Trichoderma hamatum Strain Th23 Promotes Tomato Growth and Induces Systemic Resistance against Tobacco Mosaic Virus
Abstract
1. Introduction
2. Materials and Methods
2.1. Collecting, Isolating, and Identifying Samples
2.2. TMV Isolate, Inoculum Preparation, and Greenhouse Investigation
2.3. Determination of Enzyme Activity
2.3.1. Oxidative Stress Markers
Malondialdehyde
Hydrogen Peroxide
2.3.2. Antioxidant Enzymes
Polyphenol Oxidase
Catalase
Superoxide Dismutase
2.4. Analysis of Defense-Related Genes
2.4.1. Extraction of RNA and cDNA Synthesis
2.4.2. Quantitative Real-Time PCR (qRT-PCR) Assays
2.5. Statistical Analysis
3. Results
3.1. Isolation and Identification of Trichoderma Isolate
3.2. Effect of Th23 on Viral Symptoms Development, Tomato Plants Growth Parameters, and Total Chlorophyll Content
3.3. Effect of Th23 Application on TMV Accumulation Level
3.4. Oxidative Stress Markers Assay
3.5. Antioxidant Enzymes Activity
3.6. Transcriptional Levels of Defense-Related Genes
3.6.1. Polyphenolic Biosynthetic Pathway
3.6.2. Pathogenesis-Related Proteins
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ge, Y.-H.; Liu, K.-X.; Zhang, J.-X.; Mu, S.-Z.; Hao, X.-J. The Limonoids and Their Antitobacco Mosaic Virus (TMV) Activities from Munronia unifoliolata Oliv. J. Agric. Food Chem. 2012, 60, 4289–4295. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Sanan-Mishra, N. A comparative analysis of the suppressor activity of Tobacco mosaic virus proteins in the tomato plant. Jordan J. Biol. Sci. 2018, 11, 469–473. [Google Scholar]
- Scholthof, K.-B.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P.; et al. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011, 12, 938–954. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ara, I.; Bukhari, N.A.; Aref, N.M.; Shinwari, M.M.A.; Bakir, M.A. Antiviral activities of streptomycetes against tobacco mosaic virus (TMV) in Datura plant: Evaluation of different organic compounds in their metabolites. Afr. J. Biotechnol. 2012, 11, 2130–2138. [Google Scholar]
- Elsharkawy, M.M. Induced systemic resistance against Cucumber mosaic virus by Phoma sp. GS8-2 stimulates transcription of pathogenesis-related genes in Arabidopsis. Pest Manag. Sci. 2019, 75, 859–866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Ozaki, K.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus in Arabidopsis thaliana by Trichoderma asperellum SKT-1. Plant Pathol. J. 2013, 29, 193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benítez, T.; Rincón, A.M.; Limón, M.C.; Codón, A.C. Biocontrol mechanisms of Trichoderma strains. Int. Microbiol. 2004, 7, 249–260. [Google Scholar] [PubMed]
- Harman, G.E. Overview of Mechanisms and Uses of Trichoderma spp. Phytopathology 2006, 96, 190–194. [Google Scholar] [CrossRef] [Scilit]
- Harman, G.E.; Howell, C.R.; Viterbo, A.; Chet, I.; Lorito, M. Trichoderma species—Opportunistic, avirulent plant symbionts. Nat. Rev. Microbiol. 2004, 2, 43–56. [Google Scholar] [CrossRef] [Scilit]
- Shoresh, M.; Harman, G.E.; Mastouri, F. Induced Systemic Resistance and Plant Responses to Fungal Biocontrol Agents. Annu. Rev. Phytopathol. 2010, 48, 21–43. [Google Scholar] [CrossRef] [Scilit]
- Mathys, J.; De Cremer, K.; Timmermans, P.; Van Kerckhove, S.; Lievens, B.; Vanhaecke, M.; Cammue, B.P.A.; De Coninck, B. Genome-Wide Characterization of ISR Induced in Arabidopsis thaliana by Trichoderma hamatum T382 Against Botrytis cinerea Infection. Front. Plant Sci. 2012, 3, 108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alfano, G.; Ivey, M.L.L.; Cakir, C.; Bos, J.I.B.; Miller, S.A.; Madden, L.; Kamoun, S.; Hoitink, H.A.J. Systemic Modulation of Gene Expression in Tomato by Trichoderma hamatum 382. Phytopathology 2007, 97, 429–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mastouri, F.; Björkman, T.; Harman, G.E. Seed treatment with Trichoderma harzianum alleviates biotic, abiotic, and physiological stresses in germinating seeds and seedlings. Phytopathology 2010, 100, 1213–1221. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harman, G.E.; Herrera-Estrella, A.H.; Horwitz, B.A.; Lorito, M. Trichoderma—From basic biology to biotechnology. Microbiology 2012, 158, 1–2. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vitti, A.; La Monaca, E.; Sofo, A.; Scopa, A.; Cuypers, A.; Nuzzaci, M. Beneficial effects of Trichoderma harzianum T-22 in tomato seedlings infected by Cucumber mosaic virus (CMV). BioControl 2014, 60, 135–147. [Google Scholar] [CrossRef] [Scilit]
- Bari, R.; Jones, J.D.G. Role of plant hormones in plant defence responses. Plant Mol. Biol. 2008, 69, 473–488. [Google Scholar] [CrossRef] [Scilit]
- Vitti, A.; Nuzzaci, M.; Scopa, A.; Tataranni, G.; Remans, T.; Vangronsveld, J.; Sofo, A. Auxin and Cytokinin Metabolism and Root Morphological Modifications in Arabidopsis thaliana Seedlings Infected with Cucumber mosaic virus (CMV) or Exposed to Cadmium. Int. J. Mol. Sci. 2013, 14, 6889–6902. [Google Scholar] [CrossRef] [Scilit]
- Ali, S.; Ganai, B.A.; Kamili, A.N.; Bhat, A.A.; Mir, Z.A.; Bhat, J.A.; Tyagi, A.; Islam, S.T.; Mushtaq, M.; Yadav, P. Patho-genesis-related proteins and peptides as promising tools for engineering plants with multiple stress tolerance. Microbiol. Res. 2018, 212, 29–37. [Google Scholar] [CrossRef] [Scilit]
- Singh, N.; Pandey, P.; Dubey, R.; Maheshwari, D.K. Biological control of root rot fungus Macrophomina phaseolina and growth enhancement of Pinus roxburghii (Sarg.) by rhizosphere competent Bacillus subtilis BN1. World J. Microbiol. Biotechnol. 2008, 24, 1669–1679. [Google Scholar] [CrossRef] [Scilit]
- Dempsey, D.A.; Vlot, A.C.; Wildermuth, M.C.; Klessig, D.F. Salicylic Acid Biosynthesis and Metabolism. Arab. Book 2011, 9, e0156. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Al-Askar, A.A.; Alsubaie, M.M.; Behiry, S.I. First Report of Protective Activity of Paronychia argentea Extract against Tobacco Mosaic Virus Infection. Plants 2021, 10, 2435. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Akyol, H.; Riciputi, Y.; Capanoglu, E.; Caboni, M.F.; Verardo, V. Phenolic Compounds in the Potato and Its Byproducts: An Overview. Int. J. Mol. Sci. 2016, 17, 835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shoresh, M.; Harman, G.E. Differential expression of maize chitinases in the presence or absence of Trichoderma harzianum strain T22 and indications of a novel exo- endo-heterodimeric chitinase activity. BMC Plant Biol. 2010, 10, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Contreras-Cornejo, H.A.; Macías-Rodríguez, L.; Cortés-Penagos, C.; López-Bucio, J. Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxin-dependent mechanism in Arabidopsis. Plant Physiol. 2009, 149, 1579–1592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hermosa, R.; Rubio, M.B.; Cardoza, R.E.; Nicolás, C.; Monte, E.; Gutiérrez, S. The contribution of Trichoderma to balancing the costs of plant growth and defense. Int. Microbiol. 2013, 16, 69–80. [Google Scholar]
- Mukherjee, P.K.; Horwitz, B.A.; Herrera-Estrella, A.; Schmoll, M.; Kenerley, C.M. Trichoderma Research in the Genome Era. Annu. Rev. Phytopathol. 2013, 51, 105–129. [Google Scholar] [CrossRef] [Scilit]
- Siddaiah, C.N.; Satyanarayana, N.R.; Mudili, V.; Gupta, V.K.; Gurunathan, S.; Rangappa, S.; Huntrike, S.S.; Srivastava, R.K. Elicitation of resistance and associated defense responses in Trichoderma hamatum induced protection against pearl millet downy mildew pathogen. Sci. Rep. 2017, 7, 43991. [Google Scholar] [CrossRef] [Scilit]
- Zin, N.A.; Badaluddin, N.A. Biological functions of Trichoderma spp. for agriculture applications. Ann. Agric. Sci. 2020, 65, 168–178. [Google Scholar] [CrossRef] [Scilit]
- Elad, Y.; Chet, I.; Henis, Y. A selective medium for improving quantitative isolation of Trichoderma spp. from soil. Phytoparasitica 1981, 9, 59–67. [Google Scholar] [CrossRef] [Scilit]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J.W. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M.A., Gelfand, D.H., Sninsky, J.J., White, T.J., Eds.; Academic Press: Cambridge, MA, USA, 1990; Volume 18, pp. 315–322. [Google Scholar]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef] [Scilit]
- Hatvani, L.; Antal, Z.; Manczinger, L.; Szekeres, A.; Druzhinina, I.S.; Kubicek, C.P.; Nagy, A.; Nagy, E.; Vágvölgyi, C.; Kredics, L. Green mold diseases of Agaricus and Pleurotus spp. are caused by related but phylogenetically different Trichoderma species. Phytopathology 2007, 97, 532–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, L.; Dong, J.; Hu, Z.; Li, S.; Su, X.; Zhang, J.; Yin, Y.; Xu, T.; Zhang, Z.; Chen, H. Anti-TMV activity and functional mechanisms of two sesquiterpenoids isolated from Tithonia diversifolia. Pestic. Biochem. Physiol. 2017, 140, 24–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kavroulakis, N.; Ehaliotis, C.; Ntougias, S.; Zervakis, G.; Papadopoulou, K.K. Local and systemic resistance against fungal pathogens of tomato plants elicited by a compost derived from agricultural residues. Physiol. Mol. Plant Pathol. 2005, 66, 163–174. [Google Scholar] [CrossRef] [Scilit]
- André, C.M.; Schafleitner, R.; Legay, S.; Lefèvre, I.; Aliaga, C.A.A.; Nomberto, G.; Hoffmann, L.; Hausman, J.-F.; Larondelle, Y.; Evers, D. Gene expression changes related to the production of phenolic compounds in potato tubers grown under drought stress. Phytochemistry 2009, 70, 1107–1116. [Google Scholar] [CrossRef] [Scilit]
- Sagi, M.; Davydov, O.; Orazova, S.; Yesbergenova, Z.; Ophir, R.; Stratmann, J.W.; Fluhr, R. Plant Respiratory Burst Oxidase Homologs Impinge on Wound Responsiveness and Development in Lycopersicon esculentum [W]. Plant Cell 2004, 16, 616–628. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A. Expression of tomato pathogenesis related genes in response to Tobacco mosaic virus. JAPS J. Anim. Plant Sci. 2019, 29, 1596–1602. [Google Scholar]
- Abdelkhalek, A.; Ismail, I.A.; Dessoky, E.S.; El-Hallous, E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef] [Scilit]
- Heath, R.L.; Packer, L. Photoperoxidation in isolated chloroplasts: I. Kinetics and stoichiometry of fatty acid peroxidation. Arch. Biochem. Biophys. 1968, 125, 189–198. [Google Scholar] [CrossRef] [Scilit]
- Velikova, V.; Yordanov, I.; Edreva, A. Oxidative stress and some antioxidant systems in acid rain-treated bean plants: Protective role of exogenous polyamines. Plant Sci. 2000, 151, 59–66. [Google Scholar] [CrossRef] [Scilit]
- Cho, Y.K.; Ahn, H.K. Purification and characterization of polyphenol oxidase from potato: II. Inhibition and catalytic mechanism. J. Food Biochem. 1999, 23, 593–605. [Google Scholar] [CrossRef] [Scilit]
- Cakmak, I.; Marschner, H. Magnesium Deficiency and High Light Intensity Enhance Activities of Superoxide Dismutase, Ascorbate Peroxidase, and Glutathione Reductase in Bean Leaves. Plant Physiol. 1992, 98, 1222–1227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Beauchamp, C.; Fridovich, I. Superoxide dismutase: Improved assays and an assay applicable to acrylamide gels. Anal. Biochem. 1971, 44, 276–287. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Dessoky, E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
- Abo-Zaid, G.A.; Matar, S.M.; Abdelkhalek, A. Induction of Plant Resistance against Tobacco Mosaic Virus Using the Bio-control Agent Streptomyces cellulosae Isolate Actino 48. Agronomy 2020, 10, 1620. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Al-Askar, A.A.; Hafez, E. Differential induction and suppression of the potato innate immune system in response to Alfalfa mosaic virus infection. Physiol. Mol. Plant Pathol. 2020, 110, 101485. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Hafez, E. Plant Viral Diseases in Egypt and Their Control. In Cottage Industry of Biocontrol Agents and Their Applications; Springer: Berlin/Heidelberg, Germany, 2020; pp. 403–421. [Google Scholar]
- Błaszczyk, L.; Popiel, D.; Chełkowski, J.; Koczyk, G.; Samuels, G.J.; Sobieralski, K.; Siwulski, M. Species diversity of Trichoderma in Poland. J. Appl. Genet. 2011, 52, 233–243. [Google Scholar] [CrossRef] [Scilit]
- Prabhakaran, N.; Prameeladevi, T.; Sathiyabama, M.; Kamil, D. Multiplex PCR for detection and differentiation of diverse Trichoderma species. Ann. Microbiol. 2014, 65, 1591–1595. [Google Scholar] [CrossRef] [Scilit]
- Feitosa, Y.B.; Cruz-Magalhães, V.; Argolo-Filho, R.C.; De Souza, J.T.; Loguercio, L.L. Characterization of genetic diversity on tropical Trichoderma germplasm by sequencing of rRNA internal transcribed spacers. BMC Res. Notes 2019, 12, 663. [Google Scholar] [CrossRef] [Scilit]
- Matheny, P.B. Improving phylogenetic inference of mushrooms with RPB1 and RPB2 nucleotide sequences (Inocybe; Agaricales). Mol. Phylogenet. Evol. 2005, 35, 1–20. [Google Scholar] [CrossRef] [Scilit]
- Devi, P.; Prabhakaran, N.; Kamil, D.; Pandey, P.; Borah, J.L. Characterization of Indian native isolates of Trichoderma spp. and assessment of their bio-control efficiency against plant pathogens. Afr. J. Biotechnol. 2012, 11, 15150–15160. [Google Scholar]
- Yedidia, I.; Srivastva, A.K.; Kapulnik, Y.; Chet, I. Effect of Trichoderma harzianum on microelement concentrations and increased growth of cucumber plants. Plant Soil 2001, 235, 235–242. [Google Scholar] [CrossRef] [Scilit]
- Harman, G.E. Myths and Dogmas of Biocontrol Changes in Perceptions Derived from Research on Trichoderma harzinum T-22. Plant Dis. 2000, 84, 377–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heflish, A.; Abdelkhalek, A.; Al-Askar, A.; Behiry, S. Protective and Curative Effects of Trichoderma asperelloides Ta41 on Tomato Root Rot Caused by Rhizoctonia solani Rs33. Agronomy 2021, 11, 1162. [Google Scholar] [CrossRef] [Scilit]
- Tamandegani, P.R.; Sharifnabi, B.; Massah, A.; Zahravi, M. Induced reprogramming of oxidative stress responses in cu-cumber by Trichoderma asperellum (Iran 3062C) enhances defense against cucumber mosaic virus. Biol. Control. 2021, 164, 104779. [Google Scholar] [CrossRef] [Scilit]
- Petrova, D.; Chaneva, G.; Stoimenova, E.; Kapchina-Toteva, V. Effect of cucumber mosaic virus on the contents of chlo-rophyll, proline, the degree of lipid peroxidation and phenotypic expression of pepper lines with different susceptibility to virus. Oxid. Commun. 2012, 35, 182–189. [Google Scholar]
- Martinez-Medina, A.; Roldan, A.; Pascual, J. Performance of a Trichoderma harzianum Bentonite—Vermiculite Formulation Against Fusarium Wilt in Seedling Nursery Melon Plants. HortScience 2009, 44, 2025–2027. [Google Scholar] [CrossRef] [Scilit]
- Tchameni, S.N.; Sameza, M.L.; O’Donovan, A.; Fokom, R.; Ngonkeu, E.L.M.; Nana, L.W.; Etoa, F.-X.; Nwaga, D. Antagonism of Trichoderma asperellum against Phytophthora megakarya and its potential to promote cacao growth and induce biochemical defence. Mycology 2017, 8, 84–92. [Google Scholar] [CrossRef] [Scilit]
- Harman, G.E. Multifunctional fungal plant symbionts: New tools to enhance plant growth and productivity. New Phytol. 2011, 189, 647–649. [Google Scholar] [CrossRef] [Scilit]
- Vitti, A.; Pellegrini, E.; Nali, C.; Lovelli, S.; Sofo, A.; Valerio, M.; Scopa, A.; Nuzzaci, M. Trichoderma harzianum T-22 Induces Systemic Resistance in Tomato Infected by Cucumber mosaic virus. Front. Plant Sci. 2016, 7, 1520. [Google Scholar] [CrossRef] [Scilit]
- Huang, H.; Ullah, F.; Zhou, D.-X.; Yi, M.; Zhao, Y. Mechanisms of ROS Regulation of Plant Development and Stress Responses. Front. Plant Sci. 2019, 10, 800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taheri, P.; Kakooee, T. Reactive oxygen species accumulation and homeostasis are involved in plant immunity to an opportunistic fungal pathogen. J. Plant Physiol. 2017, 216, 152–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, X.-S.; Wang, Y.-J.; Mao, W.-H.; Shi, K.; Zhou, Y.-H.; Nogués, S.; Yu, J.-Q. Effects of cucumber mosaic virus infection on electron transport and antioxidant system in chloroplasts and mitochondria of cucumber and tomato leaves. Physiol. Plant. 2009, 135, 246–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sorahinobar, M.; Soltanloo, H.; Niknam, V.; Ebrahimzadeh, H.; Moradi, B.; Safaie, N.; Behmanesh, M.; Bahram, M. Physiological and molecular responses of resistant and susceptible wheat cultivars to Fusarium graminearum mycotoxin extract. Can. J. Plant Pathol. 2017, 39, 444–453. [Google Scholar] [CrossRef] [Scilit]
- Luo, Y.; Zhang, D.-D.; Dong, X.-W.; Zhao, P.-B.; Chen, L.-L.; Song, X.-Y.; Wang, X.-J.; Chen, X.-L.; Shi, M.; Zhang, Y.-Z. Antimicrobial peptaibols induce defense responses and systemic resistance in tobacco against tobacco mosaic virus. FEMS Microbiol. Lett. 2010, 313, 120–126. [Google Scholar] [CrossRef] [Scilit]
- Sobhy, S.E.; Abo-Kassem, E.-E.M.; Sewelam, N.A.; Hafez, E.E.; Aseel, D.G.; Saad-Allah, K.M. Pre-soaking in Weed Extracts is a Reasonable Approach to Mitigate Fusarium graminearum Infection in Wheat. J. Plant Growth Regul. 2021, 1–18. [Google Scholar] [CrossRef] [Scilit]
- Loreto, F.; Velikova, V. Isoprene Produced by Leaves Protects the Photosynthetic Apparatus against Ozone Damage, Quenches Ozone Products, and Reduces Lipid Peroxidation of Cellular Membranes. Plant Physiol. 2001, 127, 1781–1787. [Google Scholar] [CrossRef]
- Anthony, K.K.; George, D.S.; Singh, H.K.B.; Fung, S.M.; Santhirasegaram, V.; Razali, Z.; Somasundram, C. Reactive Oxygen Species Activity and Antioxidant Properties of Fusarium Infected Bananas. J. Phytopathol. 2017, 165, 213–222. [Google Scholar] [CrossRef] [Scilit]
- Garg, N.; Manchanda, G. ROS generation in plants: Boon or bane? Plant Biosyst. 2009, 143, 81–96. [Google Scholar] [CrossRef] [Scilit]
- Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [Scilit]
- Masuta, C.; Inaba, J.; Shimura, H. The 2b proteins of Cucumber mosaic virus generally have the potential to differentially induce necrosis on Arabidopsis. Plant Signal. Behav. 2012, 7, 43–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mathioudakis, M.M.; Veiga, R.S.L.; Canto, T.; Medina, V.; Mossialos, D.; Makris, A.M.; Livieratos, I. P epino mosaic virus triple gene block protein 1 (TGBp1) interacts with and increases tomato catalase 1 activity to enhance virus accumulation. Mol. Plant Pathol. 2013, 14, 589–601. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mondal, S.; Phadke, R.R.; Badigannavar, A.M. Genetic variability for total phenolics, flavonoids and antioxidant activity of testaless seeds of a peanut recombinant inbred line population and identification of their controlling QTLs. Euphytica 2014, 204, 311–321. [Google Scholar] [CrossRef] [Scilit]
- Zhang, P.; Zhou, M.P.; Zhang, X.; Huo, Y.; Ma, H.X. Change of defensive-related enzyme in wheat crown rot seedlings infected byFusarium graminearum. Cereal Res. Commun. 2013, 41, 431–439. [Google Scholar] [CrossRef] [Scilit]
- Martinez, C.; Montillet, J.L.; Bresson, E.; Agnel, J.P.; Dai, G.H.; Daniel, J.F.; Geiger, J.P.; Nicole, M. Apoplastic Peroxidase Generates Superoxide Anions in Cells of Cotton Cotyledons Undergoing the Hypersensitive Reaction to Xanthomonas campestris pv. malvacearum Race 18. Mol. Plant-Microbe Interact. 1998, 11, 1038–1047. [Google Scholar] [CrossRef] [Scilit]
- Murphy, J.F.; Reddy, M.S.; Ryu, C.-M.; Kloepper, J.W.; Li, R. Rhizobacteria-Mediated Growth Promotion of Tomato Leads to Protection Against Cucumber mosaic virus. Phytopathology 2003, 93, 1301–1307. [Google Scholar] [CrossRef] [Scilit]
- Smit, F.; Dubery, I.A. Cell wall reinforcement in cotton hypocotyls in response to a Verticillium dahliae elicitor. Phytochemistry 1997, 44, 811–815. [Google Scholar] [CrossRef] [Scilit]
- Li, L.; Steffens, J.C. Overexpression of polyphenol oxidase in transgenic tomato plants results in enhanced bacterial disease resistance. Planta 2002, 215, 239–247. [Google Scholar] [CrossRef] [Scilit]
- Robert-Seilaniantz, A.; Navarro, L.; Bari, R.; Jones, J.D. Pathological hormone imbalances. Curr. Opin. Plant Biol. 2007, 10, 372–379. [Google Scholar] [CrossRef] [Scilit]
- Niggeweg, R.; Michael, A.J.; Martin, C. Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat. Biotechnol. 2004, 22, 746–754. [Google Scholar] [CrossRef] [Scilit]
- Tsao, R.; Marvin, C.H.; Broadbent, A.B.; Friesen, M.; Allen, W.R.; McGarvey, B.D. Evidence for an isobutylamide associated with host-plant resistance to western flower thrips, Frankliniella occidentalis, in chrysanthemum. J. Chem. Ecol. 2005, 31, 103–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Leiss, K.A.; Maltese, F.; Choi, Y.H.; Verpoorte, R.; Klinkhamer, P.G. Identification of Chlorogenic Acid as a Resistance Factor for Thrips in Chrysanthemum. Plant Physiol. 2009, 150, 1567–1575. [Google Scholar] [CrossRef] [Scilit]
- Yedidia, I.; Shoresh, M.; Kerem, Z.; Benhamou, N.; Kapulnik, Y.; Chet, I. Concomitant induction of systemic resistance to Pseudomonas syringae pv. lachrymans in cucumber by Trichoderma asperellum (T-203) and accumulation of phytoalexins. Appl. Environ. Microbiol. 2003, 69, 7343–7353. [Google Scholar] [PubMed]
- Singh, B.N.; Singh, A.; Singh, S.P.; Singh, H.B. Trichoderma harzianum-mediated reprogramming of oxidative stress response in root apoplast of sunflower enhances defence against Rhizoctonia solani. Eur. J. Plant Pathol. 2011, 131, 121–134. [Google Scholar] [CrossRef] [Scilit]
- Dao, T.T.H.; Linthorst, H.J.M.; Verpoorte, R. Chalcone synthase and its functions in plant resistance. Phytochem. Rev. 2011, 10, 397–412. [Google Scholar] [CrossRef] [Scilit]
- Abdelkhalek, A.; Al-Askar, A.A.; Behiry, S.I. Bacillus licheniformis strain POT1 mediated polyphenol biosynthetic pathways genes activation and systemic resistance in potato plants against Alfalfa mosaic virus. Sci. Rep. 2020, 10, 16120. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Martínez, G.; Regente, M.; Jacobi, S.; Del Rio, M.; Pinedo, M.; de la Canal, L. Chlorogenic acid is a fungicide active against phytopathogenic fungi. Pestic. Biochem. Physiol. 2017, 140, 30–35. [Google Scholar] [CrossRef] [Scilit]
- Kanwal, Q.; Hussain, I.; Siddiqui, H.L.; Javaid, A. Antifungal activity of flavonoids isolated from mango (Mangifera indica L.) leaves. Nat. Prod. Res. 2010, 24, 1907–1914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Loon, L.; Van Strien, E. The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol. Mol. Plant Pathol. 1999, 55, 85–97. [Google Scholar] [CrossRef] [Scilit]
- ElMorsi, A.; Abdelkhalek, A.; AlShehaby, O.; Hafez, E. Pathogenesis-related genes as tools for discovering the response of onion defence system against Iris yellow spot virus infection. Botany 2015, 93, 735–744. [Google Scholar] [CrossRef] [Scilit]
- Hoegen, E.; Strömberg, A.; Pihlgren, U.; Kombrink, E. Primary structure and tissue-specific expression of the pathogenesis-related protein PR-1b in potato. Mol. Plant Pathol. 2002, 3, 329–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelkhalek, A.; Qari, S.H.; Abu-Saied, M.A.A.-R.; Khalil, A.M.; Younes, H.A.; Nehela, Y.; Behiry, S.I. Chitosan Nano-particles Inactivate Alfalfa Mosaic Virus Replication and Boost Innate Immunity in Nicotiana glutinosa Plants. Plants 2021, 10, 2701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelkhalek, A.; Salem, M.Z.; Kordy, A.M.; Salem, A.Z.; Behiry, S.I. Antiviral, antifungal, and insecticidal activities of Eucalyptus bark extract: HPLC analysis of polyphenolic compounds. Microb. Pathog. 2020, 147, 104383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abo-Zaid, G.; Abdelkhalek, A.; Matar, S.; Darwish, M.; Abdel-Gayed, M. Application of Bio-Friendly Formulations of Chitinase-Producing Streptomyces cellulosae Actino 48 for Controlling Peanut Soil-Borne Diseases Caused by Sclerotium rolfsii. J. Fungi 2021, 7, 167. [Google Scholar] [CrossRef] [Scilit]
- Manganiello, G.; Sacco, A.; Ercolano, M.R.; Vinale, F.; Lanzuise, S.; Pascale, A.; Napolitano, M.; Lombardi, N.; Lorito, M.; Woo, S.L. Modulation of tomato response to Rhizoctonia solani by Trichoderma harzianum and its secondary metabolite harzianic acid. Front. Microbiol. 2018, 9, 1966. [Google Scholar] [CrossRef] [Scilit]
- Jordá, L.; Conejero, V.; Vera, P. Characterization of P69E and P69F, Two Differentially Regulated Genes Encoding New Members of the Subtilisin-Like Proteinase Family from Tomato Plants. Plant Physiol. 2000, 122, 67–74. [Google Scholar] [CrossRef] [Scilit]
- Roylawar, P.; Panda, S.; Kamble, A. Comparative analysis of BABA and Piriformospora indica mediated priming of de-fence-related genes in tomato against early blight. Physiol. Mol. Plant Pathol. 2015, 91, 88–95. [Google Scholar] [CrossRef] [Scilit]
- Villamil, J.C.M.; van der Hoorn, R.; Doehlemann, G. Papain-like cysteine proteases as hubs in plant immunity. New Phytol. 2016, 212, 902–907. [Google Scholar] [CrossRef] [Scilit]
- Tornero, P.; Mayda, E.; Gómez, M.D.; Cañas, L.; Conejero, V.; Vera, P. Characterization of LRP, a leucine-rich repeat (LRR) protein from tomato plants that is processed during pathogenesis. Plant J. 1996, 10, 315–330. [Google Scholar] [CrossRef] [Scilit]
- Ekchaweng, K.; Evangelisti, E.; Schornack, S.; Tian, M.; Churngchow, N. The plant defense and pathogen counterdefense mediated by Hevea brasiliensis serine protease HbSPA and Phytophthora palmivora extracellular protease inhibitor PpEPI10. PLoS ONE 2017, 12, e0175795. [Google Scholar] [CrossRef] [Scilit]
- Gillespie, T.; Boevink, P.; Haupt, S.; Roberts, A.G.; Toth, R.; Valentine, T.; Chapman, S.; Oparka, K.J. Functional Analysis of a DNA-Shuffled Movement Protein Reveals That Microtubules Are Dispensable for the Cell-to-Cell Movement of Tobacco mosaic virus. Plant Cell 2002, 14, 1207–1222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawakami, S.; Watanabe, Y.; Beachy, R.N. Tobacco mosaic virus infection spreads cell to cell as intact replication complexes. Proc. Natl. Acad. Sci. USA 2004, 101, 6291–6296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Otulak, K.; Garbaczewska, G. Cellular localisation of calcium ions during potato hypersensitive response to Potato virus Y. Micron 2011, 42, 381–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Wees, S.C.M.; Luijendijk, M.; Smoorenburg, I.; Van Loon, L.C.; Pieterse, C.M.J. Rhizobacteria-mediated induced systemic resistance (ISR) in Arabidopsis is not associated with a direct effect on expression of known defense-related genes but stim-ulates the expression of the jasmonate-inducible gene Atvsp upon challenge. Plant Mol. Biol. 1999, 41, 537–549. [Google Scholar] [CrossRef] [Scilit]
- Newman, M.; Von Roepenack-Lahaye, E.; Parr, A.; Daniels, M.J.; Dow, J.M. Prior exposure to lipopolysaccharide potentiates expression of plant defenses in response to bacteria. Plant J. 2002, 29, 487–495. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oide, S.; Bejai, S.; Staal, J.; Guan, N.; Kaliff, M.; Dixelius, C. A novel role of PR 2 in abscisic acid (ABA) mediated, pathogen-induced callose deposition in Arabidopsis thaliana. New Phytol. 2013, 200, 1187–1199. [Google Scholar] [CrossRef] [Scilit]
- Linthorst, H.J.; Melchers, L.S.; Mayer, A.; van Roekel, J.S.; Cornelissen, B.J.; Bol, J.F. Analysis of gene families encoding acidic and basic beta-1,3-glucanases of tobacco. Proc. Natl. Acad. Sci. USA 1990, 87, 8756–8760. [Google Scholar] [CrossRef] [Scilit]
- Rezzonico, E.; Flury, N.; Meins, F.; Beffa, R. Transcriptional down-regulation by abscisic acid of pathogenesis-related β-1, 3-glucanase genes in tobacco cell cultures. Plant Physiol. 1998, 117, 585–592. [Google Scholar] [CrossRef] [Scilit]
- Otulak-Kozieł, K.; Kozieł, E.; Lockhart, B. Plant cell wall dynamics in compatible and incompatible potato response to infection caused by Potato virus Y (PVYNTN). Int. J. Mol. Sci. 2018, 19, 862. [Google Scholar] [CrossRef] [Scilit]
- Bucher, G.L.; Tarina, C.; Heinlein, M.; Di Serio, F.; Meins, F., Jr.; Iglesias, V.A. Local expression of enzymatically active class I β-1, 3-glucanase enhances symptoms of TMV infection in tobacco. Plant J. 2001, 28, 361–369. [Google Scholar] [CrossRef] [Scilit]
- Dobnik, D.; Baebler, Š.; Kogovšek, P.; Pompe-Novak, M.; Štebih, D.; Panter, G.; Janež, N.; Morisset, D.; Žel, J.; Gruden, K. β-1, 3-glucanase class III promotes spread of PVY NTN and improves in planta protein production. Plant Biotechnol. Rep. 2013, 7, 547–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Primer Code | Target Gene | Direction | Nucleotide Sequences (5′-3′) | References |
|---|---|---|---|---|
| ITS | Internal Transcribed Spacer | Forward | TCCGTAGGTGAACCTGCGG | [30] |
| Reverse | TCCTCCGCTTATTGATATGC | |||
| rpb2 | RNA polymerase II subunit 2 | Forward | GAYGAYMGWGATCAYTTYGG | [31] |
| Reverse | CCCATRGCTTGYTTRCCCAT | |||
| tef1 | Translation elongation factor 1 alpha | Forward | CATCGAGAAGTTCGAGAAGG | [32] |
| Reverse | AACTTGCAGGCAATGTGG | |||
| TMV-CP | Tobacco mosaic virus-coat protein | Forward | ACGACTGCCGAAACGTTAGA | [33] |
| Reverse | CAAGTTGCAGGACCAGAGGT | |||
| PR-1 | Pathogenesis related protein-1 | Forward | CCAAGACTATCTTGCGGTTC | [34] |
| Reverse | GAACCTAAGCCACGATACCA | |||
| PR-2 | β-1,3-glucanases | Forward | TATAGCCGTTGGAAACGAAG | [34] |
| Reverse | CAACTTGCCATCACATTCTG | |||
| PR-7 | Proteinase | Forward | AACTGCAGAACAAGTGAAGG | [34] |
| Reverse | AACGTGATTGTAGCAACAGG | |||
| CHS | Chalcone synthase | Forward | CACCGTGGAGGAGTATCGTAAGGC | [35] |
| Reverse | TGATCAACACAGTTGGAAGGCG | |||
| HQT | Hydroxycinnamoyl Co A: quinate hydroxycinnamoyl transferase | Forward | CCCAATGGCTGGAAGATTAGCTA | [35] |
| Reverse | CATGAATCACTTTCAGCCTCAACAA | |||
| β-actin | Beta-actin | Forward | ATGCCATTCTCCGTCTTGACTTG | [36] |
| Reverse | GAGTTGTATGTAGTCTCGTGGATT |
| Treatment | Shoot ± SD * | |||||
|---|---|---|---|---|---|---|
| Length (cm) | Increase (%) | Fresh Weight (g) | Increase (%) | Dry Weight (g) | Increase (%) | |
| Mock | 33.44 ± 3.29 c | 44.64 | 7.59 ± 2.01 b | 27.99 | 3.23 ± 0.51 b | 12.54 |
| TMV | 23.12 ± 5.21 d | ----- | 5.93 ± 2.48 c | ----- | 2.87 ± 0.64 c | ----- |
| Th23 | 40.31 ± 3.34 a | 74.35 | 11.33 ± 3.97 a | 91.06 | 4.08 ± 0.41 a | 42.16 |
| Th23 + TMV | 34.73 ± 3.98 b | 50.22 | 7.54 ± 1.98 b | 27.15 | 3.21 ± 0.35 b | 11.85 |
| Treatment | Root ± SD * | |||||
|---|---|---|---|---|---|---|
| Length (cm) | Increase (%) | Fresh Weight (g) | Increase (%) | Dry Weight (g) | Increase (%) | |
| Mock | 11.41 ± 0.63 c | 16.91 | 4.11 ± 0.45 c | 34.75 | 2.03 ± 0.63 b | 11.54 |
| TMV | 9.76 ± 0.72 d | ----- | 3.05 ± 0.34 d | ----- | 1.82 ± 0.47 c | ----- |
| Th23 | 19.04 ± 2.14 a | 95.08 | 5.94 ± 1.19 a | 94.75 | 2.64 ± 0.51 a | 45.05 |
| Th23 + TMV | 14.56 ± 2.18 b | 49.18 | 4.75 ± 1.23 b | 55.74 | 2.05 ± 0.72 b | 12.64 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelkhalek, A.; Al-Askar, A.A.; Arishi, A.A.; Behiry, S.I. Trichoderma hamatum Strain Th23 Promotes Tomato Growth and Induces Systemic Resistance against Tobacco Mosaic Virus. J. Fungi 2022, 8, 228. https://doi.org/10.3390/jof8030228
Abdelkhalek A, Al-Askar AA, Arishi AA, Behiry SI. Trichoderma hamatum Strain Th23 Promotes Tomato Growth and Induces Systemic Resistance against Tobacco Mosaic Virus. Journal of Fungi. 2022; 8(3):228. https://doi.org/10.3390/jof8030228
Chicago/Turabian StyleAbdelkhalek, Ahmed, Abdulaziz A. Al-Askar, Amr A. Arishi, and Said I. Behiry. 2022. "Trichoderma hamatum Strain Th23 Promotes Tomato Growth and Induces Systemic Resistance against Tobacco Mosaic Virus" Journal of Fungi 8, no. 3: 228. https://doi.org/10.3390/jof8030228
APA StyleAbdelkhalek, A., Al-Askar, A. A., Arishi, A. A., & Behiry, S. I. (2022). Trichoderma hamatum Strain Th23 Promotes Tomato Growth and Induces Systemic Resistance against Tobacco Mosaic Virus. Journal of Fungi, 8(3), 228. https://doi.org/10.3390/jof8030228

