The Role of Dimorphism Regulating Histidine Kinase (Drk1) in the Pathogenic Fungus Paracoccidioides brasiliensis Cell Wall
Abstract
:1. Introduction
2. Materials and Methods
2.1. Fungal Isolates and Growth Conditions
2.2. Histidine Kinase Inhibitor Susceptibility
2.3. Dimorphic Transition Assay
2.4. Cell Wall Disturbing Agents Spot Test
2.5. RNA Extraction and Real-Time Quantitative PCR Analysis
2.6. Quantification of Cell Wall Components
2.7. Confocal Microscopy
2.8. PKA Activity and cAMP Quantification
2.9. Glycogen Accumulation
2.10. Phagocytosis Assay
2.11. Cytokines Determination
2.12. Statistical Analysis
3. Results
3.1. Susceptibility of P. brasiliensis to Drk1 Pharmacological Inhibitors
3.2. Role of PbDrk1 in P. brasiliensis Cell Wall Maintenance
3.3. Modulation of Cell Wall Gene Expression in P. brasiliensis
3.4. Modulation of the Cell Wall Components
3.5. Inhibition of PbDrk1 Induces Increased Phagocytosis of P. brasiliensis and Alters Cytokine Production by Macrophages
3.6. Regulation of cAMP-PKA and Glycogen Accumulation in P. brasiliensis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Shikanai-Yasuda, M.A.; Mendes, R.P.; Colombo, A.L.; de Queiroz Telles, F.; Kono, A.; Paniago, A.M.M.; Nathan, A.; do Valle, A.C.F.; Bagagli, E.; Benard, G.; et al. II Consenso Brasileiro em Paracoccidioidomicose-2017. Epidemiol. Serviços Saúde 2018, 27, e0500001. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chaves, A.F.A.; Navarro, M.V.; de Barros, Y.N.; Silva, R.S.; Xander, P.; Batista, W.L. Updates in Paracoccidioides biology and genetic advances in fungus manipulation. J. Fungi 2021, 7, 116. [Google Scholar] [CrossRef] [PubMed]
- Delboni Nunes, N.E.; Schmidt, E.B.; Massaroni Peçanha, M.A.; Zanotti, R.L.; Gonçalves Ferreira, C.U.; Lamas de Araújo, M.; Potratz, F.F.; Peçanha, P.M.; Batista Ferreira, M.E.; Delmaestro, D.; et al. Paracoccidioidomycosis: Epidemiological and Clinical Aspects in 546 Cases Studied in the State of Espírito Santo, Brazil. Am. J. Trop. Med. Hyg. 2017, 97, 836–844. [Google Scholar] [CrossRef] [Green Version]
- de Almeida, S.M. Central nervous system paracoccidioidomycosis: An overview. Braz. J. Infect. Dis. 2005, 9, 126–133. [Google Scholar] [CrossRef]
- de Almeida, F.A.; Neves, F.F.; Mora, D.J.; Dos Reis, T.A.; Sotini, D.M.; Ribeiro, B.D.M.; Andrade-Silva, L.E.; Nascentes, G.N.; Ferreira-Paim, K.; Silva-Vergara, M.L. Paracoccidioidomycosis in Brazilian Patients With and Without Human Immunodeficiency Virus Infection. Am. J. Trop. Med. Hyg. 2017, 96, 368–372. [Google Scholar] [CrossRef] [Green Version]
- Goughenour, K.D.; Rappleye, C.A. Antifungal therapeutics for dimorphic fungal pathogens. Virulence 2016, 8, 211–221. [Google Scholar] [CrossRef] [Green Version]
- Santos, L.A.; Grisolia, J.C.; Burger, E.; de Araujo Paula, F.B.; Dias, A.L.T.; Malaquias, L.C.C. Virulence factors of Paracoccidioides brasiliensis as therapeutic targets: A review. Antonie van Leeuwenhoek 2020, 5, 593–604. [Google Scholar] [CrossRef]
- Giusiano, G. The Trojan Horse Model in Paracoccidioides: A Fantastic Pathway to Survive Infecting Human Cells. Front. Cell. Infect. Microbiol. 2020, 10, 605679. [Google Scholar] [CrossRef]
- Calich, V.L.G.; Mamoni, R.L.; Loures, F.V. Regulatory T cells in paracoccidioidomycosis. Virulence 2019, 10, 810–821. [Google Scholar] [CrossRef] [Green Version]
- Boyce, K.J.; Andrianopoulos, A. Fungal dimorphism: The switch from hyphae to yeast is a specialized morphogenetic adaptation allowing colonization of a host. FEMS Microbiol. Rev. 2015, 39, 797–811. [Google Scholar] [CrossRef] [Green Version]
- Nemecek, J.C.; Wüthrich, M.; Klein, B.S. Global Control of Dimorphism and Virulence in Fungi. Science 2006, 312, 583–588. [Google Scholar] [CrossRef]
- Campos, C.B.L.; Di Benedette, J.P.T.; Morais, F.V.; Ovalle, R.; Nobrega, M.P. Evidence for the role of calcineurin in morphogenesis and calcium homeostasis during mycelium-to-yeast dimorphism of Paracoccidioides brasiliensis. Eukaryot. Cell 2008, 7, 1856–1864. [Google Scholar] [CrossRef] [Green Version]
- Puccia, R.; Vallejo, M.C.; Matsuo, A.L.; Longo, L.V.G. The Paracoccidioides Cell Wall: Past and Present Layers Toward Understanding Interaction with the Host. Front. Microbiol. 2011, 2, 257. [Google Scholar] [CrossRef] [Green Version]
- Hogan, L.H.; Klein, B.S. Altered expression of surface alpha-1,3-glucan in genetically related strains of Blastomyces dermatitidis that differ in virulence. Infect. Immun. 1994, 62, 3543–3546. [Google Scholar] [CrossRef] [Green Version]
- Klein, B.S.; Tebbets, B. Dimorphism and virulence in fungi. Curr. Opin. Microbiol. 2007, 10, 314–319. [Google Scholar] [CrossRef] [Green Version]
- Felipe, M.S.S.; Andrade, R.V.; Arraes, F.B.M.M.; Nicola, A.M.; Maranhão, A.Q.; Torres, F.A.G.G.; Silva-Pereira, I.; Poças-Fonseca, M.J.; Campos, E.G.; Moraes, L.M.P.P.; et al. Transcriptional profiles of the human pathogenic fungus Paracoccidioides brasiliensis in mycelium and yeast cells. J. Biol. Chem. 2005, 280, 24706–24714. [Google Scholar] [CrossRef] [Green Version]
- Lawry, S.M.; Tebbets, B.; Kean, I.; Stewart, D.; Hetelle, J.; Klein, B.S. Fludioxonil Induces Drk1, a Fungal Group III Hybrid Histidine Kinase, to Dephosphorylate its Downstream Target, Ypd1. Antimicrob. Agents Chemother. 2016, 61, e01414-16. [Google Scholar] [CrossRef] [Green Version]
- Hou, B.; Zhang, Z.; Zheng, F.; Liu, X. Molecular cloning, characterization and differential expression of DRK1 in Sporothrix schenckii. Int. J. Mol. Med. 2013, 31, 99–104. [Google Scholar] [CrossRef]
- Boyce, K.J.; Cao, C.; Andrianopoulos, A. Two-Component Signaling Regulates Osmotic Stress Adaptation via SskA and the High-Osmolarity Glycerol MAPK Pathway in the Human Pathogen Talaromyces marneffei. mSphere 2016, 1, e00086-15. [Google Scholar] [CrossRef] [Green Version]
- Chaves, A.F.A.; Navarro, M.V.; Castilho, D.G.; Calado, J.C.P.; Conceição, P.M.; Batista, W.L. A conserved dimorphism-regulating histidine kinase controls the dimorphic switching in Paracoccidioides brasiliensis. FEMS Yeast Res. 2016, 16, fow047. [Google Scholar] [CrossRef] [Green Version]
- Mizuno, T.; Wurtzel, E.T.; Inouye, M. Osmoregulation of gene expression. II. DNA sequence of the envZ gene of the ompB operon of Escherichia coli and characterization of its gene product. J. Biol. Chem. 1982, 257, 13692–13698. [Google Scholar] [CrossRef]
- Hérivaux, A.; So, Y.-S.; Gastebois, A.; Latgé, J.-P.; Bouchara, J.-P.; Bahn, Y.-S.; Papon, N. Major Sensing Proteins in Pathogenic Fungi: The Hybrid Histidine Kinase Family. PLoS Pathog. 2016, 12, e1005683. [Google Scholar] [CrossRef] [Green Version]
- Wuichet, K.; Cantwell, B.J.; Zhulin, I.B. Evolution and phyletic distribution of two-component signal transduction systems. Curr. Opin. Microbiol. 2010, 13, 219–225. [Google Scholar] [CrossRef] [Green Version]
- Catlett, N.L.; Yoder, O.C.; Turgeon, B.G. Whole-Genome Analysis of Two-Component Signal Transduction Genes in Fungal Pathogens. Eukaryot. Cell 2003, 2, 1151–1161. [Google Scholar] [CrossRef] [Green Version]
- Defosse, T.A.; Sharma, A.; Mondal, A.K.; de Bernonville, T.D.; Latgé, J.P.; Calderone, R.; Giglioli-Guivarc’h, N.; Courdavault, V.; Clastre, M.; Papon, N. Hybrid histidine kinases in pathogenic fungi. Mol. Microbiol. 2015, 95, 914–924. [Google Scholar] [CrossRef]
- Shor, E.; Chauhan, N. A Case for Two-Component Signaling Systems As Antifungal Drug Targets. PLoS Pathog. 2015, 11, e1004632. [Google Scholar] [CrossRef] [Green Version]
- Chauhan, N.; Latge, J.-P.; Calderone, R. Signalling and oxidant adaptation in Candida albicans and Aspergillus fumigatus. Nat. Rev. Microbiol. 2006, 4, 435–444. [Google Scholar] [CrossRef]
- Holbrook, E.D.; Rappleye, C.A. Histoplasma capsulatum pathogenesis: Making a lifestyle switch. Curr. Opin. Microbiol. 2008, 11, 318–324. [Google Scholar] [CrossRef]
- Castilho, D.G.; Navarro, M.V.; Chaves, A.F.A.A.; Xander, P.; Batista, W.L. Recovery of the Paracoccidioides brasiliensis virulence after animal passage promotes changes in the antioxidant repertoire of the fungus. FEMS Yeast Res. 2018, 18, foy007. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Nogueira, M.; Istel, F.; Jenull, S.; Walker, L.; Gow, N.; Lion, T. Quantitative Analysis of Candida Cell Wall Components by Flow Cytometry with Triple-Fluorescence Staining. J. Microbiol. Mod. Tech. 2017, 2, 101. [Google Scholar] [CrossRef]
- Bradford, M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- García, R.; Bravo, E.; Diez-Muñiz, S.; Nombela, C.; Rodríguez-Peña, J.M.; Arroyo, J. A novel connection between the Cell Wall Integrity and the PKA pathways regulates cell wall stress response in yeast. Sci. Rep. 2017, 7, 5703. [Google Scholar] [CrossRef] [PubMed]
- Crosby, L.; Casey, W.; Morgan, K.; Ni, H.; Yoon, L.; Easton, M.; Misukonis, M.; Burleson, G.; Ghosh, D.K. Murine J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. Nitric Oxide Biol. Chem. 2010, 22, 242–257. [Google Scholar] [CrossRef] [Green Version]
- Romera, L.M.D.; Kaihami, G.H.; Jannuzzi, G.P.; de Almeida, J.R.F.; de Almeida, S.R. The Critical Role of Notch1–TLR 4 Signaling in the Inflammatory and Fungicidal Activity of Macrophages Against Paracoccidioides brasiliensis Strain Pb18. Mycopathologia 2017, 182, 797–807. [Google Scholar] [CrossRef]
- Popi, A.F.; Daniel Lopes, J.; Mariano, M. GP43 from Paracoccidioides brasiliensis inhibits macrophage functions. An evasion mechanism of the fungus. Cell. Immunol. 2002, 218, 87–94. [Google Scholar] [CrossRef]
- Nuutila, J.; Lilius, E.M. Flow cytometric quantitative determination of ingestion by phagocytes needs the distinguishing of overlapping populations of binding and ingesting cells. Cytom. Part A 2005, 65, 93–102. [Google Scholar] [CrossRef]
- Arima, K.; Imanaka, H.; Kousaka, M.; Fukuta, A.; Tamura, G. Pyrrolnitrin, a New Antibiotic Substance, Produced by Pseudomonas. Agric. Biol. Chem. 1964, 28, 575–576. [Google Scholar] [CrossRef]
- Brandhorst, T.T.; Kean, I.R.L.; Lawry, S.M.; Wiesner, D.L.; Klein, B.S. Phenylpyrrole fungicides act on triosephosphate isomerase to induce methylglyoxal stress and alter hybrid histidine kinase activity. Sci. Rep. 2019, 9, 5047. [Google Scholar] [CrossRef]
- Cui, S.; Hassan, R.Y.A.; Heintz-Buschart, A.; Bilitewski, U. Regulation of Candida albicans interaction with macrophages through the activation of HOG pathway by genistein. Molecules 2016, 21, 162. [Google Scholar] [CrossRef] [Green Version]
- Kamei, M.; Yamashita, K.; Takahashi, M.; Fukumori, F.; Ichiishi, A.; Fujimura, M. Deletion and expression analysis of beta-(1,3)-glucanosyltransferase genes in Neurospora crassa. Fungal Genet. Biol. 2013, 52, 65–72. [Google Scholar] [CrossRef]
- McCormick, A.; Jacobsen, I.D.; Broniszewska, M.; Beck, J.; Heesemann, J.; Ebel, F. The two-component sensor kinase TcsC and its role in stress resistance of the human-pathogenic mold Aspergillus fumigatus. PLoS ONE 2012, 7, e38262. [Google Scholar] [CrossRef] [Green Version]
- Yoshimi, A.; Miyazawa, K.; Abe, K. Function and Biosynthesis of Cell Wall α-1,3-Glucan in Fungi. J. Fungi 2017, 3, 63. [Google Scholar] [CrossRef]
- Boyce, K.J.; Schreider, L.; Kirszenblat, L.; Andrianopoulos, A. The two-component histidine kinases DrkA and SlnA are required for in vivo growth in the human pathogen Penicillium marneffei. Mol. Microbiol. 2011, 82, 1164–1184. [Google Scholar] [CrossRef]
- Zhang, Z.; Hou, B.; Xin, Y.; Liu, X. Protein Profiling of the Dimorphic Pathogenic Fungus, Sporothrix schenckii. Mycopathologia 2012, 173, 1–11. [Google Scholar] [CrossRef]
- Roncero, C.; Durán, A. Effect of Calcofluor white and Congo red on fungal cell wall morphogenesis: In vivo activation of chitin polymerization. J. Bacteriol. 1985, 163, 1180–1185. [Google Scholar] [CrossRef] [Green Version]
- Ram, A.F.J.; Klis, F.M. Identification of fungal cell wall mutants using susceptibility assays based on Calcofluor white and Congo red. Nat. Protoc. 2006, 1, 2253–2256. [Google Scholar] [CrossRef]
- Ene, I.V.; Walker, L.A.; Schiavone, M.; Lee, K.K.; Martin-Yken, H.; Dague, E.; Gow, N.A.R.; Munro, C.A.; Brown, A.J.P. Cell wall remodeling enzymes modulate fungal cell wall elasticity and osmotic stress resistance. MBio 2015, 6, e00986-15. [Google Scholar] [CrossRef] [Green Version]
- Niño-Vega, G.A.; Munro, C.A.; San-Blas, G.; Gooday, G.W.; Gow, N.A. Differential expression of chitin synthase genes during temperature-induced dimorphic transitions in Paracoccidioides brasiliensis. Med. Mycol. 2000, 38, 31–39. [Google Scholar] [CrossRef]
- Zambuzzi-Carvalho, P.; Tomazett, P.; Santos, S.; Ferri, P.; Borges, C.; Martins, W.; de Almeida Soares, C.; Pereira, M. Transcriptional profile of Paracoccidioides induced by oenothein B, a potential antifungal agent from the Brazilian Cerrado plant Eugenia uniflora. BMC Microbiol. 2013, 13, 227. [Google Scholar] [CrossRef] [Green Version]
- Degani, G.; Popolo, L. The Glucan-Remodeling Enzyme Phr1p and the Chitin Synthase Chs1p Cooperate to Maintain Proper Nuclear Segregation and Cell Integrity in Candida albicans. Front. Cell. Infect. Microbiol. 2019, 9, 400. [Google Scholar] [CrossRef] [Green Version]
- Bolouri Moghaddam, M.-R.; Vilcinskas, A.; Rahnamaeian, M. The insect-derived antimicrobial peptide metchnikowin targets Fusarium graminearum β(1,3)glucanosyltransferase Gel1, which is required for the maintenance of cell wall integrity. Biol. Chem. 2017, 398, 491–498. [Google Scholar] [CrossRef]
- da Silva Castro, N.; Maia, Z.A.; Pereira, M.; de Almeida Soares, C.M. Screening for glycosylphosphatidylinositol-anchored proteins in the Paracoccidioides brasiliensis transcriptome. Genet. Mol. Res. 2005, 4, 326–345. [Google Scholar]
- Villalobos-Duno, H.; San-Blas, G.; Paulinkevicius, M.; Sánchez-Martín, Y.; Nino-Vega, G. Biochemical Characterization of Paracoccidioides brasiliensis α-1,3-Glucanase Agn1p, and Its Functionality by Heterologous Expression in Schizosaccharomyces pombe. PLoS ONE 2013, 8, e66853. [Google Scholar] [CrossRef] [Green Version]
- Gonçales, R.A.; Ricci-Azevedo, R.; Vieira, V.C.S.; Fernandes, F.F.; de Oliveira Thomaz, S.M.; Carvalho, A.; Vendruscolo, P.E.; Cunha, C.; Roque-Barreira, M.C.; Rodrigues, F. Paracoccin overexpression in Paracoccidioides brasiliensis enhances fungal virulence by remodeling chitin properties of the cell wall. J. Infect. Dis. 2020, 224, 164–174. [Google Scholar] [CrossRef]
- Wagener, J.; Striegler, K.; Wagener, N. α- and β-1,3-glucan synthesis and remodeling. Curr. Top. Microbiol. Immunol. 2020, 425, 53–82. [Google Scholar] [CrossRef]
- Kanetsuna, F.; Carbonell, L.M.; Azuma, I.; Yamamura, Y. Biochemical Studies on the Thermal Dimorphism of Paracoccidioides brasiliensis. J. Bacteriol. 1972, 110, 208–218. [Google Scholar] [CrossRef] [Green Version]
- Lin, C.J.; Wu, C.Y.; Yu, S.J.; Chen, Y.L. Protein kinase A governs growth and virulence in Candida tropicalis. Virulence 2018, 9, 331–347. [Google Scholar] [CrossRef]
- Caza, M.; Kronstad, J.W. The cAMP/Protein Kinase a Pathway Regulates Virulence and Adaptation to Host Conditions in Cryptococcus neoformans. Front. Cell. Infect. Microbiol. 2019, 9, 212. [Google Scholar] [CrossRef] [PubMed]
- Bravo Ruiz, G.; Lorenz, A. What do we know about the biology of the emerging fungal pathogen of humans Candida auris? Microbiol. Res. 2021, 242, 126621. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Zhou, M.; Xiong, Z.; Peng, F.; Wei, W. The cAMP-PKA Signaling Pathway Regulates Pathogenicity, Hyphal Growth, Appressorial Formation, Conidiation, and Stress Tolerance in Colletotrichum higginsianum. Front. Microbiol. 2017, 8, 1416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Yang, F.; Li, S.; Dai, J.; Deng, H. Glutaredoxin Deletion Shortens Chronological Life Span in Saccharomyces cerevisiae via ROS-Mediated Ras/PKA Activation. J. Proteome Res. 2018, 17, 2318–2327. [Google Scholar] [CrossRef] [PubMed]
- Freitas, F.Z.; de Paula, R.M.; Barbosa, L.C.B.; Terenzi, H.F.; Bertolini, M.C. cAMP signaling pathway controls glycogen metabolism in Neurospora crassa by regulating the glycogen synthase gene expression and phosphorylation. Fungal Genet. Biol. 2010, 47, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Smith, A.; Ward, M.P.; Garrett, S. Yeast PKA represses Msn2p/Msn4p-dependent gene expression to regulate growth, stress response and glycogen accumulation. EMBO J. 1998, 17, 3556–3564. [Google Scholar] [CrossRef] [Green Version]
- de Assis, L.J.; Manfiolli, A.; Mattos, E.; Fabri, J.H.T.M.; Malavazi, I.; Jacobsen, I.D.; Brock, M.; Cramer, R.A.; Thammahong, A.; Hagiwara, D.; et al. Protein Kinase A and High-Osmolarity Glycerol Response Pathways Cooperatively Control Cell Wall Carbohydrate Mobilization in Aspergillus fumigatus. MBio 2018, 9, e01952-18. [Google Scholar] [CrossRef] [Green Version]
- Schmelzle, T.; Beck, T.; Martin, D.E.; Hall, M.N. Activation of the RAS/cyclic AMP pathway suppresses a TOR deficiency in yeast. Mol. Cell. Biol. 2004, 24, 338–351. [Google Scholar] [CrossRef] [Green Version]
- Fisher, M.C.; Hawkins, N.J.; Sanglard, D.; Gurr, S.J. Worldwide emergence of resistance to antifungal drugs challenges human health and food security. Science 2018, 360, 739–742. [Google Scholar] [CrossRef] [Green Version]
- Kilani, J.; Fillinger, S. Phenylpyrroles: 30 years, two molecules and (nearly) no resistance. Front. Microbiol. 2016, 7, 2014. [Google Scholar] [CrossRef] [Green Version]
- Schumacher, M.M.; Enderlin, C.S.; Selitrennikoff, C.P. The osmotic-1 locus of Neurospora crassa encodes a putative histidine kinase similar to osmosensors of bacteria and yeast. Curr. Microbiol. 1997, 34, 340–347. [Google Scholar] [CrossRef]
- Motoyama, T.; Kadokura, K.; Ohira, T.; Ichiishi, A.; Fujimura, M.; Yamaguchi, I.; Kudo, T. A two-component histidine kinase of the rice blast fungus is involved in osmotic stress response and fungicide action. Fungal Genet. Biol. 2005, 42, 200–212. [Google Scholar] [CrossRef]
- Yamada-Okabe, T.; Mio, T.; Ono, N.; Kashima, Y.; Matsui, M.; Arisawa, M.; Yamada-Okabe, H. Roles of three histidine kinase genes in hyphal development and virulence of the pathogenic fungus Candida albicans. J. Bacteriol. 1999, 181, 7243–7247. [Google Scholar] [CrossRef] [Green Version]
- Dünkler, A.; Wendland, J.J.; Dünkler, A.; Wendland, J.J. Candida albicans Rho-type GTPase-encoding genes required for polarized cell growth and cell separation. Eukaryot. Cell 2007, 6, 844–854. [Google Scholar] [CrossRef] [Green Version]
- Preechasuth, K.; Anderson, J.C.; Peck, S.C.; Brown, A.J.P.; Gow, N.A.R.; Lenardon, M.D. Cell wall protection by the Candida albicans class I chitin synthases. Fungal Genet. Biol. 2015, 82, 264–276. [Google Scholar] [CrossRef] [Green Version]
- Barreto, L.; Sorais, F.; Salazar, V.; San-Blas, G.; Niño-Vega, G.A. Expression of Paracoccidioides brasiliensis CHS3 in a Saccharomyces cerevisiae CHS3 null mutant demonstrates its functionality as a chitin synthase gene. Yeast 2010, 27, 293–300. [Google Scholar] [CrossRef]
- De Quaglia e Silva, J.C.; Della Coletta, A.M.; Gardizani, T.P.; Romagnoli, G.G.; Kaneno, R.; Dias-Melicio, L.A. Involvement of the Dectin-1 Receptor upon the Effector Mechanisms of Human Phagocytic Cells against Paracoccidioides brasiliensis. J. Immunol. Res. 2019, 2019, 1529189. [Google Scholar] [CrossRef] [Green Version]
- Romagnolo, A.G.; de Quaglia e Silva, J.C.; Della Coletta, A.M.; Gardizani, T.P.; Martins, A.T.L.; Romagnoli, G.G.; Kaneno, R.; de Campos Soares, A.M.V.; De Faveri, J.; Dias-Melicio, L.A. Role of Dectin-1 receptor on cytokine production by human monocytes challenged with Paracoccidioides brasiliensis. Mycoses 2018, 61, 222–230. [Google Scholar] [CrossRef]
- Elieh Ali Komi, D.; Sharma, L.; Dela Cruz, C.S. Chitin and Its Effects on Inflammatory and Immune Responses. Clin. Rev. Allergy Immunol. 2018, 54, 213–223. [Google Scholar] [CrossRef] [Green Version]
- Yadav, B.; Mora-Montes, H.M.; Wagener, J.; Cunningham, I.; West, L.; Haynes, K.; Brown, A.J.P.; Gow, N.A.R. Differences in fungal immune recognition by monocytes and macrophages: N-mannan can be a shield or activator of immune recognition. Cell Surf. 2020, 6, 100042. [Google Scholar] [CrossRef]
- Donlin, M.J.; Upadhya, R.; Gerik, K.J.; Lam, W.; VanArendonk, L.G.; Specht, C.A.; Sharma, N.K.; Lodge, J.K. Cross talk between the cell wall integrity and cyclic AMP/protein kinase A pathways in Cryptococcus neoformans. MBio 2014, 5, e01573-14. [Google Scholar] [CrossRef] [Green Version]
- Cao, C.; Wu, M.; Bing, J.; Tao, L.; Ding, X.; Liu, X.; Huang, G. Global regulatory roles of the cAMP/PKA pathway revealed by phenotypic, transcriptomic and phosphoproteomic analyses in a null mutant of the PKA catalytic subunit in Candida albicans. Mol. Microbiol. 2017, 105, 46–64. [Google Scholar] [CrossRef] [Green Version]
- Sestari, S.J.; Brito, W.A.; Neves, B.J.; Soares, C.M.A.; Salem-Izacc, S.M. Inhibition of protein kinase A affects Paracoccidioides lutzii dimorphism. Int. J. Biol. Macromol. 2018, 113, 1214–1220. [Google Scholar] [CrossRef] [PubMed]
- Sassone-Corsi, P. The cyclic AMP pathway. Cold Spring Harb. Perspect. Biol. 2012, 4, a011148. [Google Scholar] [CrossRef] [PubMed]
- Koschinski, A.; Zaccolo, M. Activation of PKA in cell requires higher concentration of cAMP than in vitro: Implications for compartmentalization of cAMP signalling. Sci. Rep. 2017, 7, 14090. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arvindekar, A.U.; Patil, N.B. Glycogen: A covalently linked component of the cell wall in Saccharomyces cerevisiae. Yeast 2002, 19, 131–139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kurokawa, C.S.; Araujo, J.P.; Soares, A.M.V.C.; Sugizaki, M.F.; Peraçoli, M.T.S. Pro- and anti-inflammatory cytokines produced by human monocytes challenged in vitro with Paracoccidioides brasiliensis. Microbiol. Immunol. 2007, 51, 421–428. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tristão, F.S.M.; Rocha, F.A.; Carlos, D.; Ketelut-Carneiro, N.; Souza, C.O.S.; Milanezi, C.M.; Silva, J.S. Th17-Inducing Cytokines IL-6 and IL-23 Are Crucial for Granuloma Formation during Experimental Paracoccidioidomycosis. Front. Immunol. 2017, 8, 949. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fortes, M.R.P.; Miot, H.A.; Kurokawa, C.S.; Marques, M.E.A.; Marques, S.A. Immunology of paracoccidioidomycosis. An. Bras. Dermatol. 2011, 86, 516–525. [Google Scholar] [CrossRef] [PubMed]
- Burger, E. Paracoccidioidomycosis protective immunity. J. Fungi 2021, 7, 137. [Google Scholar] [CrossRef]
- Davis, M.R.; Thompson, G.R.; Patterson, T.F. Fungal Infections Potentiated by Biologics. Infect. Dis. Clin. N. Am. 2020, 34, 389–411. [Google Scholar] [CrossRef]
- Thompson, A.; Orr, S.J. Emerging IL-12 family cytokines in the fight against fungal infections. Cytokine 2018, 111, 398–407. [Google Scholar] [CrossRef]
Gene | Sequence (5′–3′) | Gene ID |
---|---|---|
L34 | Foward: AAAGGAACCGCACCAAAATG Reverse: AGACCTGGGAGTATTCACGG | PADG_04402 |
18S | Foward: CGGAGAGAGGGAGCCTGAGAA Reverse: GGGATTGGGTAATTTGCGC | ADG_12090 |
FKS1 | Forward: GTTCCCATCACCGATCCTATTT Reverse: GAAGGAGAGCAAGAAGACGATAC | PADG_11846 |
KRE6 | Foward: TTCCGACGAGTTCAACAAAGA Reverse: CTGCGTCACTCCATACCAAATA | PADG_07170 |
PHR2 | Foward: ACTGAGGACAAACACCATCAG Reverse: ACAGATCTGCAACGACGTAAA | PADG_04918 |
GEL3 | Foward: CGTTGTCAGCGGAGGTATCGTC Reverse: AGGGCAGGTTCGGAGTTCAGTG | PADG_04918 |
AGN1 | Foward: AAATGCGGCACGGAGGAGA Reverse: AAGGGTGGTATCAAGTGCCGAGT | PADG_03169 |
CHT3 | Foward: GCGAGGAATTGGGTGATAGAA Reverse: AGGGTTGACGCTATCAGAAATAA | PADG_08156 |
CHS2 | Foward: CCCGAACCTACTGCACTTTATC Reverse: TGCCCTTACCCGCTTTAATC | PADG_08636 |
CHS3 | Foward: CGCTATGGTTAAGGATCCCGAGA Reverse: GCATCCAGGCAAGCAAGTAACA | O94191_PARB |
CHS4 | Foward: ACCGGATGAGGCCACTATTACAGA Reverse: GTCTGCAATCGCTGCTCAACG | PADG_07911 |
CHS5 | Foward: AGAGTATCAAGGCTGAGCTGGAACG Reverse: CGGAAAGGACGGCTTCGGTT | A9XTF9_PARBR |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Navarro, M.V.; de Barros, Y.N.; Segura, W.D.; Chaves, A.F.A.; Jannuzzi, G.P.; Ferreira, K.S.; Xander, P.; Batista, W.L. The Role of Dimorphism Regulating Histidine Kinase (Drk1) in the Pathogenic Fungus Paracoccidioides brasiliensis Cell Wall. J. Fungi 2021, 7, 1014. https://doi.org/10.3390/jof7121014
Navarro MV, de Barros YN, Segura WD, Chaves AFA, Jannuzzi GP, Ferreira KS, Xander P, Batista WL. The Role of Dimorphism Regulating Histidine Kinase (Drk1) in the Pathogenic Fungus Paracoccidioides brasiliensis Cell Wall. Journal of Fungi. 2021; 7(12):1014. https://doi.org/10.3390/jof7121014
Chicago/Turabian StyleNavarro, Marina Valente, Yasmin Nascimento de Barros, Wilson Dias Segura, Alison Felipe Alencar Chaves, Grasielle Pereira Jannuzzi, Karen Spadari Ferreira, Patrícia Xander, and Wagner Luiz Batista. 2021. "The Role of Dimorphism Regulating Histidine Kinase (Drk1) in the Pathogenic Fungus Paracoccidioides brasiliensis Cell Wall" Journal of Fungi 7, no. 12: 1014. https://doi.org/10.3390/jof7121014
APA StyleNavarro, M. V., de Barros, Y. N., Segura, W. D., Chaves, A. F. A., Jannuzzi, G. P., Ferreira, K. S., Xander, P., & Batista, W. L. (2021). The Role of Dimorphism Regulating Histidine Kinase (Drk1) in the Pathogenic Fungus Paracoccidioides brasiliensis Cell Wall. Journal of Fungi, 7(12), 1014. https://doi.org/10.3390/jof7121014