Acid Dehydrogenase (GDH) Assay Kit | Solarbio, Beijing, China | BC1460 | Spectrophotometry |
| Species | Genes | Forward Primers (5′→3′) | Reverse Primers (5′→3′) |
|---|---|---|---|
| P. ostreatus | UBQ | TCTGCTCGATGTTGACTGATC | TATTTCCTCGTCCATTCCCT |
| ACO | GGGCAATAATGTCTGGCTCA | AGGCGTGGGATATTTCGTT | |
| NOXA | GCCGAGCGACTAGACTTTCC | GTCACCGACTTGGCGAATG | |
| GOGAT | GCTGGCGTCGGGCTTATTT | TATGGTCGGCTTTGGCTTT | |
| GS | CCAAGAAGGCAGGCGAATC | ATAGCCACGCCGAACTCTG | |
| AAT | GAACGCTCTACGGTCTCGC | AAGACTCGGGCACTGGATG | |
| AMT | ACCGCCTTGAGAAGAAATGG | TGCCAACGATACCTCCAACA | |
| GDH | TTGAAGGCTCCGACCTGTT | TGCGTTGACACCGTATTTGT | |
| Enterobacter sp. | glnA | CCAACCACCAACTCCTACAAG | CGGGATACGGATAGAAGCAG |
| gltD | AGTGACACGGGCAGCAAAT | TCGAGGCCACCCATGATAT | |
| amtB | GCAATGCGTTCTTTGGTAAC | TAGGCACATAGGAGAGCGTC | |
| gdhA | TGTGAAATCAAAGCCAGCC | CACGCCGTTGCTAATCAA | |
| rpoB | GCCAAGCCGATTTCTGGAGCA | CGTTTCGATTGGACATACG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, R.; Zhang, Q.; Chen, Y.; Gao, Y.; Yang, Y.; Liu, Q.; Kong, W.; Chai, H.; Sun, B.; Li, Y.; et al. The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus). J. Fungi 2025, 11, 130. https://doi.org/10.3390/jof11020130
Li R, Zhang Q, Chen Y, Gao Y, Yang Y, Liu Q, Kong W, Chai H, Sun B, Li Y, et al. The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus). Journal of Fungi. 2025; 11(2):130. https://doi.org/10.3390/jof11020130
Chicago/Turabian StyleLi, Rui, Qi Zhang, Yuannan Chen, Yuqian Gao, Yanqing Yang, Qin Liu, Weili Kong, Haopeng Chai, Bingke Sun, Yanan Li, and et al. 2025. "The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus)" Journal of Fungi 11, no. 2: 130. https://doi.org/10.3390/jof11020130
APA StyleLi, R., Zhang, Q., Chen, Y., Gao, Y., Yang, Y., Liu, Q., Kong, W., Chai, H., Sun, B., Li, Y., & Qiu, L. (2025). The Mechanism of Ammonia-Assimilating Bacteria Promoting the Growth of Oyster Mushrooms (Pleurotus ostreatus). Journal of Fungi, 11(2), 130. https://doi.org/10.3390/jof11020130

