A New Benzaldehyde Derivative Exhibits Antiaflatoxigenic Activity against Aspergillus flavus
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Strain and Culture Conditions
2.2. Reagents and Chemicals
2.3. Antifungal and Antiaflatoxigenic Activities of MPOBA in a Liquid Medium
2.4. UHPLC Analysis of AFB1
2.5. Effect of MPOBA on the Expression of Genes Involved in AFB1 Biosynthesis
2.6. Effect of MPOBA on Sporulation in A. flavus
2.7. Cytotoxicity Assay Using (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT Assay)
2.8. Statistical Analysis
3. Results
3.1. Effects of MPOBA on the Production of AFB1 and the Fungal Growth of A. flavus
3.2. Effect of MPOBA on the Expression of Genes Involved in the Biosynthesis of AFB1
3.3. Effect of MPOBA on Sporulation in A. flavus
3.4. Effect of MPOBA on MDCK Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Mahmoud, M.; Ali, H.M.; El-Aziz, A.R.; Al-Othman, M.R.; Al-Wadai, A.S. Molecular characterization of aflatoxigenic and non-aflatoxigenic Aspergillus flavus isolates collected from corn grains. Genet. Mol. Res. 2014, 13, 9352–9370. [Google Scholar] [CrossRef] [Scilit]
- Benkerroum, N. Aflatoxins: Producing-Molds, Structure, Health Issues and Incidence in Southeast Asian and Sub-Saharan African Countries. Int. J. Environ. Res. Public. Health 2020, 17, 1215. [Google Scholar] [CrossRef] [Scilit]
- Shank, R.C. Environmental toxicoses in humans. In Mycotoxins and N- Nitroso Compounds: Environmental Risks; Shank, R.C., Ed.; CRC Press, Inc.: Boca Raton, FL, USA, 1981; pp. 107–140. [Google Scholar]
- Liu, Y.; Wu, F. Global burden of aflatoxin-induced hepatocellular carcinoma: A risk assessment. Environ. Health Perspect. 2010, 118, 818–824. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mitchell, N.J.; Bowers, E.; Hurburgh, C.; Wu, F. Potential economic losses to the US corn industry from aflatoxin contamination. Food Addit. Contam. Part. A Chem. Anal. Control Expo. Risk Assess. 2016, 33, 540–550. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Perrone, G.; Haidukowski, M.; Stea, G.; Epifani, F.; Bandyopadhyay, R.; Leslie, J.F.; Logrieco, A. Population structure and Aflatoxin production by Aspergillus Sect. Flavi from maize in Nigeria and Ghana. Food Microbiol. 2014, 41, 52–59. [Google Scholar] [CrossRef] [Scilit]
- Iqbal, S.Z.; Asi, M.R.; Hanif, U.; Zuber, M.; Jinap, S. The presence of aflatoxins and ochratoxin A in rice and rice products; and evaluation of dietary intake. Food Chem. 2016, 210, 135–140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alameri, M.M.; Kong, A.S.-Y.; Aljaafari, M.N.; Ali, H.A.; Eid, K.; Sallagi, M.A.; Cheng, W.-H.; Abushelaibi, A.; Lim, S.-H.E.; Loh, J.-Y. Aflatoxin contamination: An overview on health issues, detection and management strategies. Toxins 2023, 15, 246. [Google Scholar] [CrossRef] [Scilit]
- Tumukunde, E.; Ma, G.; Li, D.; Yuan, J.; Qin, L.; Wang, S. Current research and prevention of aflatoxins in China. World Mycotoxin J. 2020, 13, 121–138. [Google Scholar] [CrossRef] [Scilit]
- Ali, N. Aflatoxins in rice: Worldwide occurrence and public health perspectives. Toxicol. Rep. 2019, 6, 1188–1197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Adebo, O.A.; Njobeh, P.B.; Gbashi, S.; Nwinyi, O.C.; Mavumengwana, V. Review on microbial degradation of aflatoxins. Crit. Rev. Food Sci. Nutr. 2017, 57, 3208–3217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qian, Y. Decontamination of aflatoxin B1. In Aflatoxin B1 Occurrence, Detection and Toxicological Effects; Long, X.D., Ed.; IntechOpen: London, UK, 2019; p. 10. [Google Scholar]
- Sipos, P.; Peles, F.; Brassó, D.L.; Béri, B.; Pusztahelyi, T.; Pócsi, I.; Győri, Z. Physical and chemical methods for reduction in aflatoxin content of feed and food. Toxins 2021, 13, 204. [Google Scholar] [CrossRef] [Scilit]
- Guan, Y.; Chen, J.; Nepovimova, E.; Long, M.; Wu, W.; Kuca, K. Aflatoxin detoxification using microorganisms and enzymes. Toxins 2021, 13, 46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mahato, D.K.; Lee, K.E.; Kamle, M.; Devi, S.; Dewangan, K.N.; Kumar, P.; Kang, S.G. Aflatoxins in food and feed: An overview on prevalence, detection and control strategies. Front. Microbiol. 2019, 10, 2266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peles, F.; Sipos, P.; Kovács, S.; Győri, Z.; Pócsi, I.; Pusztahelyi, T. Biological control and mitigation of aflatoxin contamination in commodities. Toxins 2021, 13, 104. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J. Current understanding on aflatoxin biosynthesis and future perspective in reducing aflatoxin contamination. Toxins 2012, 4, 1024–1057. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Caceres, I.; Khoury, A.A.; Khoury, R.E.; Lorber, S.; Oswald, I.P.; Khoury, A.E.; Atoui, A.; Puel, O.; Bailly, J.D. Aflatoxin biosynthesis and genetic regulation: A review. Toxins 2020, 12, 150. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.; Guan, X.; Xing, F.; Lv, C.; Dai, X.; Liu, Y. Effect of water activity and temperature on the growth of Aspergillus flavus, the expression of aflatoxin biosynthetic genes and aflatoxin production in shelled peanuts. Food Control 2017, 82, 325–332. [Google Scholar] [CrossRef] [Scilit]
- Park, H.-S.; Yu, J.-H. Velvet regulators in Aspergillus spp. Microbiol. Biotechnol. Lett. 2016, 44, 409–419. [Google Scholar] [CrossRef] [Scilit]
- Moon, H.; Han, K.-H.; Yu, J.-H. Upstream regulation of development and secondary metabolism in Aspergillus Species. Cells 2023, 12, 2. [Google Scholar] [CrossRef] [Scilit]
- Dzhavakhiya, V.G.; Voinova, T.M.; Popletaeva, S.B.; Statsyuk, N.V.; Limantseva, L.A.; Shcherbakova, L.A. Effect of various compounds blocking the colony pigmentation on the aflatoxin B1 production by Aspergillus flavus. Toxins 2016, 8, 313. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lagogianni, C.S.; Tsitsigiannis, D.I. Effective chemical management for prevention of aflatoxins in maize. Phytopathol. Mediterr. 2018, 57, 186–198. [Google Scholar]
- Neto, L.J.L.; Ramos, A.G.B.; Freitas, T.S.; Barbosa, C.R.D.S.; de Sousa Júnior, D.L.; Siyadatpanah, A.; Nejat, M.; Wilairatana, P.; Coutinho, H.D.M.; da Cunha, F.A.B. Evaluation of benzaldehyde as an antibiotic modulator and its toxic effect against Drosophila melanogaster. Molecules 2021, 26, 5570. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Liu, H.; Zhao, J.; Gao, H.; Zhou, L.; Liu, Z.; Chen, Y.; Sui, P. Antimicrobial and antioxidant activities of the root bark essential oil of Periploca sepium and its main component 2-Hydroxy-4-methoxybenzaldehyde. Molecules 2010, 15, 5807–5817. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Haff, R.P.; Faria, N.C.G.; Martins, M.D.L.; Chan, K.L.; Campbell, B.C. Targeting the mitochondrial respiratory chain of Cryptococcus through antifungal chemosensitization: A model for control of non-fermentative pathogens. Molecules 2013, 18, 8873–8894. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Andersen, A. final report on the safety assessment of benzaldehyde. Int. J. Toxicol. 2006, 25 (Suppl. 1), 11–27. [Google Scholar]
- Kim, J.H.; Chan, K.L. Benzaldehyde use to protect seeds from foodborne fungal pathogens. Biol. Life Sci. Forum 2022, 18, 7. [Google Scholar]
- Thongaram, P.; Kanjanasirirat, P.; Jearawuttanakul, K.; Kongsema, M.; Chuanopparat, N.; Ngernmeesri, P. Synthesis and anticancer activity evaluation of benzo[6,7]oxepino[3,2-b] pyridine derivatives. Tetrahedron 2020, 76, 131473. [Google Scholar] [CrossRef] [Scilit]
- Zhang, R.; Zhang, R.; Tan, Z.-C.; Huang, K.-C.; Wen, Y.; Li, X.-Y.; Zhao, J.-L.; Liu, C.-L. A vortex-assisted dispersive liquid-liquid microextraction followed by UPLC-MS/MS for simultaneous determination of pesticides and aflatoxins in herbal tea. Molecules 2019, 24, 1029. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cleveland, T.E.; Yu, J.; Fedorova, N.; Bhatnagar, D.; Payne, G.A.; Nierman, W.C.; Bennett, J.W. Potential of Aspergillus flavus genomics for applications in biotechnology. Trends Biotechnol. 2009, 27, 151–157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hua, S.S.T.; Beck, J.J.; Sarreal, S.B.; Gee, W. The major volatile compound 2-phenylethanol from the biocontrol yeast, Pichia anomala, inhibits growth and expression of aflatoxin biosynthetic genes of Aspergillus flavus. Mycotoxin Res. 2014, 30, 71–78. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, Q.; Qiu, Y.; Wang, X.; Gu, Y.; Zhao, Y.; Wang, Y.; Yue, T.; Yuan, Y. Inhibitory effects of Eurotium cristatum on growth and aflatoxin B1 biosynthesis in Aspergillus flavus. Front. Microbiol. 2020, 11, 921. [Google Scholar] [CrossRef] [Scilit]
- Schütz, G.; Haltrich, D.; Atanasova, L. Influence of spore morphology on spectrophotometric quantification of Trichoderma inocula. BioTechniques 2020, 68, 279–282. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyazawa, K.; Umeyama, T.; Hoshino, Y.; Abe, K.; Miyazaki, Y. Quantitative monitoring of mycelial growth of Aspergillus fumigatus in liquid culture by optical density. Microbiol. Spectr. 2022, 10, e00063-21. [Google Scholar] [CrossRef] [Scilit]
- Caligiore Gei, P.; Valdez, J.G. Adjustment of a rapid method for quantification of Fusarium spp. spore suspensions in plant pathology. Rev. Argent. Microbiol. 2015, 50, 152–154. [Google Scholar] [CrossRef] [Scilit]
- Ansari, S.; Mousavi, A.; Safarnejad, M.R.; Farrokhi, N.; Alavi, S.M.; Schillberg, S.; Nölke, G. Selection and characterization of two monoclonal antibodies specific for the Aspergillus flavus major antigenic cell wall protein Aflmp1. Fungal Biol. 2021, 125, 621–629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alkhayyat, F.; Yu, J.H. Upstream regulation of mycotoxin biosynthesis. Adv. Appl. Microbiol. 2014, 86, 251–278. [Google Scholar] [PubMed]
- Cary, J.W.; Harris-Coward, P.Y.; Ehrlich, K.C.; Mack, B.M.; Kale, S.P.; Larey, C.; Calvo, A.M. NsdC and NsdD affect Aspergillus flavus morphogenesis and aflatoxin production. Eukaryot. Cell 2012, 11, 1104–1111. [Google Scholar] [CrossRef] [Scilit]
- Jallow, A.; Xie, H.; Tang, X.; Qi, Z.; Li, P. Worldwide aflatoxin contamination of agricultural products and foods: From occurrence to control. Compr. Rev. Food Sci. 2021, 20, 2332–2381. [Google Scholar] [CrossRef] [Scilit]
- Jermnak, U.; Yoshinari, T.; Sugiyama, Y.; Tsuyuki, R.; Nagasawa, H.; Sakuda, S. Isolation of methyl syringate as a specific aflatoxin production inhibitor from the essential oil of Betula alba and aflatoxin production inhibitory activities of its related compounds. Int. J. Food Microbiol. 2012, 153, 339–344. [Google Scholar] [CrossRef] [Scilit]
- Jantapan, K.; Poapolathep, A.; Imsilp, K.; Poapolathep, S.; Tanhan, P.; Kumagai, S.; Jermnak, U. Inhibitory effects of Thai essential oils on potentially aflatoxigenic Aspergillus parasiticus and Aspergillus flavus. Biocontrol Sci. 2017, 22, 31–40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Furukawa, T.; Sakuda, S. Inhibition of aflatoxin production by paraquat and external superoxide dismutase in Aspergillus flavus. Toxins 2019, 11, 107. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, J.-B.; Lim, S.-H.; Sim, H.-S.; Park, J.-H.; Kwon, H.-J.; Nam, H.S.; Kim, M.-D.; Baek, H.-H.; Ha, S.-J. Changes in antioxidant activities and volatile compounds of mixed berry juice through fermentation by lactic acid bacteria. Food Sci. Biotechnol. 2017, 26, 441–446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ullah, I.; Khan, A.L.; Ali, L.; Khan, A.R.; Waqas, M.; Hussain, J.; Lee, I.J.; Shin, J.H. Benzaldehyde as an insecticidal, antimicrobial, and antioxidant compound produced by Photorhabdus temperata M1021. J. Microbiol. 2015, 53, 127–133. [Google Scholar] [CrossRef] [Scilit]
- Bisceglie, F.; Degola, F.; Rogolino, D.; Giannelli, G.; Orsoni, N.; Spadola, G.; Pioli, M.; Restivo, F.M.; Carcelli, M.; Pelosi, G. Sisters in structure but different in character, some benzaldehyde and cinnamaldehyde derivatives differentially tune Aspergillus flavus secondary metabolism. Sci. Rep. 2020, 10, 17686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, J.; Liu, J.; Kang, D.; Huang, Y.; Kong, W.; Xiang, Y.; Zhu, X.; Duan, Y.; Huang, Y. Isolation and characterization of benzaldehyde derivatives with anti-inflammatory activities from Eurotium cristatum, the dominant fungi species in Fuzhuan brick tea. ACS Omega 2019, 4, 6630–6636. [Google Scholar] [CrossRef] [Scilit]
- Smith, C.A.; Woloshuk, C.P.; Robertson, D.; Payne, G.A. Silencing of the aflatoxin gene cluster in a diploid strain of Aspergillus flavus is suppressed by ectopic aflR expression. Genetics 2007, 176, 2077–2086. [Google Scholar] [CrossRef] [Scilit]
- Du, W.; Obrian, G.; Payne, G. Function and regulation of aflJ in the accumulation of aflatoxin early pathway intermediate in Aspergillus flavus. Food Addit. Contam. 2007, 24, 1043–1050. [Google Scholar] [CrossRef] [Scilit]
- Zhou, R.; Linz, J.E. Enzymatic function of the Nor-1 protein in aflatoxin biosynthesis in Aspergillus parasiticus. Appl. Environ. Microbiol. 1999, 65, 5639–5641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, X.; Branà, M.T.; Haidukowski, M.; Gallo, A.; Zhang, Q.; Logrieco, A.F.; Li, P.; Zhao, S.; Altomare, C. Potential of Trichoderma spp. for biocontrol of aflatoxin-producing Aspergillus flavus. Toxins 2022, 14, 86. [Google Scholar] [CrossRef] [Scilit]
- Amaike, S.; Keller, N.P. Distinct roles for VeA and LaeA in development and pathogenesis of Aspergillus flavus. Eukaryot. Cell 2009, 8, 1051–1060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, P.; Xu, J.; Chang, P.-K.; Liu, Z.; Kong, Q. New insights of transcriptional regulator AflR in Aspergillus flavus physiology. Microbiol. Spectr. 2022, 10, e0079121. [Google Scholar] [CrossRef] [Scilit]
- Baidya, S.; Duran, R.M.; Lohmar, J.M.; Harris-Coward, P.Y.; Cary, J.W.; Hong, S.Y.; Roze, L.V.; Linz, J.E.; Calvo, A.M. VeA is associated with the response to oxidative stress in the aflatoxin producer Aspergillus flavus. Eukaryot. Cell 2014, 13, 1095–1103. [Google Scholar] [CrossRef] [Scilit]
- Brakhage, A. Regulation of fungal secondary metabolism. Nat. Rev. Microbiol. 2013, 11, 21–32. [Google Scholar] [CrossRef] [Scilit]
- Sarikaya, B.O.; Bayram, O.; Valerius, O.; Park, H.S.; Irniger, S.; Gerke, J.; Ni, M.; Han, K.H.; Yu, J.H.; Braus, G.H. LaeA control of velvet family regulatory proteins for light-dependent development and fungal cell-type specificity. PLoS Genet. 2010, 6, e1001226. [Google Scholar] [CrossRef] [Scilit]
- Bok, J.W.; Keller, N.P. LaeA, a regulator of secondary metabolism in Aspergillus spp. Eukaryot. Cell 2004, 3, 527–535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bayram, O.; Krappmann, S.; Ni, M.; Bok, J.W.; Helmstaedt, K.; Valerius, O.; Braus-Stromeyer, S.; Kwon, N.J.; Keller, N.P.; Yu, J.H.; et al. VelB/VeA/LaeA complex coordinates light signal with fungal development and secondary metabolism. Science 2008, 320, 1504–1506. [Google Scholar] [CrossRef] [Scilit]
- Chanda, A.; Roze, L.V.; Kang, S.; Artymovich, K.A.; Hicks, G.R.; Raikhel, N.V.; Calvo, A.M.; Linz, J.E. A key role for vesicles in fungal secondary metabolism. Proc. Natl. Acad. Sci. USA 2009, 106, 19533–19538. [Google Scholar] [CrossRef] [Scilit]
- Khosravi, A.R.; Minooeianhaghighi, M.H.; Shokri, H.; Emami, S.A.; Alavi, S.M.; Asili, J. The potential inhibitory effect of Cuminum cyminum, Ziziphora clinopodioides and Nigella sativa essential oils on the growth of Aspergillus fumigatus and Aspergillus. Braz. J. Microbiol. 2011, 42, 216–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Q.; Zhu, X.; Xie, Y.; Liang, J. Antifungal properties and mechanisms of three volatile aldehydes (octanal, nonanal and decanal) on Aspergillus flavus. Grain Oil Sci. Technol. 2021, 4, 131–140. [Google Scholar] [CrossRef] [Scilit]
- Liang, D.; Xing, F.; Selvaraj, J.N.; Liu, X.; Wang, L.; Hua, H.; Liu, Y. Inhibitory effect of cinnamaldehyde, citral, and eugenol on aflatoxin biosynthetic gene expression and aflatoxin B1 biosynthesis in Aspergillus flavus. J. Food Sci. 2015, 80, 2917–2924. [Google Scholar] [CrossRef] [Scilit]
- Wang, P.; Ma, L.; Jin, J.; Zheng, M.; Pan, L.; Zhao, Y.; Sun, X.; Liu, Y.; Xing, F. The anti-aflatoxigenic mechanism of cinnamaldehyde in Aspergillus flavus. Sci. Rep. 2019, 9, 10499. [Google Scholar] [CrossRef] [Scilit]
- Qu, S.; Yang, K.; Chen, L.; Liu, M.; Geng, Q.; He, X.; Li, Y.; Liu, Y.; Tian, J. Cinnamaldehyde, a promising natural preservative against Aspergillus flavus. Front. Microbiol. 2019, 10, 2895. [Google Scholar] [CrossRef] [Scilit]
- Sun, Q.; Shang, B.; Wang, L.; Lu, Z.; Liu, Y. Cinnamaldehyde inhibits fungal growth and aflatoxin B1 biosynthesis by modulating the oxidative stress response of Aspergillus flavus. Appl. Microbiol. Biotechnol. 2015, 100, 1355–1364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, D.; Wei, M.; Peng, S.; Mo, H.; Huang, L.; Yao, L.; Hu, L. Cuminaldehyde in cumin essential oils prevents the growth and aflatoxin B1 biosynthesis of Aspergillus flavus in peanuts. Food Control 2021, 125, 107985. [Google Scholar] [CrossRef] [Scilit]
- Xie, Y.; Cao, Y.; Zhang, Y.; Liu, F.; Xu, H.; Xiao, X. Synergistic antifungal properties of lauraldehyde and geraniol against Aspergillus flavus in pistachio. Food Control 2023, 153, 109915. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Chan, K.L.; Mahoney, N.; Campbell, B.C. Antifungal activity of redox-active benzaldehydes that target cellular antioxidation. Ann. Clin. Microbiol. Antimicrob. 2011, 10, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kluwe, W.M.; Montgomery, C.A.; Giles, H.D.; Prejean, J.D. Encephalopathy in rats and nephropathy in rats and mice after subchronic oral exposure to benzaldehyde. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 1983, 21, 245–250. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Primer (5′ to 3′) | PCR Product Size (bp) |
|---|---|---|
| β-tubulin | F: TCTTCATGGTTGGCTTCGCT R: CTTGGGGTCGAACATCTGCT | 98 |
| aflR | F: GATCTGGCTGGTCAGGAGCA R: CGCCTGAAACGGTGGTAGTG | 204 |
| aflS | F: TGGTGCGACCATATTTACA R: GGTTGGGTCACGAACTGTTT | 94 |
| aflD | F: ATGCTCCCGTCCTACTGTTT R: ATGTTGGTGATGGTGCTGAT | 106 |
| aflQ | F: TTAAGGCAGCGGAATACAAG R: GACGCCCAAAGCCGAACACAAA | 599 |
| LaeA | F: AAAGGTTGCTCGCTGGTACA R: GACTTCTGACGAAATGCGCC | 121 |
| VeA | F: TTGTCGTGTGCGGATTCG R: CTCATCGTAGTCGTATCATCG | 79 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jermnak, U.; Ngernmeesri, P.; Yurayart, C.; Poapolathep, A.; Udomkusonsri, P.; Poapolathep, S.; Phaochoosak, N. A New Benzaldehyde Derivative Exhibits Antiaflatoxigenic Activity against Aspergillus flavus. J. Fungi 2023, 9, 1103. https://doi.org/10.3390/jof9111103
Jermnak U, Ngernmeesri P, Yurayart C, Poapolathep A, Udomkusonsri P, Poapolathep S, Phaochoosak N. A New Benzaldehyde Derivative Exhibits Antiaflatoxigenic Activity against Aspergillus flavus. Journal of Fungi. 2023; 9(11):1103. https://doi.org/10.3390/jof9111103
Chicago/Turabian StyleJermnak, Usuma, Paiboon Ngernmeesri, Chompoonek Yurayart, Amnart Poapolathep, Pareeya Udomkusonsri, Saranya Poapolathep, and Napasorn Phaochoosak. 2023. "A New Benzaldehyde Derivative Exhibits Antiaflatoxigenic Activity against Aspergillus flavus" Journal of Fungi 9, no. 11: 1103. https://doi.org/10.3390/jof9111103
APA StyleJermnak, U., Ngernmeesri, P., Yurayart, C., Poapolathep, A., Udomkusonsri, P., Poapolathep, S., & Phaochoosak, N. (2023). A New Benzaldehyde Derivative Exhibits Antiaflatoxigenic Activity against Aspergillus flavus. Journal of Fungi, 9(11), 1103. https://doi.org/10.3390/jof9111103

