Next Article in Journal
Reference-Based RADseq Unravels the Evolutionary History of Polar Species in ‘the Crux Lichenologorum’ Genus Usnea (Parmeliaceae, Ascomycota)
Previous Article in Journal
Metabolomic Profiling of Different Antrodia cinnamomea Phenotypes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Anti-Candida Potential of Sclareol in Inhibiting Growth, Biofilm Formation, and Yeast–Hyphal Transition

1
Department of Life Science, Gachon University, Seongnam 13120, Gyeonggi-do, Republic of Korea
2
Graduate School of Biotechnology, Kyung Hee University, Yingin 17104, Gyeonggi-do, Republic of Korea
3
College of Life Science, Kyung Hee University, Yongin 17104, Gyeonggi-do, Republic of Korea
*
Author to whom correspondence should be addressed.
J. Fungi 2023, 9(1), 98; https://doi.org/10.3390/jof9010098
Submission received: 27 November 2022 / Revised: 6 January 2023 / Accepted: 8 January 2023 / Published: 10 January 2023
(This article belongs to the Special Issue Natural Antifungal Agents)

Abstract

Even though Candida albicans commonly colonizes on most mucosal surfaces including the vaginal and gastrointestinal tract, it can cause candidiasis as an opportunistic infectious fungus. The emergence of resistant Candida strains and the toxicity of anti-fungal agents have encouraged the development of new classes of potential anti-fungal agents. Sclareol, a labdane-type diterpene, showed anti-Candida activity with a minimum inhibitory concentration of 50 μg/mL in 24 h based on a microdilution anti-fungal susceptibility test. Cell membrane permeability with propidium iodide staining and mitochondrial membrane potential with JC-1 staining were increased in C. albicans by treatment of sclareol. Sclareol also suppressed the hyphal formation of C. albicans in both liquid and solid media, and reduced biofilm formation. Taken together, sclareol induces an apoptosis-like cell death against Candida spp. and suppressed biofilm and hyphal formation in C. albicans. Sclareol is of high interest as a novel anti-fungal agent and anti-virulence factor.

1. Introduction

Candida albicans is an important opportunistic fungal pathogen worldwide. C. albicans is normally commensal in the human gastrointestinal tract and skin. However, C. albicans can cause hospital-acquired infections from superficial infections of oral or vaginal mucous membranes to life-threatening systemic disease, especially in immunocompromised patients [1]. Candida infections in the United States are the fourth most common hospital-acquired bloodstream infections and a 40% mortality rate in patients with systemic candidiasis has been reported [2,3]. To solve these health problems, many studies have been conducted to treat C. albicans infection, but few drugs are currently available as front-line treatments. To make matters worse, some strains become more resistant against commercially used anti-fungal drugs such as azoles [4]. New drugs to treat Candida infection must be developed to overcome drug resistance [4,5,6].
Apoptosis is the most well-known form of programmed cell death, which occurs essentially for proper development of higher eukaryotes. In fungi, apoptosis occurs naturally during aging and reproduction, and is induced by environmental stresses and treatment with anti-fungal agents [7]. Apoptosis in fungi has some features including phosphatidylserine (PS) externalization, nuclear condensation, DNA fragmentation, reactive oxygen species (ROS) accumulation, mitochondrial membrane potential dissipation, and cell cycle arrest [8,9,10].
Biofilms are structured communities of fungi and have an important function for fungi to adhere to biotic and abiotic surfaces [11]. Biofilms also provide resistance to antimicrobial therapy and host immune defenses. If mature biofilms have already developed, it is difficult to completely remove them due to their resistance to medical methods using disinfectants or physical washing [12]. Therefore, inhibiting biofilm formation is a new and critical candidate to reduce fungal infection.
C. albicans has three biological phases including yeast, pseudohyphal, and hyphal forms. The transformation of C. albicans from yeast to hyphae has important roles in causing disease by escaping from the phagocytic activity of macrophages and increasing invasion activity into epithelial cells. Inhibition of hyphal formation is a good target for anti-fungal adjuvants to reduce fungal virulence [13].
Sclareol is a labdane diterpene derivative isolated from Salvia sclarea (Figure 1). Sclareol induces cell cycle arrest and apoptosis in human breast cancer cells and inhibits proliferation of osteosarcoma cells by apoptotic induction and loss of mitochondrial membrane potential [14,15,16,17]. Sclareol also can alleviate the severity of arthritis by modulating excessive inflammation [18].
In this study, sclareol was tested for new anti-Candida activity with apoptosis-like cell death and for reduction in virulence by inhibiting biofilm formation and morphological transition of Candida spp.

2. Materials and Methods

2.1. Fungi Strains and Growth Conditions

The following Candida strains were used in this study: C. albicans (KCTC7965), C. tropicalis var. tropicalis (KCTC17762), C. parapsilosis var. parapsilosis (KACC45480), C. parapsilosis (KACC49573), C. glabrata (KCTC7219), and C. auris (KCTC17809). They were purchased either from KCTC (Korean Collection for Type Cultures; Jeongeup, Republic of Korea) or KACC (Korean Agricultural Culture Collection; Suwon, Republic of Korea). All strains were stored as frozen stock with 20% glycerol at −70 °C. Strains were cultured on YPD containing yeast extract 10 g/L (BD Difco, Franklin Lakes, NJ, USA), peptone 20 g/L (BD Difco, Franklin Lakes, NJ, USA), 2% D-glucose (w/v) (Daejung, Gyeonggi-do, Suwon, Republic of Korea), and agar 15 g/L (Daejung, Gyeonggi-do, Suwon, Republic of Korea) at 30 °C for 24–48 h [14,19].

2.2. Anti-Fungal Susceptibility Microdilution Assay

A microdilution assay was performed based on the description of a previous work [20]. Sclareol (Sigma-Aldrich, St. Louis, MO, USA) was dissolved with dimethyl sulfoxide (DMSO, Junsei, Tokyo, Japan) as a 10 mg/mL stock solution. Candida strains were cultured in culture tubes overnight and diluted to absorbances at OD600 = 0.01. Amounts totaling to 100 µL of C. albicans cells were added into each well of a 96-well plate (SPL, Gyeonggi-do, Seoul, Republic of Korea) with serial two-fold dilution of sclareol (3.125–200 µg/mL). After incubating at 30 °C for 24 h, the minimum inhibitory concentration (MIC) of the compound was measured by the naked eye. After MIC detection, 50 µL of the cultures was spread onto a YPD agar plate and incubated for 24 h at 30 °C to obtain the minimum fungicidal concentration (MFC) value as a no-cell-growth determinant. Growth control without sclareol treatment and sterilized medium control were performed in each test [21].

2.3. Fungi Cell Growth Test

Culture conditions in this study were the same as those in the above-mentioned anti-fungal susceptibility microdilution assay. Sclareol (25 and 50 µg/mL) was added to 96-well plates (SPL Gyeonggi-do, Seoul, Republic of Korea) with C. albicans. Growth of C. albicans was measured by change in absorbance at OD600 = 0.05 using a microplate reader (BioTek Instruments, Winooski, VT, USA) at a time indicated in a previous work [22].

2.4. Membrane Permeabilization Assay

Propidium iodide (PI, Biotium, Hayward, California, SF, USA) staining was carried out as reported previously with some modifications [23]. Freshly grown C. albicans cells were diluted to 106 CFU/mL in YPD medium and treated with indicated concentrations of sclareol (25, 50 and 100 µg/mL) at 30 °C for 2 h. Cells were washed twice with PBS and resuspended in 25 µg/mL of PI solution for 20 min at room temperature in the dark with shaking. After washing twice, the fluorescence was monitored and photographed with an EVOS FL Cell Imaging System (Thermo Fisher, Waltham, MA, USA) [24].

2.5. Measurement of Mitochondrial Membrane Potential

JC-1 (Koma Biotech, Seoul, Republic of Korea) staining was performed as reported previously with slight modifications to check mitochondrial membrane potential [24,25]. Freshly grown C. albicans cells were diluted to 106 CFU/mL in YPD and incubated with 25, 50, and 100 µg/mL of sclareol at 30 °C for 2 h. Cells were washed with PBS twice and stained with 0.5 µM of JC-1 for 15 min at 37 °C. After washing twice, the fluorescence of JC-1 was monitored and photographed with an EVOS FL Cell Imaging System (Thermo Fisher, Waltham, MA, USA).

2.6. ROS Detection

Dihydroethidium (DHE) staining (Cayman chemical, Ann Arbor, MI, USA) was used to detect ROS generation in apoptotic cells [22]. C. albicans cells were diluted to 106 CFU/mL in YPD, then incubated with indicated concentrations of sclareol or with 10 µM antimycin A (positive control) for 2 h. Cells were washed with a cell-based assay buffer. After discarding the assay buffer, a ROS staining buffer containing 0.1% DHE was added and incubated at 37 °C for 1 h. After removing the supernatant, a cell-based assay buffer was added to the cells. DHE-stained cells were measured by VICTOR2 (Perkin Elmer, Waltham, MA, USA) using an excitation wavelength of 480 nm and an emission wavelength of 580 nm.

2.7. Biofilm Formation Assay

To assess biofilm formation, C. albicans cells were cultured on YPD medium overnight at 30 °C in a shaking incubator and washed twice with phosphate-buffered saline (PBS) [26,27,28]. Amounts totaling to 100 µL of Candida cell suspensions (OD600 = 0.5) in RPMI 1640 were dispensed in 96 microdilution wells with or without sclareol (3.125 to 100 μg/mL). The plates were incubated at 37 °C for 24 h to adhere, and after that, washed with PBS to remove nonadherent cells. Biofilms were stained with 100 μL of 1% aqueous crystal violet for 15 min and washed twice with PBS and destained with 200 μL of 33% acetic acid for 20 min. The 96-well plate measured the optical density of each well by using a microplate reader (BioTek Instruments, Winooski, VT, USA) at 570 nm. To calculate the relative biofilm formation rate of C. albicans according to different doses of compound, compound-free wells and biofilm-free wells were also included for control. The assay was conducted more than three times in triplicate.

2.8. Hyphal Transition Assay

To evaluate the effect of compound on the yeast-to-hyphae transition of C. albicans, YPD media with 10% fetal bovine serum (FBS, Gibco, NY, USA) was used [29]. C. albicans cells were cultured overnight in 3 mL YPD media at 30 °C. Overnight cultures were centrifuged at 3000× g for 10 min. After removing supernatant, cells were washed and prepared at an absorbance of OD600 = 0.05. Afterwards, cells were incubated with shaking (250 rpm) for 4 h at 37 °C with indicated concentrations of sclareol. YPD + FBS transition-inducing media was used as controls. Cultures were washed with distilled water and we checked hyphal formation using an ICX41 coupled with an OD400UHW-P digital microscope camera (Thermo, Waltham, MA, USA). The percentage of hyphae formed was calculated by the number of hyphae formed/the total number of C. albicans cells.
Yeast-to-hyphae transition was also conducted using spider medium (10% nutrient broth, 10% D-mannitol, 2% K2HPO4, 20% agar) with indicated concentrations of sclareol [30,31,32]. Cells without compounds were used as control. The plates were incubated for 7 days at 37 °C and pictures were taken with an ICX41 coupled with an OD400UHW-P digital microscope camera [33,34,35].

2.9. Synergistic Anti-Fungal Activity Assay

To evaluate the anti-fungal synergistic activity, the fractional inhibitory concentration index (FICI) was used [36].
Simply, C. albicans cells were cultured overnight, resuspended with YPD medium at OD600 = 0.01, and added to each well of a 96-well plate. Miconazole and sclareol were added with serial two-fold dilution from a maximum of 100 µg/mL. Plates were incubated at 30 °C for 24 h. The synergistic effect of compound and miconazole was measured based on the FICI value [37]. The assay was conducted more than three times in triplicate.
FICI = (MICA in combination/MICA alone) + (MICB in combination/MICB alone). According to the following criteria, the effects of the anti-fungal drug combinations were classified: (1) FICI ≤ 0.5, synergistic effects; (2) 0.5 < FICI ≤ 1, additive effects; (3) 1 < FICI < 4, no interactions; (4) FICI ≥ 4.0, antagonistic effects.

2.10. Quantitative Reverse Transcriptase PCR (qRT-PCR) Analysis

RNA isolation and quantitative RT-PCR were performed as described previously with some modifications [21,38]. Total RNA was extracted with TRIzol reagent (Life Technology, Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions. cDNA was synthesized using 1 ug of RNA with reverse transcriptase (NanoHelix, Daejeon, Republic of Korea). qRT-PCR was performed with the 2X SybrGreen qPCR Mater Mix (CellSafe, Yongin, Republic of Korea). The expression level of tested genes was calculated using the formula 2-ΔΔCT. Primer sequences are listed in Table 1. ACT1 was used for the internal control. Statistical qRT-PCR analyses were performed by using GraphPad Prism, version 3.00, for Windows (GraphPad Software, San Diego, CA, USA).

2.11. Statistical Analysis

All data are expressed as the mean ± SD. Significant differences among the groups were determined using Student’s t-test and p < 0.05 was considered significant.

3. Results

3.1. Sclareol Inhibited the Growth of Candida spp.

The growth-inhibitory effect of sclareol against Candida spp. was evaluated. Sclareol showed an MIC value of 50 μg/mL for C. albicans, C. auris, and C. parapsilosis after 24 h (Table 2). To test the persistence of anti-fungal activity of sclareol to Candida spp., Candida was cultured for a further 72 h. The MIC of sclareol against C. albicans was 100 μg/mL after 48 h, and the value remained constant up to 72 h. The MFC value was 100 μg/mL for C. albicans after 24 h (Table 3). Treatment of 50 μg/mL of sclareol also inhibited C. albicans growth until 12 h, as indicated by a growth inhibition assay, but showed growth after 24 h (Figure 2). In summary, sclareol showed an anti-fungal effect against Candida spp.

3.2. Sclareol Reduced Membrane Permeability of C. albicans

The membrane permeability of C. albicans after treatment wiyj sclareol was detected using propidium iodide (PI) staining. After 2 h of sclareol treatment, the red fluorescence was increased depending on the concentration of sclareol (Figure 3a). In particular, the red fluorescence significantly increased by treatment of 100 μg/mL of sclareol. These results suggested that sclareol increased membrane permeability of C. albicans.

3.3. Sclareol Induced Apoptosis-like Cell Death through Disruption of Mitochondrial Membrane Potential and Increasing Intracellular Concentration of ROS

To further evaluate whether sclareol induced growth inhibition through apoptosis-like cell death, mitochondrial membrane potential and ROS generation were tested after sclareol treatment. Dissipation of mitochondrial membrane potential was detected by JC-1 staining. A JC-1 assay is a method of identifying mitochondrial membrane potentials using J-aggregate (JC-1) fluorescence. JC-1 dye is a lipophilic cation dye that permeates mitochondrial membrane well, having green fluorescence when present as a monomer and red fluorescence when present in the J-aggregates. In other words, when apoptosis occurs, the JC-1 cannot pass through the membrane and becomes green, and if it is alive, it penetrates the membrane well and becomes red [25]. C. albicans treated with sclareol showed a significant loss of red fluorescence compared with the untreated control (Figure 3b). This result indicates that sclareol inhibited the growth of C. albicans by abnormally altering the mitochondrial membrane potential. To support this result, ROS production was checked by DHE staining. Treatment with sclareol for 2 h increased the levels of intracellular ROS in a dose-dependent manner (Figure 3c). ROS generation in C. albicans started to remarkably increase at exposure to 100 µg/mL of sclareol [40,41,42,43,44,45,46].
To determine the molecular mechanism of sclareol in C. albicans, mRNA expression of Candida apoptosis-related genes was tested (Table 1). MCA1 is a cysteine protease involved in apoptosis in response to stresses and a homologue of a mammalian caspase in C. albicans. HSP90 is a molecular chaperone in the stress response of C. albicans and orchestrates echinocandin resistance via regulating the calcineurin pathway, which is involved in apoptosis [47,48,49,50]. YPK1 is a serine/threonine protein kinase that affects a variety of cellular activities, including sphingolipid homeostasis [51,52,53]. The expression of three key genes, MCA1, HSP90, and YPK1, was dramatically increased by sclareol treatment in a dose-dependent manner (Figure 3d). The SOD gene family provides instructions for creating an enzyme called superoxide dismutase, which is related to ROS. The expression of SOD2 and SOD5 genes was increased by sclareol treatment in a dose-dependent manner, excluding the SOD1 gene, whose expression was dose-dependently reduced (Figure 3e) [54]. Based on the above results, it is suggested that sclareol could induce apoptotic-like cell death against C. albicans (Figure 3f).

3.4. Sclareol Inhibited the Biofilm Formation of C. albicans

The inhibition of biofilm formation of C. albicans by sclareol was evaluated to determine whether sclareol also reduces the virulence of Candida or not. Sclareol dose-dependently inhibited the biofilm formation of C. albicans (Figure 4a). The expression of biofilm-related factors including ZAP1, ADH5, CSH1, TPO4, and CAN2 was significantly decreased after treatment with 6.25 to 50 µg/mL of sclareol, which supports the previous result (Figure 4b, Table 1). ZAP1 is a negative regulator of a major matrix component, soluble β-1,3 glucan [55,56,57]. ADH5 represents extracellular matrix genes and promotes matrix production. The expression of CSH1 is related to inhibition of structured communities of fungi. TPO4 plays a role in biofilm formation and CAN2 may participate in nutrient signaling pathways important for biofilm formation [58,59,60,61].

3.5. Sclareol Inhibited the Hyphal Formation of C. albicans

The inhibition of hyphal formation of C. albicans by sclareol was evaluated because biofilm formation is related with the morphological transition of C. albicans. Sclareol dose-dependently inhibited the hyphal formation of C. albicans (Figure 5a,c). Hyphal formation of C. albicans in spider medium is also inhibited by treatment of 50 μg/mL of sclareol (Figure 5b).
To support the result, the expression of Candida hyphae-related genes was tested (Table 1). After treatment with 6.25 to 50 µg/mL of sclareol, the expression of hyphae-associated factors in C. albicans was significantly decreased (Figure 5d). The expression of ALS3 mediates adherence to epithelial cells by encoding a cell surface protein. The expression of CYR1 is associated with the Ras1–cAMP–PKA pathway. ECE1 expression is correlated with the extent of cell elongation and ECE1 plays a role in the process of hyphal formation. The expression of TPK1 needs to control hyphal formation [62,63,64].

3.6. Sclareol Synergistically Inhibited the Growth of C. albicans with Miconazole

The FICI value between sclareol and miconazole against C. albicans was 0.31 (Table 4). Sclareol with miconazole synergistically inhibited the growth of C. albicans compared with the miconazole or sclareol alone group. Even though the MIC value of sclareol was 50 μg/mL, 3.125 μg/mL of sclareol combined with 0.78 μg/mL of miconazole showed significant inhibition of C. albicans growth. The FICI value was determined from three independent experiments [65,66].

4. Discussion

The low efficacy, high toxicity, and drug resistance of currently available anti-fungal agents necessitate the search for next-generation anti-fungal agents [40]. Many natural products have been reported to exhibit anti-fungal activity by inducing apoptosis [41,42,43]. Apoptosis is a form of programmed cell death and important for homeostasis and maintenance by eliminating mutated, damaged, infected, or superfluous cells without an inflammatory reaction [44]. In addition to metazoans, apoptosis has also been found in unicellular organisms. The production of ROS is one of earliest changes associated with apoptosis and ROS are necessary and sufficient to induce apoptosis in yeast [45,46]. Previous studies have shown that sclareol and its derivatives have remarkable anti-fungal activities against Botrytis cinerea [47]. However, the potential mechanisms explaining the anti-fungal action have not yet been fully explained.
Sclareol showed inhibition of C. albicans growth through increasing cell death. It was found that the number of dead cells (using PI staining) was increased and mitochondrial membrane potential was broken (using JC-1 staining) by treatment of sclareol. Mitochondria are both the origin and target of ROS and play an essential role in apoptotic processes [49]. These results indicated that sclareol caused mitochondrial dysfunction and ROS accumulation and could induce apoptosis in C. albicans.
Sclareol also exhibited synergistic anti-fungal activity with miconazole, which is a well-known imidazole anti-fungal agent. Miconazole inhibits ergosterol synthesis which influences the membrane permeability of Candida. This might enable sclareol to invade Candida more and result in synergistic activity [50]. The other possible mechanism lies in the notion that miconazole can also increase ROS generation which could synergistically affect Candida growth [51]. However, the detailed mechanism of synergistic anti-fungal activity must be examined in the future with other commercially available anti-fungal agents and natural compounds.
Apoptosis is a complex process involving multiple factors, including MCA1, HSP90, and YPK1 [52]. MCA1 is a central regulator of apoptosis and is involved in releasing ROS in fungi [9]. MCA1 encodes a human homologue of caspase. The calcineurin pathway was required for H2O2-induced C. albicans apoptosis. HSP90 was activated and CaMCA1 expression was elevated; this resulted in increased caspase activity and, thus, induced apoptosis [52]. Sphingolipids (SL) are a group of lipids presented in eukaryotic plasma membrane and involved in pivotal cellular processes such as apoptosis in fungi [53]. SL biosynthesis is regulated by paralog YPK1 protein kinases, a member of the AGC kinase subfamily [54]. The SOD gene codes superoxide dismutases (SODs), which are in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. SODs are critical antioxidant enzymes; they protect organisms from ROS caused by adverse conditions. The expression of MCA1, HSP90, YPK1, and most SOD genes (except SOD1) were increased by treatment of sclareol, and this result supports the notion that sclareol induces apoptosis via increasing and accumulating ROS in C. albicans [56].
The biofilm of fungi resists anti-fungal therapies and host defenses, and so it is necessary to suppress the production of a microbial-produced extracellular matrix. Biofilm formation is a complex process involving multiple factors, including ZAP1, ADH5, CSH1, TPO4, and CAN2. ZAP1 is the zinc response transcription factor and regulates the expression of genes for matrix formation in C. albicans [58,60]. ADH5 supports a matrix-stimulatory signal and may provide hexose for β-1,3 glucan synthesis. CSH1 represents ZAP1-activated genes, and predicted alcohol dehydrogenases TPO4 encode a putative transporter similar to polyamine and major facilitator superfamilies of drug transporters. Polyamines are essential for normal cell growth, and polyamine levels are carefully regulated in higher eukaryotes. CAN2 may be correlated with drug and toxic substance transport or nutrient sensing and signaling pathways. Both TPO4 and CAN2 are involved in transporting small molecules which affect biofilm formation in C. albicans [60]. As a result, the formation of biofilms should be suppressed by treatment with sclareol.
C. albicans has three biological phases in yeast, pseudohyphal, and hyphal forms. The morphological transition of C. albicans from yeast to hyphae has an important role in causing disease by escaping from the phagocytosis of macrophages and invading epithelial cells. Hyphal formation is a complex process involving multiple factors, including ALS3, CYR1, ECE1, and TPK1. ALS3 mediates adherence to epithelial cells by encoding a cell surface protein. In C. albicans, disruption of both copies of ALS3 reduces adherence to endothelial cells and overexpression of this gene increases adherence. ALS3 is also required for adherence of the hyphal form of C. albicans [62]. Yeast-to-hyphae transition in C. albicans requires a rapid activation of the adenylyl cyclase CYR1 to generate a cAMP spike. CYR1 acts as sensors of hyphae-inducing molecules. ECE1 is a key gene for hyphal development and its expression has been shown to be correlated with cell elongation and biofilm formation. TPK1 is essential for the derepression of branched-chain amino acid biosynthesis genes that have a role in the maintenance of iron levels and DNA stability within mitochondria. TPK1 allows hyphal formation on solid inducing media. The four key genes in hyphal formation, ALS3, CYR1, ECE1, and TPK1, were downregulated by treatment with sclareol. Sclareol inhibits C. albicans hyphal formation by suppressing gene expression.
In summary, sclareol inhibits the growth of C. albicans by inducing apoptosis-like cell death and reduces the virulence by inhibiting biofilm formation and hyphal transition [67]. This, sclareol is useful for new anti-Candida adjuvants and can act as a scaffold to develop new anti-fungal molecules (Figure 6).

5. Conclusions

Sclareol inhibits the growth of C. albicans by inducing apoptosis-like cell death via induction of production of ROS, disruption of mitochondrial integrity, and induction of expression of apoptosis-related genes. Sclareol also reduces the virulence by inhibiting biofilm formation and hyphal transition. The anti-fungal efficacy of sclareol may lead to the development of novel anti-fungal agents with low virulence of C. albicans.

Author Contributions

Conceptualization, J.-G.K. and K.-Y.K.; methodology, C.K., J.-G.K., and K.-Y.K.; validation, C.K., J.-G.K. and K.-Y.K.; formal analysis, C.K. and J.-G.K.; investigation, C.K. and J.-G.K.; resources, K.-Y.K.; data curation, J.-G.K. and K.-Y.K.; writing—original draft preparation, C.K.; writing—review and editing, K.-Y.K.; visualization, C.K.; supervision, K.-Y.K.; project administration, K.-Y.K.; funding acquisition, K.-Y.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the GRRC Program of Gyeonggi province [GRRC-KyungHee2020(B04)], Republic of Korea.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

Thanks to all participants involved in this research.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Phillips, A.J.; Sudbery, I.; Ramsdale, M. Apoptosis induced by environmental stresses and amphotericin B in Candida albicans. Proc. Natl. Acad. Sci. USA 2003, 100, 14327–14332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Hajjeh, R.A.; Sofair, A.N.; Harrison, L.H.; Lyon, G.M.; Arthington-Skaggs, B.A.; Mirza, S.A.; Phelan, M.; Morgan, J.; Lee-Yang, W.; Ciblak, M.A.; et al. Incidence of bloodstream infections due to Candida species and in vitro susceptibilities of isolates collected from 1998 to 2000 in a population-based active surveillance program. J. Clin. Microbiol. 2004, 42, 1519–1527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Singh, R.; Chakrabarti, A. Invasive candidiasis in the Southeast-Asian region. In Candida albicans: Cellular and Molecular Biology; Springer: Cham, Switzerland, 2017; pp. 25–40. [Google Scholar] [CrossRef] [Scilit]
  4. Sardi, J.C.O.; Scorzoni, L.; Bernardi, T.; Fusco-Almeida, A.M.; Mendes Giannini, M.J.S. Candida species: Current epidemiology, pathogenicity, biofilm formation, natural antifungal products and new therapeutic options. J. Med. Microbiol. 2013, 62, 10–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Thatchanamoorthy, N.; Rukumani Devi, V.; Chandramathi, S.; Tee Tay, S. Candida auris: A mini review on epidemiology in healthcare facilities in Asia. J. Fungi 2022, 8, 1126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Gintjee, T.J.; Donnelley, M.A.; Thompson, G.R., III. Aspiring antifungals: Review of current antifungal pipeline developments. J. Fungi 2020, 6, 28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Sharon, A.; Finkelstein, A.; Shlezinger, N.; Hatam, I. Fungal apoptosis: Function, genes and gene function. FEMS Microbiol. Rev. 2009, 33, 833–854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Yun, J.; Lee, D.G. Cecropin A-induced apoptosis is regulated by ion balance and glutathione antioxidant system in Candida albicans. IUBMB Life 2016, 68, 652–662. [Google Scholar] [CrossRef] [Scilit]
  9. Madeo, F.; Herker, E.; Wissing, S.; Jungwirth, H.; Eisenberg, T.; Fröhlich, K.U. Apoptosis in yeast. Curr. Opin. Microbiol. 2004, 7, 655–660. [Google Scholar] [CrossRef] [Scilit]
  10. Wu, X.Z.; Chang, W.Q.; Cheng, A.X.; Sun, L.M.; Lou, H.X. Plagiochin E, an antifungal active macrocyclic bis(bibenzyl), induced apoptosis in Candida albicans through a metacaspase-dependent apoptotic pathway. Biochim. Biophys. Acta 2010, 1800, 439–447. [Google Scholar] [CrossRef] [Scilit]
  11. Douglas, L.J. Medical importance of biofilms in Candida infections. Rev. Iberoam. Micol. 2002, 19, 139–143. [Google Scholar]
  12. Donlan, R.M. Biofilm formation: A clinically relevant microbiological process. Clin. Infect. Dis. 2001, 33, 1387–1392. [Google Scholar] [CrossRef] [Scilit]
  13. Chen, H.; Zhou, X.; Ren, B.; Cheng, L. The regulation of hyphae growth in Candida albicans. Virulence 2020, 11, 337–348. [Google Scholar] [CrossRef] [Scilit]
  14. Dimas, K.; Papadaki, M.; Tsimplouli, C.; Hatziantoniou, S.; Alevizopoulos, K.; Pantazis, P.; Demetzos, C. Labd-14-ene-8,13-diol (sclareol) induces cell cycle arrest and apoptosis in human breast cancer cells and enhances the activity of anticancer drugs. Biomed. Pharmacother. 2006, 60, 127–133. [Google Scholar] [CrossRef] [Scilit]
  15. Wang, L.; He, H.S.; Yu, H.L.; Zeng, Y.; Han, H.; He, N.; Liu, Z.G.; Wang, Z.Y.; Xu, S.J.; Xiong, M. Sclareol, a plant diterpene, exhibits potent antiproliferative effects via the induction of apoptosis and mitochondrial membrane potential loss in osteosarcoma cancer cells. Mol. Med. Rep. 2015, 11, 4273–4278. [Google Scholar] [CrossRef] [Scilit]
  16. Duan, G.; Hou, S.; Ji, J.; Deng, B. The study of sclareol in inhibiting proliferation of osteosarcoma cells by apoptotic induction and loss of mitochondrial membrane potential. Cancer Biomark. 2018, 22, 29–34. [Google Scholar] [CrossRef] [Scilit]
  17. Bhatia, S.P.; McGinty, D.; Letizia, C.S.; Api, A.M. Fragrance material review on sclareol. Food Chem. Toxicol. 2008, 46, S270–S274. [Google Scholar] [CrossRef] [Scilit]
  18. Tsai, S.W.; Hsieh, M.C.; Li, S.; Lin, S.C.; Wang, S.P.; Lehman, C.W.; Lien, C.Z.; Lin, C.C. Therapeutic potential of sclareol in experimental models of rheumatoid arthritis. Int. J. Mol. Sci. 2018, 19, 1351. [Google Scholar] [CrossRef] [Scilit]
  19. Kim, D.; Kim, K.Y. Antibacterial effect of sophoraflavanone G by destroying the cell wall of Enterococcus faecium. J. Appl. Pharm. Sci. 2020, 10, 59–64. [Google Scholar] [CrossRef] [Scilit]
  20. Pfaller, M.A.; Diekema, D. Progress in antifungal susceptibility testing of Candida spp. by use of Clinical and Laboratory Standards Institute broth microdilution methods, 2010 to 2012. J. Clin. Microbiol. 2012, 50, 2846–2856. [Google Scholar] [CrossRef] [Scilit]
  21. Kim, J.; Ha Quang Bao, T.; Shin, Y.K.; Kim, K.Y. Antifungal activity of magnoflorine against Candida strains. World J. Microbiol. Biotechnol. 2018, 34, 167. [Google Scholar] [CrossRef] [Scilit]
  22. Lee, J.; Kim, J.G.; Lee, H.; Lee, T.H.; Kim, K.Y.; Kim, H. Antifungal activity of 1,4-Dialkoxynaphthalen-2-Acyl Imidazolium salts by inducing apoptosis of pathogenic Candida spp. Pharmaceutics 2021, 13, 312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Kim, M.; Kim, J.G.; Kim, K.Y. Trichosanthes kirilowii extract promotes wound healing through the phosphorylation of ERK1/2 in Keratinocytes. Biomimetics 2022, 7, 154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Hwang, J.H.; Choi, H.; Kim, A.R.; Yun, J.W.; Yu, R.; Woo, E.R.; Lee, D.G. Hibicuslide C-induced cell death in Candida albicans involves apoptosis mechanism. J. Appl. Microbiol. 2014, 117, 1400–1411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Sivandzade, F.; Bhalerao, A.; Cucullo, L. Analysis of the mitochondrial membrane potential using the cationic JC-1 dye as a sensitive fluorescent probe. Bio-Protocol 2019, 9, e3128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Katherine, M.C.; Cristina, M.A.; Estibaliz, M.; José Manuel, A.U.; Guillermo, Q.; Elena, E. In vitro activities of carvacrol, cinnamaldehyde and thymol against Candida biofilms. Biomed. Pharmacother. 2021, 143, 112218. [Google Scholar] [CrossRef] [Scilit]
  27. Kim, D.; Kim, K.Y. Adenophora triphylla var. japonica inhibits Candida biofilm formation, increases susceptibility to antifungal agents and reduces infection. Int. J. Mol. Sci. 2021, 22, 12523. [Google Scholar] [CrossRef] [Scilit]
  28. Hawser, S.P.; Douglas, L.J. Biofilm formation by Candida species on the surface of catheter materials in vitro. Infect. Immun. 1994, 62, 915–921. [Google Scholar] [CrossRef] [Scilit]
  29. Bravo-Chaucanés, C.P.; Vargas-Casanova, Y.; Chitiva-Chitiva, L.C.; Ceballos-Garzon, A.; Modesti-Costa, G.; Parra-Giraldo, C.M. Evaluation of anti-Candida potential of Piper nigrum extract in inhibiting growth, yeast-hyphal transition, virulent enzymes, and biofilm formation. J. Fungi 2022, 8, 784. [Google Scholar] [CrossRef] [Scilit]
  30. Guilherme, M.C.; Walicyranison, P.S. Superoxide dismutases and glutaredoxins have a distinct role in the response of Candida albicans to oxidative stress generated by the chemical compounds menadione and diamide. Mem. Inst. Oswaldo Cruz 2012, 107, 998–1005. [Google Scholar] [CrossRef] [Scilit]
  31. Liu, H.; Kohler, J.; Fink, G.R. Suppression of hyphal formation in Candida albicans by mutation of a STE12 homolog. Science 1994, 266, 1723–1726. [Google Scholar] [CrossRef] [Scilit]
  32. Haghdoost, N.S.; Salehi, T.Z.; Khosravi, A.; Sharifzadeh, A. Antifungal activity and influence of propolis against germ tube formation as a critical virulence attribute by clinical isolates of Candida albicans. J. Mycol. Med. 2016, 26, 298–305. [Google Scholar] [CrossRef] [Scilit]
  33. Dongliang, Y.; Yanling, H.; Zixin, Y.; Qianru, G.; Yuqian, Z.; Fong, Y.C.; Guisheng, Z.; Lixing, W.; Lianhui, W.; Yue, W. Candida albicans ubiquitin and heat shock factor-type transcriptional factors are involved in 2-Dodecenoic acid-mediated inhibition of hyphal growth. Microorganisms 2020, 8, 75. [Google Scholar] [CrossRef] [Scilit]
  34. Yamada-Okabe, T.; Mio, T.; Ono, N.; Kashima, Y.; Matsui, M.; Arisawa, M.; Yamada-Okabe, H. Roles of three histidine kinase genes in hyphal development and virulence of the pathogenic fungus Candida albicans. J. Bacteriol. 1999, 181, 7243–7247. [Google Scholar] [CrossRef] [Scilit]
  35. Kim, D.; Kim, K.Y. Pectolinarin inhibits the bacterial biofilm formation and thereby reduces bacterial pathogenicity. Antibiotics 2022, 11, 598. [Google Scholar] [CrossRef] [Scilit]
  36. Konaté, K.; Mavoungou, J.F.; Lepengué, A.N.; Aworet-Samseny, R.R.; Hilou, A.; Souza, A.; Dicko, M.H.; M’Batchi, B. Antibacterial activity against β-lactamase producing methicillin and ampicillin-resistants Staphylococcus aureus: Fractional inhibitory concentration index (FICI) determination. Ann. Clin. Microbiol. Antimicrob. 2012, 11, 18. [Google Scholar] [CrossRef] [Scilit]
  37. Lane, S.; Zhou, S.; Pan, T.; Dai, Q.; Liu, H. The basic helix-loop-helix transcription factor Cph2 regulates hyphal development in Candida albicans partly via TEC1. Mol. Cell. Biol. 2001, 21, 6418–6428. [Google Scholar] [CrossRef] [Scilit]
  38. Nguyen, A.T.; Kim, K.Y. Inhibition of proinflammatory cytokines in Cutibacterium acnes-induced inflammation in HaCaT cells by using Buddleja davidii aqueous extract. Int. J. Inflam. 2020, 2020, 8063289. [Google Scholar] [CrossRef] [Scilit]
  39. Carmona-Gutierrez, D.; Eisenberg, T.; Büttner, S.; Meisinger, C.; Kroemer, G.; Madeo, F. Apoptosis in yeast: Triggers, pathways, subroutines. Cell Death Differ. 2010, 17, n763–n773. [Google Scholar] [CrossRef] [Scilit]
  40. Liu, P.; Luo, L.; Guo, J.; Liu, H.; Wang, B.; Deng, B.; Long, C.A.; Cheng, Y. Farnesol induces apoptosis and oxidative stress in the fungal pathogen Penicillium expansum. Mycologia 2010, 102, 311–318. [Google Scholar] [CrossRef] [Scilit]
  41. Da, X.; Nishiyama, Y.; Tie, D.; Hein, K.Z.; Yamamoto, O.; Morita, E. Antifungal activity and mechanism of action of Ougon (Scutellaria root extract) components against pathogenic fungi. Sci. Rep. 2019, 9, 1683. [Google Scholar] [CrossRef] [Scilit]
  42. Liu, X.; Ma, Z.; Zhang, J.; Yang, L. Antifungal compounds against Candida infections from traditional chinese medicine. BioMed Res. Int. 2017, 2017, 4614183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Rockenfeller, P.; Madeo, F. Apoptotic death of ageing yeast. Exp. Gerontol. 2008, 43, 876–881. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Price, M.; Reiners, J.J.; Santiago, A.M.; Kessel, D. Monitoring singlet oxygen and hydroxyl radical formation with fluorescent probes during photodynamic therapy. Photochem. Photobiol. 2009, 85, 1177–1181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Benaroudj, N.; Lee, D.H.; Goldberg, A.L. Trehalose accumulation during cellular stress protects cells and cellular proteins from damage by oxygen radicals. J. Biol. Chem. 2001, 276, 24261–24267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Mendoza, L.; Sepulveda, C.; Melo, R.; Cotoras, M. Characterization of the antifungal activity against Botrytis cinerea of sclareol and 13-epi-sclareol, two labdane-type diterpenoids. J. Chil. Chem. 2015, 60, 3024–3028. [Google Scholar] [CrossRef] [Scilit]
  47. Jia, C.; Zhang, J.; Yu, L.; Wang, C.; Yang, Y.; Rong, X.; Xu, K.; Chu, M. Antifungal activity of Coumarin against Candida albicans is related to apoptosis. Front. Cell. Infect. Microbiol. 2019, 8, 445. [Google Scholar] [CrossRef] [Scilit]
  48. Pereira, C.; Silva, R.D.; Saraiva, L.; Johansson, B.; Sousa, M.J.; Côrte-Real, M. Mitochondria-dependent apoptosis in yeast. Biochim. Biophys. Acta 2008, 1783, 1286–1302. [Google Scholar] [CrossRef] [Scilit]
  49. Dai, B.; Wang, Y.; Li, D.; Xu, Y.; Liang, R.; Zhao, L.; Cao, Y.; Jia, J.; Jiang, Y. Hsp90 is involved in apoptosis of Candida albicans by regulating the calcineurin-caspase apoptotic pathway. PLoS ONE 2012, 7, e45109. [Google Scholar] [CrossRef] [Scilit]
  50. Swamy, K.S.; Sirsi, M.; Ramananda, G.R. Studies on the mechanism of action of miconazole: Effect of miconazole on respiration and cell permeability of Candida albicans. Antimicrob. Agents Chemother. 1974, 5, 420–425. [Google Scholar] [CrossRef] [Scilit]
  51. Kobayashi, D.; Kondo, K.; Uehara, N.; Otokozawa, S.; Tsuji, N.; Yagihashi, A.; Watanabe, N. Endogenous reactive oxygen species is an important mediator of miconazole antifungal effect. Antimicrob. Agents Chemother. 2002, 46, 3113–3117. [Google Scholar] [CrossRef] [Scilit]
  52. Cheng, J.; Park, T.S.; Chio, L.C.; Fischl, A.S.; Ye, X.S. Induction of apoptosis by sphingoid long-chain bases in Aspergillus nidulans. Mol. Cell. Biol. 2003, 23, 163–177. [Google Scholar] [CrossRef] [Scilit]
  53. Niles, B.J.; Mogri, H.; Hill, A.; Vlahakis, A.; Powers, T. Plasma membrane recruitment and activation of the AGC kinase Ypk1 is mediated by target of rapamycin complex 2 (TORC2) and its effector proteins Slm1 and Slm2. Proc. Natl. Acad. Sci. USA 2012, 109, 1536–1541. [Google Scholar] [CrossRef] [Scilit]
  54. Salazar, V.A.; Arranz-Trullén, J.; Prats-Ejarque, G.; Torrent, M.; Andreu, D.; Pulido, D.; Boix, E. Insight into the antifungal mechanism of action of human RNase N-terminus derived peptides. Int. J. Mol. Sci. 2019, 20, 4558. [Google Scholar] [CrossRef] [Scilit]
  55. Barber, S.C.; Mead, R.J.; Shaw, P.J. Oxidative stress in ALS: A mechanism of neurodegeneration and a therapeutic target. Biochim. Biophys. Acta 2006, 1762, 1051–1067. [Google Scholar] [CrossRef] [Scilit]
  56. Morici, P.; Fais, R.; Rizzato, C.; Tavanti, A.; Lupetti, A. Inhibition of Candida albicans biofilm formation by the synthetic Lactoferricin derived peptide hLF1-11. PLoS ONE 2016, 11, e0167470. [Google Scholar] [CrossRef] [Scilit]
  57. Nobile, C.J.; Nett, J.E.; Hernday, A.D.; Homann, O.R.; Deneault, J.S.; Nantel, A.; Andres, D.R.; Johnson, A.D.; Mitchell, A.P. Biofilm matrix regulation by Candida albicans Zap1. PLoS Biol. 2009, 7, e1000133. [Google Scholar] [CrossRef] [Scilit]
  58. Mukherjee, P.K.; Mohamed, S.; Chandra, J.; Kuhn, D.; Liu, S.; Antar, O.S.; Munyon, R.; Mitchell, A.P.; Andes, D.; Chance, M.R.; et al. Alcohol dehydrogenase restricts the ability of the pathogen Candida albicans to form a biofilm on catheter surfaces through an ethanol-based mechanism. Infect. Immun. 2006, 74, 3804–3816. [Google Scholar] [CrossRef] [Scilit]
  59. Clarissa, J.N.; Emily, P.F.; Jeniel, E.N.; Trevor, R.S.; Quinn, M.M.; Aaron, D.H.; Brian, B.T.; David, R.A.; Alexander, D.J. A recently evolved transcriptional network controls biofilm development in Candida albicans. Cell 2012, 148, 126–138. [Google Scholar] [CrossRef] [Scilit]
  60. Igarashi, K.; Kashiwagi, K. Characteristics of cellular polyamine transport in prokaryotes and eukaryotes. Plant Physiol. Biochem. 2010, 48, 506–512. [Google Scholar] [CrossRef] [Scilit]
  61. Igarashi, K.; Kashiwagi, K. Modulation of cellular function by polyamines. Int. J. Biochem. Cell Biol. 2010, 42, 39–51. [Google Scholar] [CrossRef] [Scilit]
  62. Fan, Y.; He, H.; Dong, Y.; Pan, H. Hyphae-specific genes HGC1, ALS3, HWP1, and ECE1 and relevant signaling pathways in Candida albicans. Mycopathologia 2013, 176, 329–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Lee, J.H.; Kim, Y.G.; Choi, P.J.; Ham, J.Y.; Park, J.G.; Lee, J.T. Antibiofilm and antivirulence activities of 6-Gingerol and 6-Shogaol against Candida albicans due to hyphal inhibition. Front. Cell. Infect. Microbiol. 2018, 8, 299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Robertson, L.S.; Causton, H.C.; Young, R.A.; Fink, G.R. The yeast A-kinases differentially regulate iron uptake and respiratory function. Proc. Natl. Acad. Sci. USA 2000, 97, 5984–5988. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Tamura, T.; Asahara, M.; Yamamoto, M.; Yamaura, M.; Matsumura, M.; Goto, K.; Rezaei-Matehkolaei, A.; Mirhendi, H.; Makimura, M.; Makimura, K. In vitro susceptibility of dermatomycoses agents to six antifungal drugs and evaluation by fractional inhibitory concentration index of combined effects of amorolfine and itraconazole in dermatophytes. Microbiol. Immunol. 2014, 58, 1–8. [Google Scholar] [CrossRef] [Scilit]
  66. Odds, F.C. Synergy, antagonism, and what the chequerboard puts between them. J. Antimicrob. Chemother. 2003, 52, 1. [Google Scholar] [CrossRef] [Scilit]
  67. Bahn, Y.S.; Sundstrom, P. CAP1, an adenylate cyclase-associated protein gene, regulates bud-hypha transitions, filamentous growth, and cyclic AMP levels and is required for virulence of Candida albicans. J. Bacteriol. 2001, 183, 3211–3223. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Chemical structure of sclareol.
Figure 1. Chemical structure of sclareol.
Jof 09 00098 g001
Figure 2. The growth of C. albicans was inhibited by treatment with sclareol. C. albicans (OD600 = 0.05) cells were cultured with 25–100 μg/mL of sclareol for 24 h at 30 °C. The growth was monitored by change in absorbance at 600. Data are presented as mean ± SD from three independent experiments.
Figure 2. The growth of C. albicans was inhibited by treatment with sclareol. C. albicans (OD600 = 0.05) cells were cultured with 25–100 μg/mL of sclareol for 24 h at 30 °C. The growth was monitored by change in absorbance at 600. Data are presented as mean ± SD from three independent experiments.
Jof 09 00098 g002
Figure 3. Sclareol-induced apoptosis-like cell death of C. albicans: (a) Propidium iodide (PI) staining showed fungal apoptosis-like cell death, a response caused by sclareol. Before fluorescent staining, C. albicans was cultured in YPD, and then treated with indicated concentration of sclareol for 2 h at 30 °C. (b) Sclareol induced depolarization of mitochondrial membrane potential in C. albicans. Visualization by fluorescent microscopy of C. albicans stained with JC-1. C. albicans was cultured in YPD, and then treated with indicated concentrations of sclareol for 2 h at 30 °C. Cells were washed with PBS and stained with 0.5 μM of JC-1 for 15 min. (c) Sclareol-induced apoptosis in C. albicans by increasing ROS levels. The graph shows intracellular ROS levels in 25–100 μg/mL sclareol-treated cells at 2 h. Cells were stained with dihydroethidium and analyzed by reading excitation and emission wavelengths of 480 and 580 nm, respectively. Data are presented as the mean ± SD of triplicate experiments. * p < 0.05 was considered significant. (d) Sclareol induced the expression of apoptosis-related genes of C. albicans. mRNA of C. albicans (KCTC7965) was obtained after 24 h treatment. A total 6.25–50 μg/mL of sclareol was used for treatment. M6.25 represents 6.25 μg/mL of miconazole. Data are presented as the mean ± SD of triplicate experiments. * = p < 0.05 was considered significant. (e) Sclareol induced the expression of SOD genes of C. albicans. Data are presented as the mean ± SD of triplicate experiments. * p < 0.05 was considered significant. (f) The predicted pathway of apoptosis in C. albicans induced by sclareol.
Figure 3. Sclareol-induced apoptosis-like cell death of C. albicans: (a) Propidium iodide (PI) staining showed fungal apoptosis-like cell death, a response caused by sclareol. Before fluorescent staining, C. albicans was cultured in YPD, and then treated with indicated concentration of sclareol for 2 h at 30 °C. (b) Sclareol induced depolarization of mitochondrial membrane potential in C. albicans. Visualization by fluorescent microscopy of C. albicans stained with JC-1. C. albicans was cultured in YPD, and then treated with indicated concentrations of sclareol for 2 h at 30 °C. Cells were washed with PBS and stained with 0.5 μM of JC-1 for 15 min. (c) Sclareol-induced apoptosis in C. albicans by increasing ROS levels. The graph shows intracellular ROS levels in 25–100 μg/mL sclareol-treated cells at 2 h. Cells were stained with dihydroethidium and analyzed by reading excitation and emission wavelengths of 480 and 580 nm, respectively. Data are presented as the mean ± SD of triplicate experiments. * p < 0.05 was considered significant. (d) Sclareol induced the expression of apoptosis-related genes of C. albicans. mRNA of C. albicans (KCTC7965) was obtained after 24 h treatment. A total 6.25–50 μg/mL of sclareol was used for treatment. M6.25 represents 6.25 μg/mL of miconazole. Data are presented as the mean ± SD of triplicate experiments. * = p < 0.05 was considered significant. (e) Sclareol induced the expression of SOD genes of C. albicans. Data are presented as the mean ± SD of triplicate experiments. * p < 0.05 was considered significant. (f) The predicted pathway of apoptosis in C. albicans induced by sclareol.
Jof 09 00098 g003
Figure 4. Sclareol inhibited the biofilm formation of C. albicans. (a) C. albicans biofilm was formed in medium with or without sclareol (3.125–50 μg/mL) at 37 °C for 24 h. Data are presented as the mean ± SD of triplicate experiments. * p < 0.05 was considered significant. (b) Sclareol inhibited the expression of genes related with biofilm formation in C. albicans. mRNA of C. albicans (KCTC7965) was obtained after 24 h treatment in biofilm formation condition. Data are presented as mean ± SD from three independent experiments. * p < 0.05.
Figure 4. Sclareol inhibited the biofilm formation of C. albicans. (a) C. albicans biofilm was formed in medium with or without sclareol (3.125–50 μg/mL) at 37 °C for 24 h. Data are presented as the mean ± SD of triplicate experiments. * p < 0.05 was considered significant. (b) Sclareol inhibited the expression of genes related with biofilm formation in C. albicans. mRNA of C. albicans (KCTC7965) was obtained after 24 h treatment in biofilm formation condition. Data are presented as mean ± SD from three independent experiments. * p < 0.05.
Jof 09 00098 g004
Figure 5. Sclareol inhibited the hyphal formation of C. albicans. (a) Sclareol inhibited the hyphal formation of C. albicans in broth media. C. albicans hyphae was formed in a medium supplemented with FBS with or without sclareol (3.75–50 μg/mL) at 37 °C for 24 h. (b) Sclareol inhibited the filamentation of C. albicans on spider medium. C. albicans cells were cultured on the spider media plates with sclareol for 7 days at 37 °C. (c) Percentage of hyphal form of C. albicans in broth media. Data are presented as the mean ± SD of triplicate experiments. * p < 0.05 was considered significant. (d) Sclareol inhibited the expression of genes related with hyphal formation in C. albicans. Data are presented as mean values ± SD of triplicate experiments. * p < 0.05 was considered significant.
Figure 5. Sclareol inhibited the hyphal formation of C. albicans. (a) Sclareol inhibited the hyphal formation of C. albicans in broth media. C. albicans hyphae was formed in a medium supplemented with FBS with or without sclareol (3.75–50 μg/mL) at 37 °C for 24 h. (b) Sclareol inhibited the filamentation of C. albicans on spider medium. C. albicans cells were cultured on the spider media plates with sclareol for 7 days at 37 °C. (c) Percentage of hyphal form of C. albicans in broth media. Data are presented as the mean ± SD of triplicate experiments. * p < 0.05 was considered significant. (d) Sclareol inhibited the expression of genes related with hyphal formation in C. albicans. Data are presented as mean values ± SD of triplicate experiments. * p < 0.05 was considered significant.
Jof 09 00098 g005
Figure 6. The schematic diagram of anti-fungal effect of sclareol against C. albicans.
Figure 6. The schematic diagram of anti-fungal effect of sclareol against C. albicans.
Jof 09 00098 g006
Table 1. List of qRT-PCR primers.
Table 1. List of qRT-PCR primers.
GenePrimer SequenceFunctionReferences
ACT1F: TAGGTTTGGAAGCTGCTGG
R: CCTGGGAACATGGTAGTAC
Control[39]
MCA1F: TATAATAGACCTTCTGGAC
R: TTGGTGGACGAGAATAATG
ApoptosisIn this study
HSP90F: GGGAATCTAACGCTGGTGGTAA
R: TTCGGTTTCTGGAACTTCTTTT
ApoptosisIn this study
YPK1F: CAACACAACACAGTAGCACC
R: GTTGTGGATAAAGGTGGTTCG
ApoptosisIn this study
SOD1F: TTAAAGCTGTCGCTGTTGTC
R: AATATGGAAACCTCTCAAGGC
AntioxidantIn this study
SOD2F: AACTTGGCTCCTGTCTC
R: TATCACCATTGGCTTTG
AntioxidantIn this study
SOD3F: TATCACCATTGGCTTTG
R: TATCACCATTGGCTTTG
AntioxidantIn this study
SOD5F: ACGAGGGACACGGCAATGCT
R: ACGAGGGACACGGCAATGCT
AntioxidantIn this study
SOD6F: GACCCCGACCCACCTCAACAA
R: GGGTAGCAAGGAGTGCCGGT
AntioxidantIn this study
ZAP1F: ATCTGTCCAGTGTTGTTTGTA
R: AGGTCTCTTTGAAAGTTGTG
Biofilm[39]
ADH5F: ACCTGCAAGGGCTCATTCTG
R: CGGCTCTCAACTTCTCCATA
Biofilm[39]
CSH1F: CGTGAGGACGAGAGAGAAT
R: CGAATGGACGACACAAAACA
Biofilm[39]
TPO4F: GCTGCTACCAATGTCAGTCC
R: ACGGAGCTATCCGAATCGTC
BiofilmIn this study
CAN2F: GCGGAATGGATATGCATGGG
R: CGGATTGCTCTTGGAGAAGC
Biofilm[39]
ALS3F: GGTTATCGTCCATTTGTTG
R: TTCTGTATCCAGTCCATCT
Hyphae[39]
CYR1F: GTTTCCCCCACCACTCA
R: TTGCGGTAATGACACAACAG
Hyphae[39]
ECE1F: ACAGTTTCCAGGACGCCAT
R: ATTGTTGCTCGTGTTGCCA
Hyphae[39]
TPK1F: CCAACGATTCCCTACTCCAG
R: GCAATATAATCTGGAGTCCCAC
HyphaeIn this study
Table 2. Anti-fungal effects of Sclareol against Candida spp.
Table 2. Anti-fungal effects of Sclareol against Candida spp.
Candida spp.Sclareol [μg/mL]
24 h48 h72 h
C. albicans (KCTC7965)50100100
C. auris (KCTC17809)50>100>100
C. glabrata (KCTC7219)>100>100>100
C. parapsilosis var. parapsilosis (KACC45480)50>100>100
C. parapsilosis (KACC49573)>100>100>100
C. tropicalis var. tropicalis (KCTC17762)>100>100>100
Table 3. Sclareol showed fungistatic activity against C. albicans.
Table 3. Sclareol showed fungistatic activity against C. albicans.
Candida spp.Sclareol [μg/mL]
MICMFC
C. albicans (KCTC7965)50100
Table 4. Sclareol synergistically inhibited the growth of C. albicans with miconazole.
Table 4. Sclareol synergistically inhibited the growth of C. albicans with miconazole.
Candida spp.MIC(μg/mL) of MiconazoleMIC(μg/mL) of SclareolFICISynergy
AloneWith SclareolAloneWith Miconazole
C. albicans (KCTC7965)3.1250.78503.1250.31Synergy
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Kim, C.; Kim, J.-G.; Kim, K.-Y. Anti-Candida Potential of Sclareol in Inhibiting Growth, Biofilm Formation, and Yeast–Hyphal Transition. J. Fungi 2023, 9, 98. https://doi.org/10.3390/jof9010098

AMA Style

Kim C, Kim J-G, Kim K-Y. Anti-Candida Potential of Sclareol in Inhibiting Growth, Biofilm Formation, and Yeast–Hyphal Transition. Journal of Fungi. 2023; 9(1):98. https://doi.org/10.3390/jof9010098

Chicago/Turabian Style

Kim, Chaerim, Jae-Goo Kim, and Ki-Young Kim. 2023. "Anti-Candida Potential of Sclareol in Inhibiting Growth, Biofilm Formation, and Yeast–Hyphal Transition" Journal of Fungi 9, no. 1: 98. https://doi.org/10.3390/jof9010098

APA Style

Kim, C., Kim, J.-G., & Kim, K.-Y. (2023). Anti-Candida Potential of Sclareol in Inhibiting Growth, Biofilm Formation, and Yeast–Hyphal Transition. Journal of Fungi, 9(1), 98. https://doi.org/10.3390/jof9010098

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop