Genetic Diversity and Population Structure of Didymella rabiei Affecting Chickpea in Ethiopia
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection, Pathogen Isolation and DNA Extraction
2.2. Pathogen Sequencing
2.3. SSR Amplification
2.4. Data Analyses
2.4.1. Internal Transcribed Spacer Region
2.4.2. SSR Polymorphism and Genetic Diversity
2.4.3. Analysis of Molecular Variance
2.4.4. Analyses of Allelic Patterns
2.4.5. Cluster Analysis, Principal Component Analysis, and Population Genetic Structure
3. Results
3.1. Pathogen Identity
3.2. SSR Polymorphism and Gene Diversity
3.3. Population Genetic differentiation and Gene Flow
3.4. Population Genetic Diversity Analysis
3.5. Cluster Analysis, Principal Component Analysis, and Population Genetic Structure
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAOSTAT. Food and Agriculture Organization of the United States of America. 2019. Available online: http://www.fao.org/faostat/en/#data/QC/visualize (accessed on 30 September 2019).
- CSA. Agricultural Sample Survey Report on area and production for major crops (private peasant holdings, Meher season). Stat. Bull. 2018, 584, 1–57. [Google Scholar]
- Fikre, A.; Desmae, H.; Ahmed, S. Tapping the economic potential of chickpea in sub-Saharan Africa. Agronomy 2020, 10, 1707. [Google Scholar] [CrossRef]
- Frenkel, O.; Peever, T.L.; Chilvers, M.I.; Özkilinc, H.; Can, A.; Abbo, S.; Shtienberg, D.; Sherman, A. Ecological genetic divergence of the fungal pathogen Didymella rabiei on sympatric wild and domesticated Cicer spp. (chickpea). Appl. Environ. Microbiol. 2010, 76, 30–39. [Google Scholar] [CrossRef]
- Deokar, A.; Sagi, M.; Daba, K.; Tar’an, B. QTL sequencing strategy to map genomic regions associated with resistance to Ascochyta blight in chickpea. Plant Biotechnol. J. 2019, 17, 275–288. [Google Scholar] [CrossRef] [PubMed]
- Nene, Y.L.; Sheila, V.K.; Sharma, S.B. A World List of Chickpea and Pigeonpea Pathogens; ICRISAT: Patancheru, India, 1996; p. 27. [Google Scholar]
- Pande, S.; Sharma, M.; Gaur, P.M.; Gowda, C.L.L. Host plant resistance to Ascochyta blight of chickpea. Inf. Bull. 2010, 82, 1–40. Available online: http://oar.icrisat.org/184/1/24_2010_IB_no_82_Host_Plant.pdf (accessed on 29 September 2021).
- Sharma, M.; Ghosh, R. An update on genetic resistance of chickpea to Ascochyta blight. Agronomy 2016, 6, 18. [Google Scholar] [CrossRef]
- Shtienberg, D.; Vintal, H.; Brener, S.; Retig, B. Rational management of Didymella rabiei in chickpea by integration of genotype resistance and post infection application of fungicides. Phytopathology 2000, 90, 834–842. [Google Scholar] [CrossRef] [PubMed]
- Abbo, S.; Berger, J.; Turner, N.C. Evolution of cultivated chickpea: Four bottlenecks limit diversity and constrain adaptation. Funct. Plant Biol. 2003, 30, 1081–1087. [Google Scholar] [CrossRef]
- Knights, T.; Siddique, K. Chickpea status and production constraints in Australia. In Update of Research in Progress at the Tamworth Agricultural Institute; Tamworth, N.S.W., Ed.; CAB international: Wallingford, UK, 2002; pp. 16–19. [Google Scholar]
- Harveson, R.M.; Markell, S.G.; Goswami, R.; Urrea, C.A.; Burrows, M.E.; Dugan, F.; Chen, W.; Skoglund, L.G. Ascochyta Blight of Chickpeas. Plant Health Prog. 2011, 12, 30. [Google Scholar] [CrossRef]
- Rani, U.; Singh, S.; Basandrai, A.K.; Rathee, V.K.; Tripathi, K.; Singh, N.; Dixit, G.P.; Rana, J.C.; Pandey, S.; Kumar, A.; et al. Identification of novel resistant sources for ascochyta blight (Ascochyta rabiei) in chickpea. PLoS ONE 2020, 15, e0240589. [Google Scholar]
- Kim, W.; Park, C.-M.; Park, J.-J.; Akamatsu, H.O.; Peever, T.L.; Xian, M.; Gang, D.R.; VanDeMark, G.; Chen, W. Functional analyses of the Diels-Alderase gene sol5 of Ascochyta rabiei and Alternaria solani indicate that the solanapyrone phytotoxins are not required for pathogenicity. Mol. Plant-Microbe Interact. 2015, 28, 482–496. [Google Scholar] [CrossRef]
- Mahiout, D. Physiological characterization of Ascochyta rabiei (Pass.) Lab. isolated from diseased chickpea fields in six regions of northwestern Algeria. Am. Eurasian J. Agric. Environ. Sci. 2015, 15, 1136–1146. [Google Scholar]
- Baite, M.S.; Dubey, S.C.; Singh, B. “Morphological variability in the Indian isolates of Ascochyta rabiei causing blight in chickpea and evaluation of chickpea cultivars. Indian J. Plant Prot. 2016, 44, 74–82. [Google Scholar]
- Bahr, L.; Castelli, M.V.; Barolo, M.I.; Mostacero, N.R.; Tosello, M.E.; López, S.N. Ascochyta blight: Isolation, characterization, and development of a rapid method to detect inhibitors of the chickpea fungal pathogen Ascochyta rabiei. Fungal Biol. 2016, 120, 424–432. [Google Scholar] [CrossRef] [PubMed]
- Ozkilinc, H. The most recent status of genetic structure of Didymella rabiei (Ascochyta rabiei) populations in Turkey and the first genotype MPMI profile of the pathogen from the wild ancestor; Cicer reticulatum. Phytoparasitica 2019, 47, 263–273. [Google Scholar] [CrossRef]
- Gan, Y.T.; Siddique, K.H.M.; Macleod, W.J.; Jayakumar, P. Management options for minimizing the damage by Ascochyta blight (Ascochyta rabiei) in chickpea (Cicer arietinum L.). Field Crop. Res. 2006, 97, 121–134. [Google Scholar] [CrossRef]
- Chen, W.; Coyne, C.J.; Peever, T.L.; Muehlbauer, F.J. Characterization of chickpea differentials for pathogenicity assay of ascochyta blight and identification of chickpea accessions resistant to Didymella rabiei. Plant Pathol. 2004, 53, 759–769. [Google Scholar] [CrossRef]
- Ellegren, H. Microsatellites: Simple sequences with complex evolution. Nat. Rev. Genet. 2004, 5, 435–445. [Google Scholar] [CrossRef]
- Varshney, R.; Pande, S.; Kannan, S.; Mahendar, T.; Sharma, M.; Gaur, P.; Hoisington, D. Assessment and comparison of AFLP and SSR based molecular genetic diversity in Indian isolates of Ascochyta rabiei, a causal agent of Ascochyta blight in chickpea (Cicer arietinum L.). Mycol. Prog. 2009, 8, 87–97. [Google Scholar] [CrossRef]
- Moges, A.D.; Admassu, B.; Belew, D.; Yesuf, M.; Njuguna, J.; Kyalo, M.; Ghimire, S.R. Development of microsatellite markers and analysis of genetic diversity and population structure of Colletotrichum gloeosporioides from Ethiopia. PLoS ONE 2016, 11, e0151257. [Google Scholar] [CrossRef]
- Geistlinger, J.; Weising, K.; Winter, P.; Kahl, G. Locus-specific microsatellite markers for the fungal chickpea pathogen Didymella rabiei (anarmoph) Ascochyta rabiei. Mol. Ecol. 2000, 9, 1939–1941. [Google Scholar] [CrossRef]
- Mason, A.S. SSR genotyping. In Plant Genotyping; Humana Press: New York, NY, USA, 2015; pp. 77–89. [Google Scholar]
- Weising, K.; Kaemmer, D.; Weigand, J.T.E.F.; Saxena, M.; Kahl, G. DNA fingerprinting of Ascochyta rabiei with synthetic oligodeoxynucleotides. Curr. Genet. 1991, 19, 483–489. [Google Scholar] [CrossRef]
- Morjane, H.; Geistlinger, J.; Harrabi, M.; Weising, K.; Kahl, G. Oligonucleotide fingerprinting detects genetic diversity among Ascochyta rabiei isolates from a single chickpea field in Tunisia. Curr. Genet. 1994, 26, 191–197. [Google Scholar] [CrossRef] [PubMed]
- Bayraktar, H.; Dolar, F.S.; Tör, M. Determination of genetic diversity within Ascochyta rabiei (Pass.) Labr., the cause of ascochyta blight of chickpea in Turkey. J. Plant Pathol. 2007, 89, 341–347. [Google Scholar]
- Geistlinger, J. Detection of microsatellite fingerprint markers and their Mendelian inheritance in Ascochyta rabiei. Curr. Genet. 1997, 101, 1113–1121. [Google Scholar] [CrossRef]
- Bejiga, G. Ascochyta blight situation of chickpea in Ethiopia. In Ascochyta Blight and Winter Sowing of Chickpeas; Saxena, M.C., Singh, K.B., Eds.; Martinus Nijhoff/Dr. W. Junk: The Hague, The Netherland, 1984; pp. 269–271. [Google Scholar]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Academic Press Inc.: Cambridge, MA, USA, 1989; pp. 315–322. [Google Scholar]
- Liu, K.; Muse, S.V. PowerMarker: An integrated analysis environment for genetic marker analysis. Bioinformatics 2005, 21, 2128–2129. [Google Scholar] [CrossRef]
- Peakal, S. Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 288–295. [Google Scholar] [CrossRef]
- Nei, M. Genetic Distance between Populations. Am. Nat. 1972, 106, 283–292. [Google Scholar] [CrossRef]
- Pritchard, J.K.; Stephens, M.; Rosenberg, N.; Donnelly, P. Association mapping in structured populations. Am. J. Hum. Genet. 2000, 67, 170–181. [Google Scholar] [CrossRef]
- Earl, D.A.; vonHoldt, B.M. STRUCTURE HARVESTER: A website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv. Genet. Resour. 2012, 4, 359–361. [Google Scholar] [CrossRef]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef]
- Keneni, G.; Bekele, E.; Assefa, F.; Imtiaz, M.; Debele, T. Evaluation of Ethiopian chickpea (Cicer arietinum L.) germplasm accessions for symbio-agronomic performance. Renew. Agric. Food Syst. 2012, 28, 338–349. [Google Scholar] [CrossRef]
- Marshall, T.C.; Slate, J.B.K.E.; Kruuk, L.E.B.; Pemberton, J.M. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol. 1998, 7, 639–655. [Google Scholar] [CrossRef]
- Marulanda, M.L.; López, A.M.; Isaza, L.; López, P. Microsatellite isolation and characterization for Colletotrichum spp, causal agent of anthracnose in Andean blackberry. Genet. Mol. Res. 2014, 13, 7673–7685. [Google Scholar] [CrossRef]
- Nourollahi, K.; Javannikkhah, M.; Naghavi, M.R.; Lichtenzveig, J.; Okhovat, S.M.; Oliver, R.P.; Ellwood, S.R. Genetic diversity and population structure of Ascochyta rabiei from the western Iranian Ilam and Kermanshah provinces using MAT and SSR markers. Mycol. Prog. 2010, 10, 1–7. [Google Scholar] [CrossRef]
- Ozkilinc, H.; Frenkel, O.; Abbo, S.; Eshed, R.; Sherman, A.; Shtienberg, D.; Ophir, R.; Can, C. A comparative study of Turkish and Israeli populations of Didymella rabiei, the ascochyta blight pathogen of chickpea. Plant Pathol. 2009, 59, 492–503. [Google Scholar] [CrossRef]
- Rhaiem, A.; Chérif, M.; Peever, T.L.; Dyer, P.S. Population structure and mating system of Ascochyta rabiei in Tunisia: Evidence for the recent introduction of mating type 2. Plant Pathol. 2008, 57, 540–551. [Google Scholar] [CrossRef]
- Phan, H.T.T.; Ford, R.; Taylor, P.W.J. Population structure of Ascochyta rabiei in Australia based on STMS fingerprints. Fungal Divers. 2003, 13, 111–129. [Google Scholar]
- Vail, S.; Banniza, S. Molecular variability and mating-type frequency of Ascochyta rabiei of chickpea from Saskatchewan; Canada. Aust. Plant Pathol. 2009, 38, 392–398. [Google Scholar] [CrossRef]
- Leo, A.E.; Celeste-Linde, C.; Rebecca, F. Defence gene expression profiling to Ascochyta rabiei aggressiveness in chickpea. Theor. Appl. Genet. 2016, 129, 1333–1345. [Google Scholar] [CrossRef]
- Mehmood, Y.; Sambasivam, P.T.; Kaur, S.; Davidson, J.; Leo, A.E.; Hobson, K.; Linde, C.C.; Moore, K.J.; Brownlie, J.; Ford, R. Evidence and consequence of a highly adapted clonal haplotype within the Australian Ascochyta rabiei population. Front. Plant Sci. 2017, 8, 1029. [Google Scholar] [CrossRef] [PubMed]
- Mcdonald, B.A. Population genetics of soilborne fungal plant pathogens the population genetics of fungi: Tools and Techniques. Phytopatology 1997, 87, 448–453. [Google Scholar] [CrossRef] [PubMed]
- Elhaik, E. Empirical distributions of FST from large-scale human polymorphism data. PLoS ONE 2012, 21, e49837. [Google Scholar] [CrossRef]
- Feliner, G.N.; Bota, Â. Fine-scale geographical structure; intra-individual polymorphism and recombination in nuclear ribosomal internal transcribed spacers in Armeria (Plumbaginaceae). Ann. Bot. 2004, 93, 189–200. [Google Scholar] [CrossRef]
- Attar, B.; Ahmed, S.; Kayim, M.; Choueiri, E.; Ghannam, H.A.; Hamwieh, A. Role of sexual reproduction in the aggressiveness of Didymella rabiei affecting chickpea. Arab. Soc. Plant Prot. 2020, 38, 17–24. [Google Scholar] [CrossRef]
- Benzohra, I.E.; Bendahmane, B.S.; Labdi, M.; Benkada, M.Y. Identification of pathotypes and physiological races in Ascochyta rabiei (Pass.) Labr.; The agent of Ascochyta blight in chickpea (Cicer arietinum) in Algeria. World Appl. Sci. J. 2011, 15, 978–984. [Google Scholar]
- Getaneh, G.; Tefera, T.; Lemessa, F.; Ahmed, S.; Villinger, J. Distribution and mating type characterization of chickpea blight (Didymella rabiei (Kov.) v. Arx) in Ethiopia. Curr. Plant Biol. 2021, 28, 100220. [Google Scholar] [CrossRef]
- Trapero-Casas, A.; Kaiser, W.J. Development of Didymella rabiei, the teleomorph of Ascochyta rabiei, on chickpea straw. Phytopathology 1992, 82, 1261–1266. [Google Scholar] [CrossRef]
- Bar, I.; Sambasivam, P.T.; Davidson, J.; Farfan-Caceres, L.M.; Lee, R.C.; Hobson, K.; Ford, R. Current population structure and pathogenicity patterns of Ascochyta rabiei in Australia. Microb. Genom. 2021, 7, 000627. [Google Scholar]
- Atik, O.; Ahmed, S.; Abang., M.M.; Imtiaz, M.; Hamwieh, A.; Baum, M.; El-Ahmed, A.; Murad, S.; Yabrak, M.M. Pathogenic and genetic diversity of Didymella rabiei affecting chickpea in Syria. Crop. Prot. 2013, 46, 70–89. [Google Scholar] [CrossRef]
- Ozkilinc, H.; Frenkel, O.; Shtienberg, D. Aggressiveness of eight Didymella rabiei isolates from domesticated and wild chickpea native to Turkey and Israel; a case study. Eur. J. Plant Pathol. 2011, 131, 529–537. [Google Scholar] [CrossRef]
- Leo, A.E.; Ford, R.; Linde, C.C. Genetic homogeneity of a recently introduced pathogen of chickpea, Ascochyta rabiei, to Australia. Biol. Invasions 2015, 17, 609–623. [Google Scholar] [CrossRef]





| Locus | Forward Primer Sequences (5′ to 3′) | Reverse Primer Sequences (5′ to 3′) | Expected Allele Size | Repeat Motifs |
|---|---|---|---|---|
| ArH02T | CTGTATAGCGTTACTGTGTG | TCCATCCGTCTTGACATCCG | 273–411 | GAA and GTA |
| ArA03T | TAGGTGGCTAAATCTGTAGG | CAGCAATGGCAACGAGCACG | 285–435 | GAA |
| ArA06T | CTCGAAACACATTCCTGTGC | GGTAGAAACGACGAATAGGG | 164–188 | CAACAC and CAC |
| ArA08T | CAGAGGGGAATTGTTGTTC | ACGACGAGGATGAGGACTTC | 264–267 | CTTCCT and CTT |
| ArH05T | CATTGTGGCATCTGACATCAC | TGGATGGGAGGTTTTTGGTA | 213–285 | CTT |
| ArR01D | CAGAGGGGAGTCACAAGTATC | GAGTTACAGCTGCAAGACATTC | 181–213 | GTGTGTGG |
| Marker | MAF | Gn | Na | Ne | I | Gd | Ho | He | uHe | PIC | Nm | F | HWE | ||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ChiSq | Prob (P) | Sign. | |||||||||||||
| ArH02T | 0.21 | 16 | 18 | 7.23 | 2.29 | 0.87 | 0.92 | 0.86 | 0.87 | 0.86 | 2.40 | -0.11 | 993.99 | 0.000 | *** |
| ArA03T | 0.45 | 14 | 8 | 3.38 | 1.47 | 0.73 | 0.19 | 0.70 | 0.71 | 0.70 | 3.52 | 0.72 | 272.773 | 0.000 | *** |
| ArA06T | 0.53 | 5 | 4 | 2.11 | 0.83 | 0.53 | 0.17 | 0.53 | 0.53 | 0.42 | 24.10 | 0.68 | 60.328 | 0.000 | *** |
| ArA08T | 0.77 | 4 | 3 | 1.24 | 0.34 | 0.38 | 0.17 | 0.19 | 0.20 | 0.35 | 6.15 | 0.00 | 0.001 | 0.978 | ns |
| ArH05T | 0.27 | 18 | 15 | 6.66 | 2.18 | 0.86 | 0.55 | 0.85 | 0.86 | 0.85 | 1.51 | 0.31 | 641.142 | 0.000 | *** |
| ArR01D | 0.82 | 4 | 3 | 1.31 | 0.40 | 0.31 | 0.01 | 0.24 | 0.24 | 0.29 | 1.81 | 0.95 | 82.756 | 0.000 | *** |
| Mean | 0.51 | 10.17 | 8.5 | 3.66 | 1.25 | 0.61 | 0.33 | 0.56 | 0.57 | 0.58 | 6.58 | 0.43 | |||
| Population | N | Na | Na Freq. ≥ 5% | Ne | I | No. Private Alleles | He | uHe | % of Polymorphic Loci |
|---|---|---|---|---|---|---|---|---|---|
| Pop-A | 77 | 6.50 | 3.33 | 3.36 | 1.18 | 3.33 | 0.56 | 0.57 | 100.00 |
| Pop-B | 13 | 3.67 | 2.67 | 2.41 | 0.86 | 0.33 | 0.46 | 0.48 | 83.33 |
| Pop-C | 6 | 2.50 | 2.50 | 2.28 | 0.69 | 0.67 | 0.40 | 0.44 | 66.67 |
| Mean | 4.2 | 2.83 | 2.68 | 0.91 | 1.44 | 0.47 | 0.50 | 83.33 |
| Source | df | SS | MS | Est. Var. | % | Stat | Value | p |
|---|---|---|---|---|---|---|---|---|
| Among Pops | 2 | 26.11 | 13.10 | 0.49 | 8% | PhiPT | 0.085 | 0.05 |
| Within Pops | 93 | 488.13 | 5.25 | 5.25 | 92% | Nm | 2.7 | |
| Total | 95 | 514.24 | 5.74 | 100% |
| Population | N | Na | Ne | Na Freq. ≥ 5% | I | No. Private Alleles | Ho | He | uHe | % of Polymorphic Loci |
|---|---|---|---|---|---|---|---|---|---|---|
| Pop-A | 73.00 | 6.50 | 3.36 | 3.33 | 1.18 | 3.33 | 0.34 | 0.56 | 0.57 | 100.00 |
| Pop-B | 12.33 | 3.67 | 2.41 | 2.67 | 0.86 | 0.33 | 0.46 | 0.46 | 0.48 | 83.33 |
| Pop-C | 5.33 | 2.50 | 2.28 | 2.50 | 0.69 | 0.67 | 0.28 | 0.40 | 0.44 | 66.67 |
| Mean | 83.33 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Getaneh, G.; Tefera, T.; Lemessa, F.; Ahmed, S.; Fite, T.; Villinger, J. Genetic Diversity and Population Structure of Didymella rabiei Affecting Chickpea in Ethiopia. J. Fungi 2021, 7, 820. https://doi.org/10.3390/jof7100820
Getaneh G, Tefera T, Lemessa F, Ahmed S, Fite T, Villinger J. Genetic Diversity and Population Structure of Didymella rabiei Affecting Chickpea in Ethiopia. Journal of Fungi. 2021; 7(10):820. https://doi.org/10.3390/jof7100820
Chicago/Turabian StyleGetaneh, Gezahegne, Tadele Tefera, Fikre Lemessa, Seid Ahmed, Tarekegn Fite, and Jandouwe Villinger. 2021. "Genetic Diversity and Population Structure of Didymella rabiei Affecting Chickpea in Ethiopia" Journal of Fungi 7, no. 10: 820. https://doi.org/10.3390/jof7100820
APA StyleGetaneh, G., Tefera, T., Lemessa, F., Ahmed, S., Fite, T., & Villinger, J. (2021). Genetic Diversity and Population Structure of Didymella rabiei Affecting Chickpea in Ethiopia. Journal of Fungi, 7(10), 820. https://doi.org/10.3390/jof7100820

